ID: 1048825044

View in Genome Browser
Species Human (GRCh38)
Location 8:138416140-138416162
Sequence ATTTTGTCCTGGGGGATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048825044_1048825050 2 Left 1048825044 8:138416140-138416162 CCCTTGATCCCCCAGGACAAAAT 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data
1048825044_1048825051 16 Left 1048825044 8:138416140-138416162 CCCTTGATCCCCCAGGACAAAAT 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1048825051 8:138416179-138416201 TACTTTTGGAGTACAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048825044 Original CRISPR ATTTTGTCCTGGGGGATCAA GGG (reversed) Intronic
902084039 1:13843572-13843594 ATTTTTTCCTGTGGGATCAGTGG + Intergenic
902217310 1:14942570-14942592 ATTTTCTCCTGGGAGATGAGGGG + Intronic
902644012 1:17785445-17785467 CTTTTGTCCTGGGAGATAAGAGG + Intronic
907912431 1:58838271-58838293 ATTTTCTCCTGTGGCATCAGTGG + Intergenic
909154469 1:72054910-72054932 TAATTATCCTGGGGGATCAAAGG + Intronic
909201150 1:72691867-72691889 ATTTTGTCCTGGGGGTTCTTTGG + Intergenic
917685800 1:177414568-177414590 ATTTTGCCTTAGGGGATGAATGG - Intergenic
921741641 1:218691925-218691947 ATTTTCTCCAGGGGAATAAAAGG - Intergenic
923415758 1:233758101-233758123 ATTTTGATCTGGGGCTTCAAAGG - Intergenic
924395502 1:243615543-243615565 ATTTTATTCAGGGGGATGAAAGG + Intronic
1062865047 10:845233-845255 TTTTTGTTTTGGGGGATAAAGGG - Intronic
1067975357 10:51018629-51018651 ATTCTGTCCTGAGTGATTAATGG - Intronic
1073300345 10:102467541-102467563 ATTTTCTTCAGGGGGTTCAAGGG + Intronic
1073956216 10:108874375-108874397 ATTTTGCCCTGGGAGGGCAAGGG + Intergenic
1074362593 10:112835128-112835150 CTTTTGTCCTGGGAGATCCAGGG - Intergenic
1074440207 10:113471350-113471372 CCTTTGTCCTTGGGGTTCAATGG - Intergenic
1079902460 11:26204311-26204333 GTGTTGTCCTGGGGGATAAGTGG - Intergenic
1080426959 11:32163885-32163907 ATTTGGTCCTGGGGCAGCACAGG - Intergenic
1080446758 11:32344804-32344826 GTTCTTTCCTGGGGGATGAAGGG - Intergenic
1080821018 11:35806610-35806632 AATTGCTCCTGGTGGATCAAAGG - Exonic
1087575402 11:99983790-99983812 ATATTGGCCTGGGGGTTCAAAGG + Intronic
1089011084 11:115132384-115132406 ATTTTGGCTTGGGGGATGGAGGG + Intergenic
1089498503 11:118919538-118919560 AGTTTGTACTGGGGGGTCAAAGG + Intronic
1089504822 11:118956251-118956273 ATTTTGTCCTGGGGGTGGGAGGG - Intronic
1091244916 11:134084047-134084069 TTTTTCTACTGGGGGATCACAGG + Intronic
1095081127 12:38000877-38000899 ATTTTCTCCATGGGCATCAATGG - Intergenic
1095392925 12:41729890-41729912 TTTTTTTCCTGGGGGAACAATGG - Intergenic
1096028113 12:48385994-48386016 ATTTTTTCTTGGGGCACCAATGG - Intergenic
1096389116 12:51215728-51215750 ATTTTGACATGAGGGGTCAAAGG + Intronic
1096916035 12:55034558-55034580 ATTTAGTACTGGAGGAGCAAAGG + Intergenic
1098160342 12:67643463-67643485 CATTTGTCCTGCTGGATCAAAGG + Intergenic
1101118193 12:101552542-101552564 ATTTTCTCCTGGGGCATCTGAGG - Intergenic
1102488738 12:113276196-113276218 ATTTTTTCCCTGTGGATCAAAGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1109460019 13:62644286-62644308 ATTGTGTCCTGGGGCAGCAGGGG + Intergenic
1113118451 13:106900061-106900083 ATTTTCTCCTGGCAAATCAATGG + Intergenic
1116119865 14:40708917-40708939 TTTTTTTCCTGTGGGATCAGTGG - Intergenic
1117311914 14:54534408-54534430 ATTTTGTCCTCTGGGAGCAGTGG - Intronic
1120050246 14:79857594-79857616 ATAGTGTCCTGGGGGATCAAAGG - Intronic
1126168704 15:45675964-45675986 ATTATGTCCTGGCAGAGCAATGG - Intronic
1126724524 15:51618135-51618157 CTTTTGGCCAGGGGAATCAAGGG - Intronic
1126819391 15:52487087-52487109 ATTATTTCCTGGGGGATGTATGG + Intronic
1127908146 15:63392487-63392509 ATGCTGTCCTGGGGGATCTAAGG + Intergenic
1140412990 16:74752742-74752764 AGTTTGTCTTGGGGGCTCACGGG - Intronic
1149348396 17:55762263-55762285 ATTTTGTTCTGGTTGATCAGTGG + Intronic
1150025615 17:61671085-61671107 ATTTTGTCCGGGGTGATAATGGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153149505 18:2074880-2074902 ATTTTGGCCTGTGGTATCACTGG - Intergenic
1154066692 18:11113341-11113363 ATTTTGTCCAGGTTGGTCAATGG - Intronic
1155414535 18:25582488-25582510 ATTTTGACCAGAGGGATAAAAGG - Intergenic
1157769932 18:50337116-50337138 ATTTTGTCCTGGGGGCCCTTTGG + Intergenic
1158569909 18:58589405-58589427 ATTTTGTGCTTTGGGAACAAGGG + Intronic
1158978246 18:62732671-62732693 ATTTTGTCCAGATGTATCAAGGG - Intronic
1167254342 19:48418416-48418438 ACTTTGTCCTGGGGGTGCTAGGG + Intronic
1167267062 19:48488498-48488520 ACTTTGTCCTGGGGGTGCCAGGG - Intronic
925650905 2:6087986-6088008 AGTTAGGACTGGGGGATCAAGGG + Intergenic
929441472 2:41968559-41968581 ATTTTGTCCTGAGATTTCAAAGG - Intergenic
933185560 2:79275256-79275278 ATCTTGTCCAAGAGGATCAAAGG + Intronic
933492435 2:83003860-83003882 ATTTGGTGCTGGGGGATCCCAGG - Intergenic
937620207 2:123976648-123976670 TTTTTGTCCTGGAGAAACAAAGG + Intergenic
938230151 2:129651356-129651378 ATTTTCTCCTGGTGGCTCCAGGG - Intergenic
939852661 2:147319442-147319464 ATTTTGGCCTGCTGGATCCAGGG - Intergenic
944183522 2:196923365-196923387 AGTTTGTCTTGGGTGTTCAAAGG - Intronic
948016194 2:234692736-234692758 ACTGGGTCCTGGGGGGTCAATGG + Intergenic
1174899498 20:54483893-54483915 ATTTTGTTCTCTGGGATCCAGGG - Intronic
1179044482 21:37832318-37832340 CTTTTGTCCCGGGGGATAAAGGG + Intronic
1179337645 21:40473056-40473078 ATGTTGTTCTGGGGGAATAAAGG + Intronic
1179416513 21:41202884-41202906 ATTTTGTCCTGCCTGATCACTGG - Intronic
1181552711 22:23649837-23649859 GATTTGTCCTGGGAGATCACTGG - Intergenic
1181791742 22:25272903-25272925 ATTTTGTGTTGGAGAATCAAAGG + Intergenic
1181827378 22:25528706-25528728 ATTTTGTGTTGGAGAATCAAAGG + Intergenic
1182792511 22:32964797-32964819 GTTCTGTCATGGGGCATCAAGGG - Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
952468767 3:33621168-33621190 ATTTTGTCCTGGAGGCACTATGG - Intronic
954466178 3:50656338-50656360 ATTCTGTCCTGGGTGGTCAGTGG - Intergenic
959153534 3:102637905-102637927 ATTTAGTGCTGGGGATTCAATGG + Intergenic
960656539 3:120010722-120010744 ATTTTGGCCTGGGTGACAAAGGG + Intronic
960938445 3:122917815-122917837 ATATTTTCCTCTGGGATCAATGG + Intronic
961108199 3:124260305-124260327 ATTTGGGCCTGGGAGCTCAAAGG - Intronic
965897109 3:173591985-173592007 ATTTTCTTCTGTGGGATCACAGG + Intronic
968436120 4:590426-590448 ATTTTGGCCTGGAGGTGCAAGGG - Intergenic
968657102 4:1783427-1783449 ATTTTGTCTCGGGGGAGCTAAGG + Intergenic
972805171 4:42522594-42522616 ATTTTGTCCTGGGGAAAAATTGG - Intronic
974245323 4:59307831-59307853 ATTGTCTCTTGGGGAATCAAAGG - Intergenic
979483288 4:121242449-121242471 CATTTGTCCTGGGGGATATATGG + Intergenic
983387594 4:167084986-167085008 CTTTTGTCCAGAGGGATCCAGGG + Intronic
984537398 4:180993939-180993961 GTTTTGTTCAGTGGGATCAAGGG - Intergenic
991327203 5:65448398-65448420 ATTTTGTCCCAGGGACTCAAAGG - Intronic
991544511 5:67766547-67766569 ATTTTCTACTGAGGAATCAATGG - Intergenic
992040746 5:72828338-72828360 ATTTAGTTGTGGGGGATGAACGG + Intronic
994168539 5:96633710-96633732 ACTTTGTCCTGGGTGAAGAAAGG - Intronic
994257279 5:97613767-97613789 ATTCCTTCCTGGGGGATCAGCGG + Intergenic
996463232 5:123770892-123770914 ATTTTGGCCTGCTGGATCCAGGG - Intergenic
1001702846 5:173720237-173720259 ATTTTATCTTGTGTGATCAAGGG + Intergenic
1002375672 5:178787424-178787446 GTTTTATCTTGGGGGACCAAAGG + Intergenic
1008009610 6:46452095-46452117 ATTTGGTTCTGGGGATTCAATGG - Intronic
1008520317 6:52356790-52356812 ATTTTATCCTGGGGGAGAGAGGG - Intergenic
1009871563 6:69459020-69459042 ATTTTGTGCTGGAAGCTCAATGG - Intergenic
1010387415 6:75297880-75297902 ATTTTGTACTGTGGAAACAAAGG - Intronic
1012206244 6:96464134-96464156 CTTTTGTCATGGGGGTTCAAGGG - Intergenic
1013413564 6:109904292-109904314 ATTTTGACCTGGGGAATCCAAGG - Intergenic
1015505837 6:133986761-133986783 ATTTTGTTCTGGGCAATTAAAGG - Intronic
1015673945 6:135723800-135723822 AATTTCTCTTGGGGGGTCAAAGG - Intergenic
1018935410 6:168270955-168270977 GTTTTTTCCTGGAGGGTCAATGG - Intergenic
1019131610 6:169881061-169881083 CTTTAGTCCTGGAGGAGCAAAGG + Intergenic
1019935811 7:4256855-4256877 AAAATGTCCTGGGGGATAAAAGG - Intronic
1020537640 7:9421848-9421870 ACTTTGGCCTGGGTGATAAAAGG - Intergenic
1030865263 7:114694754-114694776 ATTTTGTGCTGTTGAATCAATGG + Intergenic
1036968668 8:13329412-13329434 ATTCTGGCCTGTGGGATAAATGG + Intronic
1038468421 8:27788671-27788693 ATTTTGTCTTGGGGGAGGGAAGG + Intronic
1041611668 8:59857356-59857378 TTTTTTTCCTGTGGGATCAGTGG - Intergenic
1043189413 8:77199382-77199404 ATTTTGTCTTTTGAGATCAACGG - Intergenic
1044653677 8:94525022-94525044 ATTGTGTACTGGGAAATCAATGG - Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1051190775 9:14509706-14509728 ATTTTGTCCTGGTGCTTCAGGGG - Intergenic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1055906833 9:81304588-81304610 ATTTTGTCCTGGAGGCAGAAAGG + Intergenic
1056089460 9:83190385-83190407 ATTTCGTTCTAGTGGATCAATGG + Intergenic
1056276080 9:84995542-84995564 ATTCTGGCCTGGGGGATGAGAGG + Intronic
1057303599 9:93900121-93900143 ACTTTGTCCTGGGGGTACTAGGG - Intergenic
1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG + Intronic
1188684000 X:33046569-33046591 ATGTTATCCTGGGCAATCAATGG - Intronic
1195815610 X:108883184-108883206 ATTTCTTCCTGGGGGCTCCAGGG + Intergenic
1197721466 X:129747550-129747572 ATTTTTTCCTGGGGTGTAAATGG + Intronic
1201274969 Y:12288042-12288064 CTTTTGCCCTGGGGGATCTGTGG + Intergenic