ID: 1048825045

View in Genome Browser
Species Human (GRCh38)
Location 8:138416141-138416163
Sequence TATTTTGTCCTGGGGGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048825045_1048825051 15 Left 1048825045 8:138416141-138416163 CCTTGATCCCCCAGGACAAAATA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1048825051 8:138416179-138416201 TACTTTTGGAGTACAAAACTAGG No data
1048825045_1048825050 1 Left 1048825045 8:138416141-138416163 CCTTGATCCCCCAGGACAAAATA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048825045 Original CRISPR TATTTTGTCCTGGGGGATCA AGG (reversed) Intronic
902217309 1:14942569-14942591 CATTTTCTCCTGGGAGATGAGGG + Intronic
902425020 1:16313758-16313780 TGTTCTTTCCTGGGGGAACAAGG - Intronic
904266341 1:29320452-29320474 TGTTTAGTTCTGGGGGGTCATGG + Intronic
904396652 1:30226992-30227014 TATTCAGACCTGGGGGGTCAGGG + Intergenic
906096594 1:43228369-43228391 TATTTTGTCTAGGGCGGTCAGGG - Intronic
907627639 1:56046029-56046051 TATTTCTTCCTCAGGGATCATGG - Intergenic
908159261 1:61390516-61390538 TATTTGGGCCAGGAGGATCATGG - Intronic
912837628 1:113010307-113010329 TAATTTGTACTGGAGTATCATGG - Intergenic
913157472 1:116114061-116114083 CATTTTGTGCTGGGGTGTCAGGG - Intronic
915464337 1:156087635-156087657 CACTTTATCCTGGGAGATCAAGG - Intronic
917474184 1:175354173-175354195 TAATTGGTCCGGGTGGATCAGGG + Intronic
919521490 1:198594589-198594611 TTTTTTGTCCTTGGGTTTCATGG + Intergenic
923662379 1:235969443-235969465 TTTTTTGTTCTGGGGGATTTGGG - Intergenic
1063283299 10:4655170-4655192 TGTTCTGTCCTGTGGGAGCAAGG - Intergenic
1063442352 10:6083192-6083214 CATGTTTTCCTGGGGGAGCAAGG + Intergenic
1067696561 10:48540098-48540120 TTATTTGTCCTGTGGGGTCATGG - Intronic
1068064499 10:52111645-52111667 TAGTTTGTTCTTGGGGATCAAGG + Intronic
1072834187 10:98693778-98693800 AATTTTTTCCTGGAGGATGAAGG + Intronic
1073956215 10:108874374-108874396 TATTTTGCCCTGGGAGGGCAAGG + Intergenic
1074239699 10:111625431-111625453 AATTTTTTCTTTGGGGATCATGG + Intergenic
1074362594 10:112835129-112835151 TCTTTTGTCCTGGGAGATCCAGG - Intergenic
1079397585 11:20078781-20078803 TATTTTGTCCTTGTGTATCTTGG + Intronic
1080446759 11:32344805-32344827 TGTTCTTTCCTGGGGGATGAAGG - Intergenic
1081992166 11:47343666-47343688 TAGCTTGGCCTGGGGGAGCAGGG - Intronic
1085267349 11:75244770-75244792 TATATTGTCCTGGGGGACTGCGG - Intergenic
1086045810 11:82529980-82530002 TTTTTTGGCCTGAGGAATCATGG - Intergenic
1089477357 11:118775497-118775519 TGTTTTGTCCTGGGGATCCATGG - Intronic
1089765373 11:120759354-120759376 TTGTTTGTCCTGGTGGCTCAGGG + Intronic
1091107432 11:132935990-132936012 CATACTGTCCAGGGGGATCATGG - Intronic
1093853735 12:24072552-24072574 AAGTGTGTCCTGGGGGATGACGG + Intergenic
1094247009 12:28310082-28310104 TAATTAGTCCTTGGGGAGCAGGG - Intronic
1106896726 13:34310907-34310929 TATTTTTTACTGGGGGATAAAGG + Intergenic
1109386720 13:61638752-61638774 TTTGGTGTCCTTGGGGATCATGG + Intergenic
1109460018 13:62644285-62644307 AATTGTGTCCTGGGGCAGCAGGG + Intergenic
1112061554 13:95744738-95744760 TCTTCTGTCCTGTGGAATCAAGG - Intronic
1118501672 14:66367972-66367994 TATTTTTTCCTGGGCAACCAGGG + Intergenic
1119541874 14:75444381-75444403 TATTTTGTCCTCGGAGATGGTGG + Intronic
1124210016 15:27755166-27755188 CATTTTGTCCTTGGGGAGAAAGG + Exonic
1127596878 15:60493347-60493369 TATTTTTCCCTGAGGGATCAAGG + Intronic
1129199044 15:73987915-73987937 TGCTTTGCCCTGGGGAATCAAGG - Intronic
1130338931 15:82982643-82982665 TATTTTGTATTTGGGGATTAGGG + Intronic
1133095794 16:3444217-3444239 TATTGTGTGCTGGGGGAGGAGGG + Intronic
1133509070 16:6440399-6440421 TAATTTGTCCAGGGGAATCTGGG + Intronic
1134626092 16:15724003-15724025 TATCTTGTCTTGGGCGACCATGG - Intronic
1135737536 16:24944321-24944343 CATTTTTTCCTGGGTGATCACGG - Intronic
1140412991 16:74752743-74752765 CAGTTTGTCTTGGGGGCTCACGG - Intronic
1141687096 16:85576788-85576810 TGGTGTGTCCTTGGGGATCATGG + Intergenic
1142642113 17:1290244-1290266 GATTTTGTCCTGCAGGAACAGGG - Intronic
1146100168 17:29973102-29973124 TAGTTGGTCCTGGTGGACCAAGG - Intronic
1148521161 17:48276334-48276356 AATTTTGCCCAGGGGAATCAGGG - Intronic
1148535547 17:48435559-48435581 TCTTTTCTTCTGGGGGATTAAGG + Intergenic
1150025614 17:61671084-61671106 AATTTTGTCCGGGGTGATAATGG + Intergenic
1153981544 18:10314821-10314843 TATTTTGACCTGGGGCAGTAGGG - Intergenic
1154078109 18:11225108-11225130 AGTTTTGTCCTGGGGGAGCTAGG - Intergenic
1156481229 18:37437565-37437587 TCTTGTGTCCTGGAGGACCAAGG + Intronic
1157464714 18:47933036-47933058 TATTTTCTCCTGTGTGAACAGGG + Intergenic
1158475359 18:57774779-57774801 TATTTTGTCCAGGTGACTCAGGG - Intronic
1158978247 18:62732672-62732694 TATTTTGTCCAGATGTATCAAGG - Intronic
1160280994 18:77490367-77490389 CCTGTGGTCCTGGGGGATCAGGG + Intergenic
1161494756 19:4580989-4581011 GATTTTGTCCTGGGGGGGCCCGG - Intergenic
1163331833 19:16643855-16643877 TATTTTGTCCACTGTGATCAGGG - Intronic
1164023797 19:21331772-21331794 TATTTTCTCCTGTGGTATGAGGG + Intergenic
1164397637 19:27879867-27879889 AAGTTTGTCCTGGGGCATTAAGG - Intergenic
1165053186 19:33156256-33156278 TATTTTCTCCTGTGAGCTCATGG - Intronic
1168232577 19:55042599-55042621 TATTTCTTACTGGGAGATCACGG - Intronic
925953123 2:8934751-8934773 TATTCTCTCTTGTGGGATCATGG + Intronic
926700503 2:15800217-15800239 TATGCTGACCTGGGGGAGCAGGG - Intergenic
930912981 2:56652365-56652387 AATTTGGTCCTGGGGGATGTGGG - Intergenic
932856023 2:75234777-75234799 AACCTTGTCTTGGGGGATCAGGG + Intergenic
934042100 2:88136162-88136184 TATTCTGTATTTGGGGATCATGG - Intergenic
945482880 2:210363559-210363581 TGTTCTGCCCTGGGGGGTCAGGG + Intergenic
1170658040 20:18308904-18308926 TATTTTGTCATGGCGGCCCAAGG - Intronic
1172240687 20:33410686-33410708 TATTTTGGACTGGGAGGTCAGGG - Intronic
1173733007 20:45341534-45341556 TATTTTGTCCCTGGGGACCCAGG - Intronic
1179044481 21:37832317-37832339 GCTTTTGTCCCGGGGGATAAAGG + Intronic
1181892447 22:26075617-26075639 AACTTTGTCCTGGGGCAACAAGG - Intergenic
1182620704 22:31616946-31616968 TATTTTCCCCTCGGGGACCAGGG - Intronic
1184593161 22:45499277-45499299 TAGCTTGTCCTGGGGGATAGGGG + Intergenic
951039545 3:17973844-17973866 GATTTTGACCTGCGCGATCACGG + Intronic
951652459 3:24965823-24965845 TATTTTTTTCTGGAGGGTCAGGG - Intergenic
954069257 3:48130880-48130902 TGTTTATTCCTGGGGGATGAGGG - Intergenic
955725144 3:61925106-61925128 TATTTTGTCATAGCGGCTCAAGG + Intronic
957206196 3:77201900-77201922 TGTTTTGTCCTTGAAGATCAAGG - Intronic
957974096 3:87420958-87420980 TACTTAGTTTTGGGGGATCATGG + Intergenic
965787699 3:172353220-172353242 TCTTCTGGCCTGAGGGATCAAGG - Intronic
967446280 3:189570409-189570431 TGTTTTGTTTTGGGGGAACAGGG + Intergenic
972722063 4:41709841-41709863 TATTTAGTCCTGGGAGAGCCTGG + Intergenic
974625007 4:64414667-64414689 GATTGTGTCTTTGGGGATCAAGG - Intergenic
975217586 4:71773766-71773788 TATTGTGTTCTGGAGAATCATGG + Intronic
975345074 4:73283977-73283999 TAATTTATCCTGAGGGATCAGGG + Intergenic
976017807 4:80579876-80579898 CCTTTTGTGCTGTGGGATCAGGG + Intronic
976048816 4:80985771-80985793 TCTTTTGTCCTGGGTGATAAAGG - Intergenic
977823480 4:101502931-101502953 TATTCTTTCTTGGGGGTTCAGGG + Intronic
980470720 4:133248119-133248141 GATTTTGTCATGGAGGATAAGGG + Intergenic
982197928 4:152935222-152935244 AATTCTGTCCTGGGAGTTCAGGG + Intergenic
982551114 4:156801010-156801032 TATTTTGACCTTGGGAATAATGG - Intronic
982841020 4:160186606-160186628 TATTTTGTCACCGGGGATAAGGG + Intergenic
984537399 4:180993940-180993962 TGTTTTGTTCAGTGGGATCAAGG - Intergenic
987563597 5:19555686-19555708 TACTTTGTCCTGGGCTACCAGGG - Intronic
988242948 5:28637362-28637384 TATTTTTTCCTGGTGGCTAATGG - Intergenic
992446852 5:76842142-76842164 TATTTTATATTGGGAGATCAGGG + Intergenic
994093213 5:95826551-95826573 GATTTTGTCCTGGGGAAACATGG - Intergenic
994178746 5:96740827-96740849 TATTTTTGGCTGGGGGAACAGGG + Intronic
995248255 5:109960203-109960225 TCTTTTGTCCTGAGGGTTCTGGG + Intergenic
997125851 5:131226065-131226087 TAATTGGTCCTGGGGTAGCAAGG + Intergenic
999768993 5:154760933-154760955 TATTTTGTCAGGGGTGATAATGG + Intronic
1000514735 5:162226176-162226198 TTTTTTTTCTTGTGGGATCAGGG + Intergenic
1001618734 5:173064127-173064149 TATTTTGTCCTGAGGGTTTGAGG + Intronic
1005921303 6:30404342-30404364 TCTTTTTTCCTGCTGGATCAGGG + Intergenic
1006051195 6:31345902-31345924 TCTCTTTTCCTGGTGGATCAGGG + Intronic
1008812041 6:55514535-55514557 TATTTTTTCATGGAGGATAAGGG - Intronic
1009787455 6:68358238-68358260 TTCTTAGTCCTGGGGGGTCAGGG + Intergenic
1012206245 6:96464135-96464157 CCTTTTGTCATGGGGGTTCAAGG - Intergenic
1015010774 6:128344555-128344577 TCTGTTGTCCTGGCAGATCATGG + Intronic
1023274110 7:38499560-38499582 TATTTGGCCCTGGAGGGTCATGG - Intronic
1023743534 7:43302001-43302023 TCATTTGTCATGGAGGATCAAGG - Intronic
1025203503 7:56977362-56977384 TAATTTGTTTTGGGGGATAATGG - Intergenic
1025668440 7:63599566-63599588 TAATTTGTTTTGGGGGATAATGG + Intergenic
1028089912 7:86686101-86686123 TATTTTGTCCAGGGGTTTAATGG - Intronic
1028184178 7:87761796-87761818 TATTATGCCCTGGGGGAAAAGGG + Intronic
1030734974 7:113037369-113037391 TATTTTTTTATGGGTGATCAGGG + Intergenic
1031188451 7:118513918-118513940 TATTTTGTTCTGGGTTATTATGG + Intergenic
1031423922 7:121583380-121583402 TAGTTTGTACTTGGGGATGAGGG + Intergenic
1035986636 8:4440422-4440444 GATTTTGTGCTGGGGGAAAAGGG - Intronic
1037507577 8:19547147-19547169 TGCTTTGTCCTGTGGCATCATGG - Intronic
1037649124 8:20820737-20820759 TCTTTCTTCCTGTGGGATCATGG + Intergenic
1040791967 8:51241332-51241354 TATTGTATTTTGGGGGATCAAGG + Intergenic
1041348189 8:56923175-56923197 AAGTTTATCCTGGGTGATCAGGG + Intergenic
1041510594 8:58651010-58651032 GATTTTTTCCTGGGGTTTCATGG + Intronic
1042823818 8:72960252-72960274 TACTTTGCCCAGGTGGATCATGG + Intergenic
1043684570 8:83069884-83069906 TTTTTTCTCTTGGGGGATTATGG - Intergenic
1046735530 8:117772600-117772622 ATTATGGTCCTGGGGGATCAGGG - Intergenic
1047046738 8:121062029-121062051 GATTTTGTCCAGGGAAATCAGGG + Intergenic
1048825045 8:138416141-138416163 TATTTTGTCCTGGGGGATCAAGG - Intronic
1051190776 9:14509707-14509729 CATTTTGTCCTGGTGCTTCAGGG - Intergenic
1054972565 9:71105607-71105629 TATTGTGTCCTGGGGTGTAAGGG + Intronic
1055186223 9:73458231-73458253 TATTTTGAGCTGGAAGATCATGG - Intergenic
1058022318 9:100102464-100102486 TATATTTTCCTGGTGGACCAAGG + Intronic
1059646786 9:116275935-116275957 TATTATGTGCTGGGGGATGAGGG - Intronic
1186952029 X:14637227-14637249 TCATTTGTCCAGGGTGATCAGGG - Intronic
1192187011 X:68954022-68954044 TATTTTATCTGGGGTGATCAGGG - Intergenic
1193857465 X:86622697-86622719 TATTTTCTCCTGATTGATCATGG - Intronic
1197286994 X:124607350-124607372 TATTTTATATTGGGTGATCAGGG + Intronic
1197596204 X:128467066-128467088 TATTTTTTCCTGTGGAAGCAGGG - Intergenic