ID: 1048825046

View in Genome Browser
Species Human (GRCh38)
Location 8:138416148-138416170
Sequence TAAGATTTATTTTGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048825046_1048825051 8 Left 1048825046 8:138416148-138416170 CCCCCAGGACAAAATAAATCTTA 0: 1
1: 0
2: 3
3: 40
4: 332
Right 1048825051 8:138416179-138416201 TACTTTTGGAGTACAAAACTAGG No data
1048825046_1048825050 -6 Left 1048825046 8:138416148-138416170 CCCCCAGGACAAAATAAATCTTA 0: 1
1: 0
2: 3
3: 40
4: 332
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048825046 Original CRISPR TAAGATTTATTTTGTCCTGG GGG (reversed) Intronic
900233186 1:1572860-1572882 TAACAATAATTTTGTCTTGGGGG + Intronic
900530086 1:3148852-3148874 TAAGATTTAGTGTGTTGTGGGGG + Intronic
900823504 1:4908387-4908409 TAAAATTAATGTTGGCCTGGTGG + Intergenic
902076010 1:13786533-13786555 TAAGGTTTGTTTTGTTTTGGGGG - Intronic
902259432 1:15213685-15213707 GAAGGTTTATTTTGTCCAGCTGG + Intronic
903388752 1:22948275-22948297 TAAATTTTATTTAGTTCTGGAGG - Intergenic
903972306 1:27126985-27127007 GAAGATTTATTTTTTGCGGGGGG + Intronic
904633151 1:31858489-31858511 TAAGAATTATTTTGTACTTAGGG + Intergenic
905054500 1:35081211-35081233 TAAGATTTATTTTATTCGGCCGG - Intronic
905061501 1:35143619-35143641 TGTAATTTTTTTTGTCCTGGTGG + Intergenic
907167266 1:52424704-52424726 TAAAATTTATTATGTTCTGCTGG - Intronic
908666049 1:66492340-66492362 TGAGAATTATGTTGTCCTGGAGG - Intergenic
909597842 1:77426419-77426441 TAAGAATTATTATGTCCTCTTGG - Intronic
909663509 1:78109204-78109226 TGAGATTTATTCTGACCTTGCGG + Intronic
911538755 1:99132904-99132926 TAAGATTTCTTTTCTACTTGTGG - Intergenic
911763370 1:101642512-101642534 CAAGATTTAATTTGTTCTGGGGG + Intergenic
912734660 1:112139635-112139657 TCAGAGCCATTTTGTCCTGGTGG + Intergenic
914771325 1:150688452-150688474 TAAGAGTTATTACCTCCTGGCGG + Intronic
914909209 1:151770526-151770548 TGAGATCCATTTTGTCCTGCTGG - Intronic
915490179 1:156246358-156246380 TCAGATTTAGTTTGGCTTGGGGG - Intronic
915874347 1:159596490-159596512 TAACAGTTATATTGTGCTGGGGG - Intergenic
916457407 1:164985134-164985156 TAAGTTTTATTTTGGGCTTGGGG + Intergenic
916653839 1:166855258-166855280 TAAAACTTATTTTTTCCTGCAGG - Intronic
916736118 1:167608328-167608350 TAAGATTTAGACTGTCCTGTTGG + Intergenic
917498777 1:175566829-175566851 TAAGAATTATTTTCTCCTTGTGG - Intronic
917765338 1:178210392-178210414 TATGATTTCTTTTGTCCTTGGGG + Intronic
917908261 1:179611870-179611892 CAAGATTTAAATTGTTCTGGTGG - Intronic
918991169 1:191698830-191698852 TGAGCTTTATTTTTTCCTGTAGG - Intergenic
919797510 1:201330204-201330226 TTAGATTTTTTTTTTCCTTGGGG + Exonic
921001410 1:211047852-211047874 TAGGATTTTTTTTTTCCTTGCGG - Intronic
921379611 1:214511029-214511051 AAAGACTTAGTTTGGCCTGGTGG - Intronic
921599369 1:217090278-217090300 TCAAATTTATTTTGCCCAGGCGG - Intronic
922326228 1:224530967-224530989 AAAGCTTTATTTTATCCTAGGGG - Intronic
922811933 1:228421086-228421108 TAAGAATTATTTTGAGCTGAAGG - Intergenic
922862748 1:228833305-228833327 TAGGATTTTGTTTTTCCTGGGGG - Intergenic
1062907580 10:1189173-1189195 TTTTATTTATTTTGGCCTGGGGG + Intronic
1064838794 10:19565971-19565993 TTAGATTTCTTTTGTACTTGGGG + Intronic
1064896294 10:20241298-20241320 TAAAATTAATTTTGTCCTGCAGG - Intronic
1065306325 10:24372612-24372634 TTAGATTTATTTTGGCGTGCAGG - Intronic
1066024830 10:31345410-31345432 TAAAATTCATTTTGTTCTGTAGG + Intronic
1067324720 10:45256590-45256612 TAATATTTATTTTGCCTAGGTGG + Intergenic
1068275854 10:54795322-54795344 GGACATTTATTTTGTCCTGGTGG - Intronic
1068306382 10:55214452-55214474 TAAATTTTTTTTTGTCCTGGTGG + Intronic
1069031342 10:63598937-63598959 TAAAAATTATTTGGTCATGGTGG + Intronic
1069168418 10:65194128-65194150 TAAGATTTATGTTTTTCTGATGG + Intergenic
1069251755 10:66275817-66275839 TAACATTTTTTTTTTCTTGGTGG - Intronic
1070212259 10:74337057-74337079 TGAGAGTTATTTTGTTGTGGTGG + Intronic
1071768258 10:88693964-88693986 TAAGAATGACTTTGTGCTGGTGG - Intergenic
1071880222 10:89889099-89889121 TACGATTTATTTTTTTCTGAAGG + Intergenic
1072821227 10:98559780-98559802 TGAGATTTATTCTGTCTGGGAGG + Intronic
1073820374 10:107255806-107255828 TTAGATTTCTTTTCTCCTGTGGG - Intergenic
1073962709 10:108952286-108952308 TAAGCTTTATGATGTGCTGGTGG - Intergenic
1078444381 11:11393189-11393211 TAAGAAAGGTTTTGTCCTGGGGG - Intronic
1078685115 11:13522540-13522562 GAAGATTTGTTTTGTCTTCGAGG - Intergenic
1078712217 11:13804944-13804966 TGAGATTTATTTTTTCCATGTGG - Intergenic
1078952613 11:16152065-16152087 TATGATGTATTTGATCCTGGTGG - Intronic
1079828327 11:25228030-25228052 TCTGATTTATTTTGTCCTATAGG - Intergenic
1079937936 11:26641040-26641062 TAAAATTCACCTTGTCCTGGAGG + Intronic
1080793350 11:35540591-35540613 TAAGAATTATTTTGAGCTGAAGG - Intergenic
1082071110 11:47940451-47940473 TAATATTTATTTGATCCTGCTGG - Intergenic
1082993261 11:59227632-59227654 TATGATTTCTTTTCTTCTGGTGG + Intergenic
1085169632 11:74438296-74438318 TTAGATTTTTTTTTTCCTGTCGG + Intergenic
1085811566 11:79687185-79687207 CAAGATTTACCTTGTCCTGCTGG + Intergenic
1085866980 11:80305635-80305657 TTAGATTTATTCTGTCCCAGAGG + Intergenic
1087666146 11:101050925-101050947 TAATATTTATATTGTTCTAGTGG - Intronic
1088546252 11:110962370-110962392 TAAGAATTATTTTGAGCTGAAGG + Intergenic
1088945997 11:114513040-114513062 TCAGATTCACTTTGTTCTGGGGG - Intergenic
1089423814 11:118352942-118352964 TAAGGGTGATTTTGCCCTGGAGG - Intronic
1090131984 11:124153010-124153032 TATCATTTTTTTTTTCCTGGTGG - Intergenic
1090482657 11:127081827-127081849 GAGGATTTAATTTTTCCTGGAGG + Intergenic
1092582613 12:9861746-9861768 TAAAAATTATTTTTACCTGGTGG - Intronic
1093111864 12:15162282-15162304 TAAGACATACTTTCTCCTGGAGG - Intronic
1094230087 12:28092835-28092857 TAAGATTTATCAAGTCCTGTTGG - Intergenic
1095529968 12:43175537-43175559 TAAGAATTATTTTGAGCTGAAGG + Intergenic
1096018942 12:48306187-48306209 TCAGTTTTGTTTTGTCATGGTGG - Intergenic
1099150110 12:79100341-79100363 TAAGATATAGTATGACCTGGTGG - Intronic
1099256460 12:80320147-80320169 AATAATTTATTTTGTCCTTGGGG - Intronic
1099623377 12:85033346-85033368 AAAGATTTTTTTTTTCCTGAAGG + Intronic
1101516660 12:105442405-105442427 TAAGAATTATTTTGAGCTGAAGG + Intergenic
1102010037 12:109612604-109612626 TAAGTTTTAATTTTTCCTAGAGG + Intergenic
1102943037 12:116961020-116961042 TCAGATTTATTTGGTCTGGGAGG + Intronic
1106114442 13:26805090-26805112 TAAGATATTTTTTGTGCTTGGGG - Intergenic
1107077827 13:36342736-36342758 GAAGACTTCATTTGTCCTGGGGG - Intronic
1107413719 13:40181272-40181294 TAAGCTTTATTATCTCCTGAAGG + Intergenic
1108929563 13:55800528-55800550 TAATATATATTTTGTCTTGCAGG + Intergenic
1109452136 13:62531066-62531088 TGAGTTTTATTTTTTCATGGCGG + Intergenic
1113477191 13:110592443-110592465 TAAGATTTTTTTTGTAGTGATGG + Intergenic
1114371794 14:22097607-22097629 CAAGTTTTAGTTTGTCCTCGTGG - Intergenic
1115074094 14:29364170-29364192 TAATATTTATTTTCTCTTTGTGG + Intergenic
1115221404 14:31062071-31062093 GAAGATTTTTTTAATCCTGGAGG + Intronic
1115727238 14:36230359-36230381 CAAGATTTTTTTTGTGCTGGTGG - Intergenic
1116713581 14:48399483-48399505 TAAGATTTATTATATCCAGGTGG + Intergenic
1117565044 14:56985427-56985449 TCACATTTAATTTGGCCTGGAGG - Intergenic
1117889471 14:60403038-60403060 TAAGATTTACTTTGATCTGGAGG + Intronic
1118500467 14:66357501-66357523 TAAAATTTATTTTTACCTTGGGG + Intergenic
1118537620 14:66785499-66785521 TAAGATTGCTGTTTTCCTGGTGG - Intronic
1118661437 14:68017668-68017690 TAAAATTTATTTTGTAATGTAGG - Intronic
1119003589 14:70905212-70905234 GAATATTTGTTTTGTCCTGCTGG + Intergenic
1121295301 14:92815999-92816021 TAAGATTTTTTTTTTCCAGCTGG - Intronic
1122367154 14:101200963-101200985 GAAGATTGAGCTTGTCCTGGGGG - Intergenic
1124326735 15:28772124-28772146 TAAGATTTTTTTTTTTTTGGAGG + Intergenic
1126731046 15:51683118-51683140 TATGATTTCTTTTTACCTGGAGG - Exonic
1127243391 15:57144010-57144032 TAAGAATTATTTTGTGCTGAAGG - Intronic
1127847470 15:62883844-62883866 TCAGATTTAGTTGGTCTTGGGGG - Intergenic
1128919045 15:71593915-71593937 TAAGATTTTTTTTTTGCCGGGGG - Intronic
1128961173 15:72006386-72006408 TAAGATTTATTTATGTCTGGCGG - Intronic
1129131220 15:73498390-73498412 TATGTTTTATTTTGTCTTTGGGG + Intronic
1130705050 15:86225166-86225188 TAATATTTATTTTCTCTTTGTGG - Intronic
1131820605 15:96269538-96269560 CAAGACTTATTTTTTCCCGGGGG - Intergenic
1133943231 16:10327757-10327779 TAAGAATTATTTTGAGCTGAAGG + Intronic
1135557193 16:23446902-23446924 TAAAAATTATTCAGTCCTGGTGG - Intronic
1135671440 16:24378872-24378894 TAAGAATTATTTTGAGCTGAAGG + Intergenic
1144501436 17:15789528-15789550 TATGATTTATTTTCTCCTTAGGG - Intergenic
1145163612 17:20592199-20592221 TATGATTTATTTTCTCCTTAGGG - Intergenic
1145988242 17:29061964-29061986 TAAGATTTTTATTACCCTGGGGG + Intergenic
1146255613 17:31390386-31390408 TAAGACATATCTTGCCCTGGAGG + Intergenic
1146424829 17:32727316-32727338 TAAGAGATATTTGGTCCTGTGGG - Intronic
1147789270 17:43003148-43003170 TAAGAATTATCTGGGCCTGGTGG + Intergenic
1148550678 17:48548856-48548878 TCAATTTTATCTTGTCCTGGTGG - Exonic
1150759437 17:67947704-67947726 TTGGATTTATTCTGTCCTGAAGG + Exonic
1150933137 17:69606883-69606905 TAAGAATTATTTTGAGCTGGGGG - Intergenic
1152137379 17:78512510-78512532 TAAGGTTTATTTTGAGCTGAAGG + Intronic
1153181998 18:2445713-2445735 TAAGAATTATTTTGAGCTGAAGG + Intergenic
1153273457 18:3345893-3345915 TTAGGTTTAGTTTGCCCTGGAGG - Intergenic
1156136622 18:34047799-34047821 TCAGATGGATTTTGTTCTGGGGG - Intronic
1157566280 18:48681045-48681067 TAAGAGTCAGTGTGTCCTGGGGG - Intronic
1158254955 18:55535609-55535631 TAAAATATATTTTTTCTTGGAGG + Intronic
1159867674 18:73725374-73725396 TAAGATTATGTGTGTCCTGGTGG - Intergenic
1159874538 18:73795803-73795825 TATGATTTATTTGATACTGGTGG + Intergenic
1160950971 19:1667297-1667319 TGAGCTTTATTTTGTCTCGGAGG + Intergenic
1161633003 19:5368635-5368657 TAAGATTTCCCTTGTCCAGGTGG + Intergenic
1163459314 19:17427000-17427022 TAAAATTTTTTTTGTACTGATGG + Intronic
1163563511 19:18035455-18035477 TAAGATTTTTTTTGTGATGTGGG - Intergenic
1163735937 19:18980713-18980735 TTAGATTTATTTTGTTGTGTTGG - Intergenic
1164655741 19:29920312-29920334 ATAAAATTATTTTGTCCTGGAGG + Intergenic
1167812274 19:51844442-51844464 CAAGATTTACTTTGTCCAGAAGG - Intergenic
1168129228 19:54306770-54306792 TTGGATTTATCTTTTCCTGGAGG + Intergenic
925021693 2:574910-574932 TAAGATTGTTTTTGCCCTGAAGG + Intergenic
928815914 2:35294167-35294189 TAAGATTTATTCTGGAATGGTGG - Intergenic
929844478 2:45508435-45508457 TAAAATTTATTTTGGAATGGAGG - Intronic
930102451 2:47613865-47613887 AAAGTTTTATTTTGTCCAGGAGG - Intergenic
930424539 2:51195955-51195977 TATTTTTTATTTTGTCCTGAAGG + Intergenic
930467326 2:51771411-51771433 TAAGCTTTATGTTGTGCTGCTGG + Intergenic
930942540 2:57029615-57029637 TAATTTTTATTTTGTACTGATGG - Intergenic
931017108 2:57995284-57995306 TAAAATGTATTTTGTAATGGAGG - Intronic
931299342 2:60961548-60961570 TAAAATTTATTTTGTTTTGCAGG - Exonic
931325620 2:61219114-61219136 GAATATTTATTTTATCCTTGGGG + Intronic
931504356 2:62907911-62907933 TGAAGTTTATTTTGTCCTGGAGG + Intronic
931956016 2:67425963-67425985 TTTGATTTATTTTGTCGTGGAGG + Intergenic
932155263 2:69411059-69411081 TAAGATGTTTTTTGTCCCTGTGG - Intronic
932395077 2:71438950-71438972 TCAGTTTTGTTTTGTCCTGAGGG + Intergenic
933492436 2:83003868-83003890 TAAAAATTATTTGGTGCTGGGGG - Intergenic
935119477 2:100170554-100170576 AAAGATATCTTTTGTCCTAGAGG + Intergenic
935892756 2:107697259-107697281 TAAGGATTATTTTGACCTGCAGG - Intergenic
935935875 2:108182483-108182505 TAAGTGTTATTTTGAACTGGAGG + Intergenic
938683403 2:133714377-133714399 TATGTTTTATTTTGCCCTAGTGG + Intergenic
938844574 2:135195511-135195533 TAAGAGTTAATCTATCCTGGAGG - Intronic
939713777 2:145557423-145557445 TAAAATTTAATTTGTCCTGAGGG + Intergenic
940169299 2:150809767-150809789 GAAAATCTAATTTGTCCTGGAGG + Intergenic
942191501 2:173474988-173475010 TGAGGTTTAATTTGTCCTGCTGG + Intergenic
942735655 2:179109201-179109223 TAATATTTGTTTTTTCATGGTGG - Exonic
942887980 2:180951953-180951975 TAAAACTGATTTTGTCCAGGGGG + Intergenic
942919832 2:181359097-181359119 TAAAAATTTTTTTGTCCTGAGGG + Intergenic
943603778 2:189951797-189951819 TAAGAATTATTTTGAGCTGAAGG + Intronic
944489725 2:200245905-200245927 TAAGATTTATTTCATTCTGTAGG - Intergenic
946492338 2:220161229-220161251 TAATATATATTTTTTCTTGGTGG + Intergenic
946654165 2:221927336-221927358 TAAAAATTATTTTTTCCTGAAGG - Intergenic
1168983693 20:2029134-2029156 TAAGATTTACTTGGTCCTTTAGG - Intergenic
1169616377 20:7450887-7450909 TAAGAATTATTTTGTCCTGAAGG + Intergenic
1172743065 20:37184375-37184397 TAAGGCTGCTTTTGTCCTGGTGG + Intronic
1174193253 20:48754998-48755020 TGAGATTTATTTTCCCCTGTAGG - Intronic
1176514168 21:7771026-7771048 TAAGAGTGATTTTTTCCAGGTGG + Intronic
1177024002 21:15898982-15899004 TCAGATTTAATTTGTACTGTAGG + Intergenic
1177304525 21:19295965-19295987 TAAGTTTTTTGTTGTGCTGGTGG - Intergenic
1177839477 21:26219839-26219861 TAAGAATTATTTTGAGCTGAAGG + Intergenic
1178021309 21:28411687-28411709 TAAGAATTATTTAGTTCTAGGGG - Intergenic
1178648281 21:34401550-34401572 TAAGAGTGATTTTTTCCAGGTGG + Intronic
1179061620 21:37984577-37984599 AGAGATTTATTTTGTACTTGTGG - Intronic
1180059493 21:45377270-45377292 TAAGAATTATTTTGAGCTGAAGG + Intergenic
1182035859 22:27197753-27197775 TGAGATTTTTTTTCTCTTGGTGG - Intergenic
1182499897 22:30739056-30739078 AAAGATTTATTATGTCGTAGGGG + Intronic
949114194 3:299827-299849 GTAGATTTATTTTTTCCTGTGGG - Intronic
949654847 3:6206210-6206232 TTAGATTTATGTTTTCCTTGAGG - Intergenic
950227538 3:11248318-11248340 TCAAATTTATATTGTTCTGGTGG - Intronic
951136606 3:19110385-19110407 ACAGATTTACTTTGTCCTGGTGG + Intergenic
951455534 3:22888224-22888246 AGTGTTTTATTTTGTCCTGGAGG - Intergenic
952109627 3:30107844-30107866 TAAGATCTATTTTTTCCTAGGGG + Intergenic
953453399 3:43022414-43022436 GATGATTTATTTTACCCTGGTGG + Intronic
955011679 3:55022809-55022831 TAAGTTTTTGTTTGTTCTGGAGG - Intronic
955351980 3:58200347-58200369 GAAAATTTATTTTGGTCTGGAGG + Intronic
956539651 3:70321681-70321703 TAAAATTAATTTTATCCTAGAGG + Intergenic
957251730 3:77780317-77780339 TAGTATTTATTTGGTCCTTGGGG - Intergenic
957391374 3:79576499-79576521 CAATATTTACTTTGTGCTGGTGG - Intronic
957786895 3:84894634-84894656 TAAGATTTATTTTGAGCTACAGG + Intergenic
958050720 3:88341608-88341630 TAAGAGTTTTTTTTTCCTGTGGG - Intergenic
958652811 3:96960090-96960112 TCAGAGTTATTTTACCCTGGAGG + Intronic
959586626 3:108031354-108031376 TCAGATATATTTTATCCAGGGGG - Intergenic
960299512 3:115985033-115985055 TAAGATAAACTTTGTCCTGAAGG + Intronic
963586127 3:147191700-147191722 TGAGATTTATTTTGTTCTTTCGG + Intergenic
963896722 3:150694361-150694383 TTAGCTTTATTTTTTCCTTGTGG - Intronic
963908042 3:150790247-150790269 TAAAAGTTATTGTGTCCTTGGGG + Intergenic
963955606 3:151250237-151250259 AAAGATTTTTTTTGTCTTTGAGG + Intronic
965252569 3:166361698-166361720 TAAGACTGATTTTGTTCTGTTGG - Intergenic
966063838 3:175792846-175792868 TAAGACTGATTTCCTCCTGGTGG + Intronic
966161309 3:176971705-176971727 TAACATTTCTTTCGTCCTGTTGG + Intergenic
966411067 3:179646481-179646503 TAAGATTTAGTGTTTTCTGGCGG - Intergenic
966612574 3:181882345-181882367 TAATAATTTTTTTGACCTGGAGG + Intergenic
967507927 3:190274389-190274411 TAACATTTAGTATTTCCTGGAGG + Intergenic
967819620 3:193828869-193828891 AAAAAATTATTTTCTCCTGGAGG - Intergenic
968680274 4:1913936-1913958 TAAGTTTTCTTTTTTCCTGGAGG + Intronic
970472156 4:16389592-16389614 CAAAATTTATTTTTTCCTGTGGG - Intergenic
970802668 4:19993096-19993118 AATAATTTATTATGTCCTGGAGG - Intergenic
971081854 4:23221842-23221864 CAAGTTTGATTTTGTCCTGTTGG - Intergenic
971109468 4:23567601-23567623 TATGTTTTGTTTTGTTCTGGGGG + Intergenic
971644213 4:29176110-29176132 TAAGATTGATATTGTCCAGTCGG - Intergenic
971861604 4:32113009-32113031 TCAGATAAATTTTGTCATGGTGG + Intergenic
972075709 4:35083725-35083747 TACAAGTTATTTTGTCCTGCTGG + Intergenic
972129968 4:35820231-35820253 TAGCATTTATTTTTCCCTGGCGG - Intergenic
972164850 4:36271102-36271124 TAAGAGCCATTTTGTCCAGGTGG - Intergenic
974710093 4:65580563-65580585 TAAGGATTATTTTGTGCTGAAGG + Intronic
975011022 4:69352059-69352081 TTAGATTTATTTTGTCTAGAGGG + Intronic
976335955 4:83886654-83886676 TCAGATTTTTTTTTTCTTGGAGG + Intergenic
976392147 4:84516826-84516848 GAAGAATTATTTGGACCTGGTGG - Intergenic
976944935 4:90753359-90753381 TAAAATTTATTTTTACCTGAAGG - Intronic
978663795 4:111158164-111158186 TAATATATAATCTGTCCTGGGGG - Intergenic
978685215 4:111434155-111434177 TGAGATGGATTTTATCCTGGAGG - Intergenic
978824117 4:113000424-113000446 TAAGAATTATTTTGAGCTGATGG - Intronic
979747181 4:124231463-124231485 CAATATGTATTTTCTCCTGGAGG - Intergenic
980346065 4:131621480-131621502 TAAGAGGAATTTTTTCCTGGAGG + Intergenic
981194449 4:141902494-141902516 AAAGCTGTATTTTGTCCTGGGGG + Intergenic
981363518 4:143874788-143874810 TAAGATCTGCTGTGTCCTGGAGG + Intronic
981383352 4:144098847-144098869 TAAGATCTGCTGTGTCCTGGAGG + Intergenic
981465460 4:145065971-145065993 CTAGATTTTTTTTTTCCTGGTGG - Intronic
981609527 4:146578377-146578399 CATGATTTATTTTTTCCTTGAGG + Intergenic
982189852 4:152843084-152843106 TCAGATTTTTTTTGTCCTATGGG + Intronic
982799159 4:159681358-159681380 TAAGATTTTTTTTATCCCTGTGG - Intergenic
983333988 4:166368732-166368754 TAATTTTCATTTTGTCATGGTGG + Intergenic
983615217 4:169696523-169696545 AAATATTTATTATGTCCTTGTGG + Intronic
985065810 4:186120444-186120466 TTGGAGTTATTTTGTTCTGGTGG - Intronic
986511845 5:8515714-8515736 TAAGATTCATTTTTTAATGGAGG - Intergenic
986582531 5:9280079-9280101 TAACATGTATTTTTTCTTGGAGG + Intronic
986636880 5:9831739-9831761 CAAGAATTATTTTGCCTTGGAGG - Intergenic
986912092 5:12570490-12570512 TAAGAATGACTTTCTCCTGGTGG - Intergenic
987260758 5:16200193-16200215 TAAGCTTTTTGTTGTGCTGGTGG - Intergenic
987634404 5:20521020-20521042 TAAAATTTTTTTTCTCCAGGTGG - Intronic
987695221 5:21319846-21319868 TAAGATTTATTTTTTACTGCTGG - Intergenic
987762491 5:22183728-22183750 TAAGATTTCTTGTGTCCTGTGGG - Intronic
988242949 5:28637369-28637391 TTTAATTTATTTTTTCCTGGTGG - Intergenic
989307239 5:39972709-39972731 TGATTTTTTTTTTGTCCTGGTGG + Intergenic
989829397 5:45895732-45895754 AAAGATTTATTTGATGCTGGTGG - Intergenic
990314975 5:54575312-54575334 TAAGAATTATTTTGAGCTGAAGG + Intergenic
990626634 5:57620457-57620479 TGAGATTTATTTTATACTGATGG + Intergenic
990710085 5:58570923-58570945 TAAGACTTATTTTATACTAGGGG - Intergenic
990731578 5:58814539-58814561 CAAGATTTATATTGTCCTGGGGG - Intronic
991093716 5:62717924-62717946 TAAGGATTATTTTGACCTGAAGG - Intergenic
991141875 5:63253995-63254017 AAAGATTTAATTCTTCCTGGAGG + Intergenic
991897280 5:71417114-71417136 TAAGATTTCTTGTGTCCTGTGGG - Intergenic
992913005 5:81416764-81416786 GAAGTTTTATTTTATTCTGGAGG + Exonic
994024102 5:95061754-95061776 TAATATTTATTATGTCTTTGTGG + Intronic
994267080 5:97730141-97730163 TCAGTTTTATTATGTACTGGAGG + Intergenic
995583114 5:113621251-113621273 AAAGATAAATTTTGTCCTGTGGG + Intergenic
996660825 5:126000409-126000431 TAAGATTTATTTCTCCCTGCTGG + Intergenic
996839635 5:127833998-127834020 TAAGAATTATTTTGAGCTGAGGG + Intergenic
996967027 5:129318842-129318864 TAAGATTTATGTTTTTTTGGAGG + Intergenic
997679548 5:135740085-135740107 TCAAATTTATATTGACCTGGTGG - Intergenic
1000675775 5:164120769-164120791 TATTATTTATTTTTTCCTGCTGG - Intergenic
1000719222 5:164685240-164685262 TGTGATTAATTTTGTCTTGGTGG - Intergenic
1001371163 5:171203955-171203977 GAAGATGTATTTTGTTCTGGAGG + Intronic
1002034516 5:176456697-176456719 TATGATATATTTTGATCTGGAGG + Intronic
1002936664 6:1679807-1679829 TAAGATTTGTTTTGTAATGACGG - Intronic
1004514446 6:16310083-16310105 TAATATGTATTTTGTTCTAGAGG - Intronic
1005555663 6:26979991-26980013 TAAGATTTATTTTTTACTGCTGG + Intergenic
1008248168 6:49204510-49204532 TATGATTTTTTTTCTTCTGGTGG + Intergenic
1008383505 6:50860040-50860062 TTACAGTTATTTTGTCCTTGAGG + Intergenic
1008459801 6:51754886-51754908 TAAGGACTATTTTGTCATGGGGG + Exonic
1008801676 6:55376226-55376248 TAAGATTTTTTTTGTGCTGCTGG + Intronic
1008850800 6:56018795-56018817 TGAGATTTATTTTCTCTGGGTGG - Intergenic
1008867451 6:56230109-56230131 TAAAATTTATTTCTTCCTGTGGG + Intronic
1009263646 6:61527343-61527365 TAAGAATTATTTTGAGCTGAAGG + Intergenic
1009668229 6:66710234-66710256 TCAGAATTATTTTGTCTTGTGGG + Intergenic
1010006088 6:70997333-70997355 TAAGATTGATTTTGTCATTTTGG + Intergenic
1010796444 6:80122220-80122242 TAAGATTTTTTATGTGCTGCTGG + Intronic
1011666077 6:89635436-89635458 TCAGAATTATTTTGTCTTGTGGG + Exonic
1011940960 6:92842598-92842620 TAACTGTTATTTTGGCCTGGGGG + Intergenic
1012088028 6:94854765-94854787 TAAGATTTTTTATGTGCTGCTGG - Intergenic
1012667083 6:101985220-101985242 TAAATTATATTTTGTCCTTGAGG + Intronic
1012855989 6:104502359-104502381 AAAGATAAATTTGGTCCTGGTGG - Intergenic
1013003371 6:106046897-106046919 TGAGATATATTCTTTCCTGGAGG + Intergenic
1013090496 6:106896226-106896248 TAAGAGTTATTTTGAGCTGAAGG - Intergenic
1014174508 6:118316909-118316931 TGCGATTTTTTTTTTCCTGGAGG - Exonic
1014610045 6:123531996-123532018 TAGGATTCATTTTGCCCTGTAGG - Intronic
1014742862 6:125166950-125166972 TAAGAGTTATTTTGAGCTGAAGG - Intronic
1015794873 6:137001610-137001632 TAGGTTTCATTTTCTCCTGGTGG + Exonic
1016282313 6:142432259-142432281 AAAGGGCTATTTTGTCCTGGAGG + Intronic
1017569261 6:155725497-155725519 CAAGAGTAATTCTGTCCTGGTGG - Intergenic
1018498507 6:164376986-164377008 TAAGAATTATTTTGAGCTGAAGG - Intergenic
1020573002 7:9890187-9890209 TGAGATTTTTTTTCTCCTTGAGG + Intergenic
1021242820 7:18225724-18225746 TATGATTTATATTTTCCTGTTGG + Intronic
1021459815 7:20873558-20873580 TCATAGTTACTTTGTCCTGGAGG + Intergenic
1022013802 7:26330996-26331018 TAAGAATTATCTGGTCATGGTGG + Intronic
1023170057 7:37382441-37382463 TAAGAATTATTTTGAGCTGAAGG + Intronic
1024103597 7:46058828-46058850 GAAAATATATTCTGTCCTGGAGG - Intergenic
1024422686 7:49187856-49187878 TAAGGTTCATTTTGGCATGGAGG - Intergenic
1024447810 7:49501812-49501834 TAAGATTTTTATTGTCATAGTGG + Intergenic
1025220857 7:57106413-57106435 TAAAAATTATTTTGGGCTGGGGG - Intergenic
1025631669 7:63278231-63278253 TAAAAATTATTTTGGGCTGGGGG - Intergenic
1025650912 7:63468156-63468178 TAAAAATTATTTTGGGCTGGGGG + Intergenic
1025997868 7:66539493-66539515 AGAGATTTATTTTGCCATGGTGG + Intergenic
1026990760 7:74584051-74584073 AAAGATTTATTTTGCCATGGGGG + Intronic
1029987962 7:104939048-104939070 TAAGAATTATTTTGAGCTGAAGG - Intergenic
1031069991 7:117151640-117151662 TAGAATTTATTTTGTAATGGAGG - Intronic
1031207980 7:118786668-118786690 TAAGATATATTTTCTCCTAAAGG + Intergenic
1031244274 7:119288051-119288073 TAGGAGGTATTGTGTCCTGGGGG - Intergenic
1031869869 7:127079937-127079959 TAAGATTATTTTTGTCCCTGTGG + Intronic
1033086518 7:138347228-138347250 AAAGATTTATTTTGTGGTAGTGG - Intergenic
1034617256 7:152429157-152429179 GAAGATTTATTGTGGCCTAGAGG - Intronic
1036610107 8:10342461-10342483 TAAGAATAATTTTGACCTTGTGG + Intronic
1038475483 8:27863465-27863487 TAAGAATTATTTTGAGCTGAAGG - Intergenic
1038625505 8:29189333-29189355 TAAGATTCATTTGGTCTAGGTGG - Intronic
1038765461 8:30423671-30423693 TAAGATTTACTATTTCCGGGAGG - Intronic
1038818787 8:30933204-30933226 TAAGAATTATTTTGAGCTGAAGG - Intergenic
1038890359 8:31714327-31714349 TAAGATTTTTTTTGTATTGGTGG + Intronic
1039205230 8:35145518-35145540 AAAGATTTATTTTTTCCTTGTGG - Intergenic
1041041314 8:53849008-53849030 TAAGAATTCTTTTGTACTGTTGG - Intergenic
1043133122 8:76487185-76487207 TAAGTTTTATTTTTTTCTGGTGG - Intergenic
1043656411 8:82673712-82673734 TAAGATATAGTCTGTCCTGGAGG - Intergenic
1044754033 8:95443417-95443439 TTTGTTTTGTTTTGTCCTGGCGG - Intergenic
1044891628 8:96842242-96842264 TCAGATTTTTGATGTCCTGGTGG + Intronic
1046709822 8:117498290-117498312 AATGATTTATTTTGTTCTTGTGG + Intergenic
1046850691 8:118969261-118969283 TAAGACTTATTTTGAACTTGTGG + Intergenic
1048071350 8:131024765-131024787 TAATATTTAATTTCTCCTAGTGG - Intronic
1048825046 8:138416148-138416170 TAAGATTTATTTTGTCCTGGGGG - Intronic
1050303704 9:4285423-4285445 AAAGATGTATTTTGTGCTTGCGG - Intronic
1050883515 9:10735438-10735460 TAATATTCATTTTTTCCTTGGGG + Intergenic
1051153621 9:14114954-14114976 TAAAAATTATTTTGTTCTAGAGG - Intronic
1052587110 9:30442849-30442871 TAAGATTTATGATGTGCTGCTGG + Intergenic
1052660534 9:31423126-31423148 TAATATTTATTTTGTTCTGTAGG - Intergenic
1053268088 9:36730534-36730556 GAAGGTTTATTTAGTCCTTGGGG + Intergenic
1053653832 9:40195995-40196017 TATGCTTTATTTTGTTGTGGTGG + Intergenic
1053904218 9:42825161-42825183 TATGCTTTATTTTGTTGTGGTGG + Intergenic
1054365954 9:64342215-64342237 TATGCTTTATTTTGTTGTGGTGG + Intergenic
1054530766 9:66180352-66180374 TATGCTTTATTTTGTTGTGGTGG - Intergenic
1054673582 9:67831945-67831967 TATGCTTTATTTTGTTGTGGTGG + Intergenic
1055906832 9:81304580-81304602 CAAAAACTATTTTGTCCTGGAGG + Intergenic
1056236822 9:84602831-84602853 CAAGAATTACTTGGTCCTGGTGG + Intergenic
1056312294 9:85352777-85352799 TAAGGTTTAGTCTGTCCTGCTGG - Intergenic
1056481388 9:87010050-87010072 TAAGTTTTCTTCTGTCTTGGTGG - Intergenic
1056488310 9:87081193-87081215 TAAGTTTTTATTGGTCCTGGAGG + Intergenic
1061356207 9:130107122-130107144 TAGGGTTTATTCTCTCCTGGTGG + Intronic
1186177676 X:6942510-6942532 TAAGAATTATTTTGACCTGAAGG - Intergenic
1187153246 X:16700899-16700921 TGTGATTTATTTTGTCCTATGGG - Intronic
1187187469 X:17000856-17000878 TACCATTTATTTTCTCCTTGTGG + Intronic
1187537558 X:20156865-20156887 TAAGACTTTTTTTGTGCTGCTGG + Intronic
1188206143 X:27360889-27360911 TAAGTATTATCTTGTCCTGTAGG - Intergenic
1188346739 X:29076578-29076600 TAAGTTTTATGTTTTCCTGGTGG + Intronic
1188390158 X:29609910-29609932 TAAGATTTAATTCATCCTGATGG - Intronic
1188780607 X:34279423-34279445 TGAGTTTTATTTTGTCTTGAGGG + Intergenic
1189156622 X:38764387-38764409 TAAAAATAATTTTGTCCAGGTGG - Intergenic
1191592036 X:62897075-62897097 TGGCATGTATTTTGTCCTGGGGG - Intergenic
1192868436 X:75161476-75161498 AAAGATTTTTTTTCCCCTGGAGG - Intergenic
1193019150 X:76770811-76770833 TAACACTTGTTTTGTCCTTGGGG - Intergenic
1193406802 X:81110377-81110399 TAAGCTTTATTTTGTCTGGTAGG - Intergenic
1194213313 X:91096457-91096479 TAAGATATATTTTGTGCTCTTGG - Intergenic
1194457207 X:94119389-94119411 TCATATTTATTTTTTCCTGGTGG - Intergenic
1195857043 X:109342869-109342891 TATCATTTTTTTTTTCCTGGTGG - Intergenic
1196583280 X:117400067-117400089 TGAGAATTATTTTGTCTTGTGGG - Intergenic
1196641359 X:118066056-118066078 TAATATTTATTTAGTAGTGGAGG + Intronic
1196766365 X:119248756-119248778 TAAGATTAATTTTCTCCTGGTGG + Intergenic
1197851838 X:130870510-130870532 TGATTTTTATTCTGTCCTGGTGG - Intronic
1197872262 X:131071422-131071444 TAAGATTTATTTAATTCTGGGGG + Intronic
1198122560 X:133608298-133608320 AAAGTTATATTTTGTCCTTGTGG - Intronic
1200802603 Y:7400039-7400061 TAAAATCTGTTTTGTTCTGGTGG + Intergenic
1201639987 Y:16168317-16168339 AAAGATAAATTTTGTCCTGGGGG + Intergenic
1201662826 Y:16417008-16417030 AAAGATAAATTTTGTCCTGGGGG - Intergenic
1202330363 Y:23745175-23745197 TAAAATTTATTTCCTCCTGGAGG + Intergenic
1202540406 Y:25924886-25924908 TAAAATTTATTTCCTCCTGGAGG - Intergenic