ID: 1048825047

View in Genome Browser
Species Human (GRCh38)
Location 8:138416149-138416171
Sequence TTAAGATTTATTTTGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 453}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048825047_1048825051 7 Left 1048825047 8:138416149-138416171 CCCCAGGACAAAATAAATCTTAA 0: 1
1: 0
2: 1
3: 49
4: 453
Right 1048825051 8:138416179-138416201 TACTTTTGGAGTACAAAACTAGG No data
1048825047_1048825050 -7 Left 1048825047 8:138416149-138416171 CCCCAGGACAAAATAAATCTTAA 0: 1
1: 0
2: 1
3: 49
4: 453
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048825047 Original CRISPR TTAAGATTTATTTTGTCCTG GGG (reversed) Intronic
900233185 1:1572859-1572881 TTAACAATAATTTTGTCTTGGGG + Intronic
900530085 1:3148851-3148873 TTAAGATTTAGTGTGTTGTGGGG + Intronic
902076011 1:13786534-13786556 TTAAGGTTTGTTTTGTTTTGGGG - Intronic
902353201 1:15874229-15874251 CTAAGATTTTTTTTTTCTTGTGG + Intronic
902856754 1:19211836-19211858 TGCAGATTAATTTTGTCCTCTGG - Intergenic
903258693 1:22119606-22119628 TTAAGAGTTCTTTTTTCCAGAGG + Exonic
904633150 1:31858488-31858510 ATAAGAATTATTTTGTACTTAGG + Intergenic
906394144 1:45446001-45446023 TTAAGTTTTTGTTTCTCCTGAGG - Intronic
907895347 1:58684010-58684032 TTAAGCTTTATTCTGTTCTGAGG + Intronic
908311043 1:62884395-62884417 TTGAAAATTAATTTGTCCTGTGG - Intergenic
908778994 1:67671232-67671254 TTAATAATTATTGTGTCCAGTGG + Intergenic
908943890 1:69470798-69470820 ATGACATTTATTTTGTCCTAAGG - Intergenic
908954627 1:69607807-69607829 TCAATTTTTAGTTTGTCCTGAGG + Intronic
909048813 1:70744019-70744041 TTAAGATTAATATTGACATGTGG + Intergenic
909377222 1:74953221-74953243 GTATGATTCATTTGGTCCTGAGG + Intergenic
910904438 1:92160365-92160387 TGGAGATTTATTTTGTTCTTTGG + Intergenic
911763369 1:101642511-101642533 CCAAGATTTAATTTGTTCTGGGG + Intergenic
911791569 1:102022435-102022457 TTAAGGTTTTTTTTTTCCTTTGG + Intergenic
911845437 1:102746470-102746492 TAAAGAGAAATTTTGTCCTGTGG + Intergenic
912096878 1:106156303-106156325 TTACAATTTTTTTTTTCCTGTGG - Intergenic
912193679 1:107372407-107372429 TTGAGATTTAATTTGACCTGTGG + Intronic
912582949 1:110736547-110736569 GTCAGACTTCTTTTGTCCTGAGG - Intergenic
913038151 1:114994860-114994882 TTAAATTTTATTTTGTACTCAGG + Exonic
913406556 1:118499803-118499825 TTCAGATTTATTTTTACTTGAGG - Intergenic
913704733 1:121408344-121408366 TTTAGATTTATTTGTACCTGTGG - Intergenic
914017833 1:143837615-143837637 TAGAGATTTATTTTCTCCAGAGG - Intergenic
914506972 1:148297668-148297690 TGAAGATTTATTCTCTCCAGAGG + Intergenic
914656442 1:149746145-149746167 TAGAGATTTATTTTCTCCAGAGG - Intergenic
915874348 1:159596491-159596513 TTAACAGTTATATTGTGCTGGGG - Intergenic
916083985 1:161254939-161254961 TTAAGAGACGTTTTGTCCTGTGG - Intergenic
916457406 1:164985133-164985155 TTAAGTTTTATTTTGGGCTTGGG + Intergenic
916529435 1:165641793-165641815 TTATGATTCATCTTTTCCTGTGG - Intronic
917654554 1:177113190-177113212 TTATGAGTTATTGTTTCCTGTGG - Intronic
917765337 1:178210391-178210413 TTATGATTTCTTTTGTCCTTGGG + Intronic
917913946 1:179681716-179681738 TTAATTTTTTTTTGGTCCTGTGG - Intronic
918129489 1:181612942-181612964 TTAAGATTTATTTTTTTATGTGG + Intronic
918203416 1:182288331-182288353 TGAGCATGTATTTTGTCCTGAGG + Intergenic
918503200 1:185221843-185221865 TTAAGTTTTGTCTTGACCTGGGG - Exonic
918928330 1:190817020-190817042 TTGAGATTTTTTTTCTCCTTAGG - Intergenic
919559017 1:199095091-199095113 TAAAGATAAGTTTTGTCCTGTGG - Intergenic
919797509 1:201330203-201330225 TTTAGATTTTTTTTTTCCTTGGG + Exonic
920590973 1:207218389-207218411 CTAAGAGAAATTTTGTCCTGTGG + Intergenic
921249727 1:213285669-213285691 TTGAGATTTACTGTGTCATGTGG + Intergenic
921965743 1:221086893-221086915 TGCAGATACATTTTGTCCTGAGG - Intergenic
922414236 1:225405821-225405843 TTAAGATTTAGTTTCACCAGTGG - Intronic
923781980 1:237032866-237032888 TTAAGTTTTATATTGTACTTAGG - Intergenic
923922647 1:238585829-238585851 GTTAGCTTTATTTTGACCTGGGG - Intergenic
924173685 1:241367536-241367558 TTAAATTTAAATTTGTCCTGTGG - Intergenic
1063600854 10:7480154-7480176 TTATCATTTTTTTTGTCTTGTGG + Intergenic
1063757989 10:9037881-9037903 ATAAGAGTTATTCTGTCCTCAGG - Intergenic
1064602555 10:17008296-17008318 TTTACATTTATTTAGTCCTGTGG + Intronic
1064628976 10:17289841-17289863 TTAACTTTTAATGTGTCCTGTGG + Intergenic
1064896271 10:20240949-20240971 TAAATATTTATTTTGTCTTCTGG + Intronic
1065142879 10:22736597-22736619 TTAAGATTTACATTGTGCGGGGG - Intergenic
1065511855 10:26487233-26487255 TTAATCTTTATTTTGACCTTTGG + Intronic
1066329677 10:34406816-34406838 TACAGATTTTTTTTCTCCTGGGG - Intronic
1066523636 10:36251358-36251380 TACATATTTATTCTGTCCTGTGG + Intergenic
1067700749 10:48569832-48569854 TTGTGATTTATTTGGTCTTGAGG + Intronic
1068464068 10:57365021-57365043 CTAAGATTCAAATTGTCCTGAGG + Intergenic
1072274070 10:93805119-93805141 TTAATATATATTTTGTCTTTAGG - Intergenic
1072545386 10:96432979-96433001 TTAATATTGATTTTGCCCTTTGG + Intronic
1073820375 10:107255807-107255829 TTTAGATTTCTTTTCTCCTGTGG - Intergenic
1074027491 10:109651593-109651615 TTTAGATTTATTTTTTCTTCTGG + Intergenic
1075131208 10:119741533-119741555 TTAATTTTTATTTTTTCTTGAGG + Intronic
1075609701 10:123842540-123842562 TTAAGACATATCTTTTCCTGAGG + Intronic
1076445004 10:130508401-130508423 TTGAGATTTATTTCCTCCAGAGG + Intergenic
1078000502 11:7490881-7490903 TTATGATCTATTTTGTGTTGTGG - Intronic
1079319557 11:19440577-19440599 TGAACATTTATTTGGTACTGAGG + Intronic
1081825456 11:46046658-46046680 TTAATATTATTTTTGTCTTGTGG - Intronic
1082146618 11:48678402-48678424 TTAGGATTGATTTTGTGATGCGG + Intergenic
1082954960 11:58860077-58860099 TTATGATTGATTTTGTTCTTAGG + Intronic
1084897354 11:72283157-72283179 TTTAGATATATTTTAACCTGTGG - Intergenic
1085153377 11:74270015-74270037 TTAAAATGTATTTTTTCCTAAGG - Intronic
1085632680 11:78132276-78132298 TAAAGATTTATTTTGCCTTGAGG - Intronic
1085834754 11:79940801-79940823 TTAAGGTCTATTTTGTTCTTAGG + Intergenic
1086083500 11:82930550-82930572 TTAGTATTTATTTTGCCCTCCGG + Intronic
1086145767 11:83550008-83550030 GGAAGATTTATTATGTTCTGTGG + Intronic
1087333131 11:96808993-96809015 TTAAGAATTGTTATGTCCTTTGG + Intergenic
1087922728 11:103885298-103885320 TTTAAATTTATTTTGCCATGTGG + Intergenic
1088569615 11:111210031-111210053 TTATAACTTGTTTTGTCCTGTGG - Intergenic
1090100022 11:123784723-123784745 TTAAGACTTTTATTGTGCTGTGG - Intergenic
1091161235 11:133422669-133422691 TTAATAATTATTATGTCATGAGG + Intronic
1091196435 11:133734971-133734993 TTAAAATTTCTTTTTTCATGTGG + Intergenic
1091607603 12:1968735-1968757 TTAAATTTTATTTTTTCCAGTGG - Intronic
1092113184 12:5979327-5979349 CTAAGATTTATTATGTCATTAGG - Intronic
1092117878 12:6022272-6022294 ATAAGATTTCATTTGTCCTGAGG - Intronic
1092683120 12:11011112-11011134 GTAGAATTTATTTTTTCCTGTGG - Intronic
1092730301 12:11526078-11526100 TGGAGATTTATTTTTTCCTATGG + Intergenic
1093369361 12:18348682-18348704 TAAAGATGTAATTTGTCATGAGG - Intronic
1094091161 12:26651859-26651881 TTCAGGTTTCTTTTGTCTTGTGG + Intronic
1094256580 12:28435872-28435894 TGATAATTTATTTTGTTCTGAGG + Intronic
1094335719 12:29349881-29349903 TAAAAATTTATTTTTTCCTTTGG + Intronic
1097907038 12:64931275-64931297 TTCAGATTTTTTTTGTCCCACGG + Intergenic
1098528095 12:71510050-71510072 TTGAGATTTTTTTCTTCCTGAGG + Intronic
1098579500 12:72082357-72082379 TTCAGTTTTATTTTCTCCTTTGG + Intronic
1099256461 12:80320148-80320170 TAATAATTTATTTTGTCCTTGGG - Intronic
1099478587 12:83139819-83139841 TTTAAATGTATTTTGTCTTGGGG + Intergenic
1099590513 12:84581885-84581907 TTAACATTTATTTTATACTTCGG - Intergenic
1099934799 12:89112026-89112048 TTGGGATTTATTTTTGCCTGTGG + Intergenic
1101291855 12:103378307-103378329 GGATGATTTTTTTTGTCCTGTGG + Intronic
1101595193 12:106158509-106158531 TTAAAAGTTATCTTTTCCTGTGG + Intergenic
1101779843 12:107825260-107825282 TAAAGAGAAATTTTGTCCTGTGG - Intergenic
1102633779 12:114304690-114304712 TTTAGATTTTTTTTTTCCTAAGG + Intergenic
1103114312 12:118312476-118312498 TTAAGATTTTTCTTGGTCTGGGG + Intronic
1103490970 12:121319651-121319673 TTAACAATTATTTTATTCTGGGG + Intronic
1103858466 12:123992021-123992043 ATATGCTTCATTTTGTCCTGCGG - Intronic
1104770317 12:131357636-131357658 TTAAGGGTAATTTGGTCCTGGGG - Intergenic
1105268409 13:18845251-18845273 TAAAGATTTATTCTGTTTTGTGG - Intergenic
1105903097 13:24774791-24774813 TTAAACCTTATTTTGTCCTAAGG + Exonic
1106032378 13:26014811-26014833 TAAATTTTTATTTTCTCCTGTGG + Intronic
1106260990 13:28066615-28066637 TGAATATTTATTTTATCCTCTGG - Intronic
1106455769 13:29925218-29925240 TTAAGTTTTATTTTCAGCTGTGG - Intergenic
1107263702 13:38525687-38525709 ATAAGATTTATTTTTCCCTCTGG - Intergenic
1107491284 13:40881766-40881788 TGGATATTTATTTTGTCCTATGG - Intergenic
1107670663 13:42743452-42743474 TTCAGATTTTTTCTGGCCTGTGG - Intergenic
1108431571 13:50359002-50359024 TCAACATTTATTTTGTGCAGAGG - Intronic
1108557682 13:51611443-51611465 TTAAGATTTGTTGTATGCTGAGG - Intronic
1109062588 13:57635830-57635852 TTTGTATTTGTTTTGTCCTGTGG + Intronic
1109614838 13:64819098-64819120 GTAATATTTATTTTGTCATTTGG + Intergenic
1110432839 13:75445076-75445098 TTAGGGTTCATCTTGTCCTGGGG - Intronic
1110528505 13:76568562-76568584 GTAAGCTTAATTGTGTCCTGGGG + Intergenic
1111611112 13:90608586-90608608 TTAAATTTTATTTTGTGCTTTGG - Intergenic
1111736351 13:92144734-92144756 TTTAGAATTATTTTGTTATGTGG - Intronic
1111794903 13:92906423-92906445 ATAAGATGTATTTTTTCCTCTGG - Intergenic
1114823576 14:26051087-26051109 TTAACATTTAATGTGTTCTGAGG - Intergenic
1115767826 14:36642334-36642356 ATAAGCTTAATTTTGTACTGCGG + Intergenic
1116253061 14:42512417-42512439 TTAAGTGGTATTTTTTCCTGGGG + Intergenic
1117705212 14:58459111-58459133 TAAGGTGTTATTTTGTCCTGGGG + Intronic
1118500720 14:66360005-66360027 TTAACATTTATTTTGTCCCTGGG - Intergenic
1119017338 14:71072740-71072762 TTAATTTTTATTTTGTTCTGTGG - Intronic
1120603252 14:86539207-86539229 TTAAGAATTATTTTGATCTTAGG - Intergenic
1202830903 14_GL000009v2_random:28716-28738 TAAAGATTTATTCTGTTTTGTGG + Intergenic
1123953425 15:25308015-25308037 TTAACATTTATTAAGTCTTGTGG + Intergenic
1124820560 15:33041926-33041948 TTAAAATTTATTTTTAGCTGTGG - Intronic
1126868190 15:52958953-52958975 TTAGCTTTTATTTTGCCCTGAGG + Intergenic
1126936613 15:53716480-53716502 TGAATTTTTATTTTGTCATGAGG - Intronic
1127036366 15:54922735-54922757 TTTAGATTTCTTTTTTCCTCAGG + Intergenic
1127847471 15:62883845-62883867 TTCAGATTTAGTTGGTCTTGGGG - Intergenic
1128901859 15:71430143-71430165 TTAAAATTTCTTTTTTCCTAAGG - Intronic
1128911369 15:71518528-71518550 TTAAGGTTTATGTTATCCTCTGG + Intronic
1129131219 15:73498389-73498411 TTATGTTTTATTTTGTCTTTGGG + Intronic
1129335171 15:74847759-74847781 TTGAGATTAATTTTGAGCTGAGG + Intronic
1130120534 15:81043637-81043659 TGAGGATTTATTATGTTCTGTGG + Intronic
1131653861 15:94433191-94433213 AAAAGATTAATTTTTTCCTGAGG - Intronic
1134802108 16:17094344-17094366 TTCAGACTTACTTTGTCTTGTGG + Intergenic
1135104624 16:19637738-19637760 TGAATATTTCTTTTGGCCTGGGG - Intronic
1138718807 16:59054562-59054584 TTTTAATTTATTTTTTCCTGTGG - Intergenic
1140093454 16:71855509-71855531 TTTAGTTTTATTTTTACCTGCGG + Exonic
1141200624 16:81895024-81895046 TAAACATTTGTTTTTTCCTGAGG - Intronic
1141542459 16:84736514-84736536 TTAAAAATTATTTTCTCCAGTGG + Intronic
1141908031 16:87040556-87040578 TTGAGCTGTATTTTTTCCTGGGG - Intergenic
1143309200 17:5974510-5974532 TTAAGATGTAGTTTTTACTGAGG + Intronic
1143425738 17:6835803-6835825 TTTTGATTTATTTTGTACTGTGG - Intergenic
1143810786 17:9469983-9470005 AAAAAATTTATTATGTCCTGAGG - Intronic
1144071637 17:11678657-11678679 TTAAGATTTTTTTTTTCTTTTGG + Intronic
1144300122 17:13915573-13915595 TAAAGTTTTATATTGTCCTGAGG - Intergenic
1144351027 17:14396530-14396552 TTAAGATTTATTTGGAATTGGGG + Intergenic
1144501437 17:15789529-15789551 TTATGATTTATTTTCTCCTTAGG - Intergenic
1144742063 17:17589427-17589449 ATCAGACATATTTTGTCCTGTGG - Intronic
1145071415 17:19811795-19811817 TTAAGATCTTTTTTGTCCTTAGG - Intronic
1145163613 17:20592200-20592222 TTATGATTTATTTTCTCCTTAGG - Intergenic
1146424830 17:32727317-32727339 CTAAGAGATATTTGGTCCTGTGG - Intronic
1146453945 17:32995196-32995218 TTACGGATTATTTAGTCCTGAGG - Intronic
1148550283 17:48546193-48546215 TTAAAATTTATTTTATTTTGAGG + Intergenic
1148859087 17:50594783-50594805 TTCAGATTCATTCTGGCCTGAGG + Intronic
1149418187 17:56482453-56482475 GTAAGGATTATTCTGTCCTGGGG - Exonic
1149748422 17:59122071-59122093 TTAAGTTTTATTTTCTCCCATGG - Intronic
1150933138 17:69606884-69606906 ATAAGAATTATTTTGAGCTGGGG - Intergenic
1150951314 17:69804930-69804952 TTATTATTTATTGTGTCCTTTGG - Intergenic
1151006640 17:70445270-70445292 TGGATATTTATTCTGTCCTGTGG - Intergenic
1151112895 17:71700478-71700500 CTAACATTTATTCTGTCCTCAGG - Intergenic
1151145821 17:72040031-72040053 TTAAGATCTATTTGGTTCTATGG - Intergenic
1152979195 18:258084-258106 TTAAGATTTTTTTTCTCCTTTGG - Intronic
1153403658 18:4709969-4709991 TTCAGGTATATTTTGTGCTGTGG + Intergenic
1154362968 18:13679846-13679868 TTAAGATTTCTTCAGTGCTGTGG - Intronic
1156273110 18:35555470-35555492 TTAAGATTTATTCTGCACGGTGG - Intergenic
1157914673 18:51653184-51653206 TTAAAATTAATATTTTCCTGTGG - Intergenic
1159543527 18:69811898-69811920 TAAACATTTATTTTGTCTTGAGG - Intronic
1159572154 18:70128278-70128300 TTAAGTTTTACTTTTTCCTTAGG - Intronic
1160052585 18:75449551-75449573 TTAATATTTATTTTATTTTGTGG - Intergenic
1160557803 18:79737403-79737425 TTAAGATTTATTTTTTAGTAAGG + Intronic
1163563512 19:18035456-18035478 CTAAGATTTTTTTTGTGATGTGG - Intergenic
1164290692 19:23866482-23866504 GTAAGATCCTTTTTGTCCTGAGG - Intergenic
1166020819 19:40027561-40027583 TTAAGGTTTCTTTTGACCTTTGG + Intergenic
1166472991 19:43096327-43096349 TTGAGATTTATTTTGTGCATGGG + Intronic
1167061737 19:47152820-47152842 TTAAGATTTATTTAGACATCAGG + Intronic
1167168347 19:47814369-47814391 TTAAGGTTTATTATGCGCTGTGG + Intronic
1167811386 19:51834581-51834603 TTAAGATTTATTTGGCCCATGGG - Intergenic
1167847571 19:52177064-52177086 TTAATTTTTTTTTTTTCCTGTGG + Intergenic
1202641791 1_KI270706v1_random:99059-99081 TAAAGATTTATTCTGTTTTGTGG - Intergenic
925530721 2:4858998-4859020 TGGAGATTTATTTAGTCTTGGGG + Intergenic
925568521 2:5283668-5283690 TTAAAATTTACTTTCTCCTTGGG + Intergenic
926020387 2:9489924-9489946 TTAAAATATCTTTTGACCTGTGG - Exonic
926825275 2:16900241-16900263 TTCAGGTATATTTTGTCATGAGG + Intergenic
926827543 2:16922270-16922292 CTAATATTTATTTTGTGTTGTGG - Intergenic
926887190 2:17609092-17609114 TGAAGATTAATTTTCTCATGGGG + Intronic
926981420 2:18574822-18574844 TTAAAATTTTTTTTGTATTGTGG - Intronic
927295117 2:21444883-21444905 TTATGATTTATTTTGTCTCAAGG - Intergenic
928599320 2:32887662-32887684 TTAACATTTATTTTATACTTTGG - Intergenic
928760818 2:34579974-34579996 TTAGGTTTTATTTTTTCCTCTGG - Intergenic
930303672 2:49650132-49650154 TGAATATTTATTTTATTCTGTGG - Intergenic
930320253 2:49845107-49845129 TTACTATTTATTCTGACCTGTGG - Intergenic
930857642 2:56036312-56036334 TTAAAATTTAGTTTGTTTTGAGG + Intergenic
931023688 2:58082368-58082390 TAAAGATTTATTTGCTGCTGTGG + Intronic
931325619 2:61219113-61219135 TGAATATTTATTTTATCCTTGGG + Intronic
932395076 2:71438949-71438971 TTCAGTTTTGTTTTGTCCTGAGG + Intergenic
933492437 2:83003869-83003891 TTAAAAATTATTTGGTGCTGGGG - Intergenic
933531883 2:83521030-83521052 TGAAGGTTTATTTTCTCCCGTGG + Intergenic
934497622 2:94822510-94822532 TAAAGATTTATTCTGTTTTGTGG - Intergenic
935446606 2:103163495-103163517 GTAAGTTTTATTTTTTCCTGTGG - Intergenic
936334362 2:111576026-111576048 TTGAGAATTATCTAGTCCTGTGG + Intergenic
936447186 2:112605578-112605600 TTAAGCTGTATTTTGCCCTTAGG + Intergenic
936748029 2:115603683-115603705 TTAAGATTTATTTTGAACAAAGG - Intronic
937000291 2:118459812-118459834 TTAAGATTTATTATTTATTGAGG + Intergenic
937391168 2:121487873-121487895 TTAACATTTATTTTATACTTTGG + Intronic
937666400 2:124492517-124492539 TTCAGCTTTATTTTTTCCTCAGG + Intronic
938618276 2:133022000-133022022 TTATGATATATTTTCTCCTTTGG + Intronic
939065699 2:137481046-137481068 TTAAAAGTTATTTTCTCCAGAGG - Intronic
939200916 2:139032474-139032496 TTAAAATATATTTTGTCGTATGG + Intergenic
939713776 2:145557422-145557444 ATAAAATTTAATTTGTCCTGAGG + Intergenic
940144868 2:150535204-150535226 GTAAGCTTAATTTTTTCCTGAGG + Intronic
940325234 2:152418270-152418292 TTAATTTTTATTTTTTGCTGTGG + Intronic
941012473 2:160316746-160316768 TTAAGATTTCTTTTGGGGTGGGG + Intronic
941405978 2:165089213-165089235 TAAATAGTTATTTTATCCTGTGG - Exonic
941619621 2:167761781-167761803 TTAAGAGTCTTTTTATCCTGTGG - Intergenic
941845883 2:170132091-170132113 TTAAGATTTTTTTTCTCCTTTGG - Intergenic
942545495 2:177059208-177059230 TTTACATTTATTTTTTCCTATGG + Intergenic
942638001 2:178029545-178029567 TGAACATTTTTTTTTTCCTGAGG - Intronic
942919831 2:181359096-181359118 CTAAAAATTTTTTTGTCCTGAGG + Intergenic
943198079 2:184781358-184781380 TTAACAGTTATTCTCTCCTGGGG - Intronic
943272195 2:185820560-185820582 CTAAGATATAATTTATCCTGGGG - Intronic
944067028 2:195630054-195630076 TTAAAATTAATTTTTCCCTGTGG + Intronic
944930432 2:204512684-204512706 TTAAGATTTATATTGTGGAGAGG - Intergenic
945204911 2:207321025-207321047 TAAATATTTATTTTATACTGTGG - Intergenic
945338567 2:208621931-208621953 TTAATATTTTATTTGTCTTGTGG + Intronic
946515736 2:220409362-220409384 TGATGATTTTTTTTTTCCTGTGG + Intergenic
946557863 2:220879400-220879422 CTAAGATCTATTTTGCCCTCTGG + Intergenic
947072040 2:226299516-226299538 TGAATATTTATTTTGTACTTTGG - Intergenic
1168732141 20:93897-93919 GTAATATTTTTTTTTTCCTGTGG + Intronic
1169938805 20:10914863-10914885 TTAAGTTTTAATTTATCTTGGGG - Intergenic
1171109069 20:22463746-22463768 TTAAGTTTCATTTAATCCTGAGG - Intergenic
1171114908 20:22516881-22516903 TGAAGATTTACTATGTGCTGGGG - Intergenic
1171725433 20:28615861-28615883 TGAATATTTATTTTTACCTGTGG + Intergenic
1171752633 20:29067222-29067244 TGAATATTTATTTTTACCTGTGG - Intergenic
1171789470 20:29507110-29507132 TTAAGATTTATTTTGCTATTTGG + Intergenic
1171789636 20:29510351-29510373 TGAATATTTATTTTTACCTGCGG + Intergenic
1173565283 20:44034235-44034257 TTCAGTTTTTTTTTTTCCTGTGG + Intronic
1174130878 20:48342572-48342594 TAAAGAATTATTTTATCCTCTGG + Intergenic
1176610090 21:8873554-8873576 TAAAGATTTATTCTGTTTTGTGG + Intergenic
1176853682 21:13944540-13944562 TAAAGATTTATTCTGTTTTGTGG - Intergenic
1177381313 21:20347768-20347790 TTAGGAGATATTTTTTCCTGAGG - Intergenic
1177502290 21:21972759-21972781 ATAAGATTAACCTTGTCCTGAGG - Intergenic
1177532490 21:22379155-22379177 TTAAGATAAATACTGTCCTGAGG + Intergenic
1178021310 21:28411688-28411710 TTAAGAATTATTTAGTTCTAGGG - Intergenic
1178629688 21:34248357-34248379 TCAAGATTTATTTTTTGGTGAGG - Intergenic
1179377739 21:40866189-40866211 TAAAAATTTATTTTTTCCTAAGG - Intergenic
1180569314 22:16700686-16700708 ATAAGATTTCATTTGTCCTGAGG - Intergenic
1182344116 22:29648232-29648254 TTAAGATTTTTTTTATATTGGGG - Intronic
1184869145 22:47222635-47222657 TTATGATTTATATTTTCCTAGGG + Intergenic
949114195 3:299828-299850 CGTAGATTTATTTTTTCCTGTGG - Intronic
949145946 3:700528-700550 TTCAGATTTCTTTTTTCATGGGG + Intergenic
949837517 3:8285434-8285456 TTCAAATTTATTTTGTCCGAGGG - Intergenic
951287361 3:20830244-20830266 TTAAGATTTACTTTGTGGTTAGG + Intergenic
952109626 3:30107843-30107865 ATAAGATCTATTTTTTCCTAGGG + Intergenic
952275855 3:31875950-31875972 GTATGATTTATTCTCTCCTGGGG - Intronic
956072888 3:65473172-65473194 TTATGATTAATTTTGTCTTCAGG + Intronic
956506138 3:69942390-69942412 GTAAGTGTTATTTTGTCCTTTGG - Intronic
956763285 3:72462487-72462509 TTAAGATTCATTTGGTCATACGG + Intergenic
956932088 3:74055072-74055094 TTGAAATATATTTTGTTCTGAGG - Intergenic
957016929 3:75076928-75076950 TTAAGGATTATTTTGTCTTTAGG + Intergenic
957404649 3:79762005-79762027 TTAAGATTTATTTGGTTCAATGG + Intronic
957475460 3:80716698-80716720 TTAAGCTTTATTCTGTCATAAGG - Intergenic
958050721 3:88341609-88341631 GTAAGAGTTTTTTTTTCCTGTGG - Intergenic
958092973 3:88901235-88901257 TTTGTATTTATTTTCTCCTGCGG - Intergenic
958129676 3:89401970-89401992 CTAATATTTATTGTGTCCTGTGG + Intronic
958945703 3:100359675-100359697 TTACATTTTATTTTGTCCTGAGG + Intergenic
959454474 3:106541648-106541670 ATAAGATTTCTTTTGTAATGTGG + Intergenic
959671807 3:108987033-108987055 TTATGATTTCTTTTCTGCTGGGG - Intronic
959894563 3:111591733-111591755 TAAAGATTTCATTTGTCATGTGG - Intronic
959908827 3:111739954-111739976 TTAAAATTTTTTTTTACCTGAGG + Intronic
961716459 3:128861006-128861028 TTAAGAGTGATTCTGTCCTGAGG + Intergenic
961766875 3:129218330-129218352 TTGAGAGTCATTTTCTCCTGGGG + Intergenic
961805235 3:129484374-129484396 TTAAGAGTGATTCTGTCCTGAGG - Intronic
962440384 3:135408094-135408116 TTTACTTTTATCTTGTCCTGAGG - Intergenic
962505110 3:136038927-136038949 TTAAGATTTTTTAAGTCCAGAGG - Intronic
963619732 3:147591363-147591385 GTAAGTTTTACTTTATCCTGTGG + Intergenic
963981442 3:151542548-151542570 TTAAAATTTATATTCTGCTGTGG + Intergenic
963999904 3:151757986-151758008 TTAGGGTTTATTTAGTCCAGTGG - Intronic
965053345 3:163680820-163680842 TAAATATTTATTTTGTACTTTGG - Intergenic
965548377 3:169938453-169938475 TTAGGAATTATTGTATCCTGGGG - Exonic
967273765 3:187753103-187753125 TTAATATTTATTTTATACTTTGG - Intergenic
1202736774 3_GL000221v1_random:8341-8363 TAAAGATTTATTCTGTTTTGTGG + Intergenic
969887052 4:10224175-10224197 TTAAGTTTTTTTTTTTCCTCCGG + Intergenic
970417267 4:15871659-15871681 TTGAGGTTTATTTTCTTCTGAGG + Intergenic
970472157 4:16389593-16389615 TCAAAATTTATTTTTTCCTGTGG - Intergenic
970630247 4:17934872-17934894 TTAAAATATATTTTATCCTCAGG + Intronic
971109467 4:23567600-23567622 TTATGTTTTGTTTTGTTCTGGGG + Intergenic
971119117 4:23684365-23684387 TTAAGATTACTTTTCTCCTCTGG + Intergenic
971983353 4:33785608-33785630 TTAAGAGTTAGTTTTTCCTTAGG + Intergenic
972191093 4:36592085-36592107 TTAATATTTATTTTATGCTTTGG - Intergenic
972450602 4:39194419-39194441 TTAAGTTGTATTTTGTACTTTGG + Intronic
972841094 4:42931041-42931063 AAAAGCTTTATTTTGTCCTCAGG - Intronic
972962499 4:44471437-44471459 TCAATATTTATTTTGTACTCTGG - Intergenic
973385305 4:49509580-49509602 TAAAGATTTATTCTGTTTTGTGG - Intergenic
974482091 4:62458236-62458258 TTACCATTTATTTTGTGCTGTGG + Intergenic
974685988 4:65230438-65230460 GAGAGATTTATTTTGTACTGGGG + Intergenic
975011021 4:69352058-69352080 GTTAGATTTATTTTGTCTAGAGG + Intronic
975263906 4:72339186-72339208 GTAATTTTTATTTTGTTCTGGGG - Intronic
975625408 4:76341024-76341046 TTAAGGTTTATTTTGTGGTTTGG + Intronic
975663886 4:76714833-76714855 TCCATATTTATTTTATCCTGTGG + Intronic
976526792 4:86101501-86101523 GAAAGATTTATGTTGTCCTAAGG - Intronic
976913954 4:90346383-90346405 TTTATATTTATTTTGTTTTGTGG + Intronic
977036176 4:91956432-91956454 ATAAGATTTATTTTATTCTATGG - Intergenic
977276972 4:94989823-94989845 TTAAGCTTTATTTGGTCATGGGG + Intronic
978421281 4:108535767-108535789 ATGAGAGTTATTTAGTCCTGAGG + Intergenic
978629487 4:110727274-110727296 ATAACTTTTATTTAGTCCTGGGG - Intergenic
978752558 4:112267939-112267961 TTAATATTTATTTTTATCTGAGG + Intronic
978763706 4:112382496-112382518 TTCAGGTTTGTTTTGTCCTCTGG - Exonic
979217037 4:118178067-118178089 TTATGCTTTTTTTTTTCCTGTGG - Intronic
979475676 4:121154933-121154955 TTTTGATTTTTTTTTTCCTGGGG - Intronic
979812135 4:125049704-125049726 TCAAGATTTATTTTTCTCTGTGG + Intergenic
980736190 4:136892219-136892241 TTAAAATTCATTTTTTCCTCAGG + Intergenic
981090415 4:140726285-140726307 TTAAAATTTTTTTTTTTCTGAGG - Intronic
981100078 4:140820161-140820183 TTGAGTTCCATTTTGTCCTGAGG + Intergenic
981194448 4:141902493-141902515 CAAAGCTGTATTTTGTCCTGGGG + Intergenic
981972515 4:150681745-150681767 GTAAGAGATATTTTGTTCTGTGG + Intronic
982053064 4:151522658-151522680 TTAAGACAAATTTTGTCCTTTGG + Intronic
982189851 4:152843083-152843105 TTCAGATTTTTTTTGTCCTATGG + Intronic
982921055 4:161275788-161275810 TTATAATTTAGTTTCTCCTGTGG - Intergenic
983764974 4:171468233-171468255 TCAACATTTATTTTGGCCAGAGG + Intergenic
983826989 4:172275174-172275196 TCAACATTTCTTTTGTCCTTAGG - Intronic
983912387 4:173254279-173254301 TTAATATTTATTTTGGACTCAGG - Intronic
984194400 4:176641402-176641424 ATTAGAATTATTTTGTCCTCAGG + Intergenic
985435136 4:189921912-189921934 TGAATATTTATTTTTACCTGTGG - Intergenic
986027489 5:3864647-3864669 TTGTGATTTGCTTTGTCCTGTGG - Intergenic
986095132 5:4547176-4547198 ATAGGGTTTATTTTGCCCTGTGG + Intergenic
986816922 5:11422393-11422415 TTCTGATTTATTTTCTCCTGTGG - Intronic
987220517 5:15786294-15786316 TTCACTTTTATTTTGTTCTGTGG - Intronic
987762492 5:22183729-22183751 GTAAGATTTCTTGTGTCCTGTGG - Intronic
988180850 5:27789763-27789785 TTAAAATGTATTTTCACCTGTGG + Intergenic
988591701 5:32555306-32555328 TAAAGAGAAATTTTGTCCTGTGG + Intronic
989467301 5:41772130-41772152 TTACTATTTATTTTGTCATCAGG + Intronic
989799235 5:45515853-45515875 TTATATTTTATTTTATCCTGTGG - Intronic
990451722 5:55938758-55938780 TTATAATTTATTTTCTCCTTAGG + Exonic
990731579 5:58814540-58814562 ACAAGATTTATATTGTCCTGGGG - Intronic
991897281 5:71417115-71417137 GTAAGATTTCTTGTGTCCTGTGG - Intergenic
992046713 5:72899186-72899208 AGAATATTTATTTTTTCCTGTGG + Intronic
992049676 5:72930855-72930877 TAAAGATAAGTTTTGTCCTGTGG - Intergenic
992122194 5:73606397-73606419 TGAATATTTATTTTGTTCTATGG + Intergenic
992171604 5:74107355-74107377 TTAAGATTTATCTTCTTCTGTGG + Intergenic
992247661 5:74843330-74843352 TAAGGTTTTATTTTTTCCTGAGG + Intronic
993060492 5:83032766-83032788 TAAATATTTATTTTATACTGTGG - Intergenic
993272750 5:85816132-85816154 TTATCATTTATTTTTTTCTGAGG - Intergenic
993615070 5:90101127-90101149 TTAAGACTTATTCAGTCATGGGG + Intergenic
994652473 5:102546035-102546057 TTGAAATATATTTTGTCCAGAGG + Intergenic
995409851 5:111843899-111843921 TTCAGATTTATTTTGTTTAGTGG - Intronic
995583113 5:113621250-113621272 TAAAGATAAATTTTGTCCTGTGG + Intergenic
995836147 5:116401521-116401543 TCATCAGTTATTTTGTCCTGAGG - Intronic
996383880 5:122889789-122889811 TTAAGAGATTTTTTGTCCTTAGG - Intronic
996839634 5:127833997-127834019 ATAAGAATTATTTTGAGCTGAGG + Intergenic
996953085 5:129151474-129151496 TTAAGGTTAATATTGTCATGTGG + Intergenic
997019208 5:129977247-129977269 TTTGGATTCATTTTGTCCTTGGG - Intronic
998075131 5:139229927-139229949 TGAATATTTATTTTGTACTTTGG - Intronic
998223588 5:140307998-140308020 TTAAGATTCACTTTGTCTTTGGG + Intergenic
998484827 5:142492721-142492743 TTAAGTTTTACTTTTTCCTGGGG + Intergenic
998719892 5:144932928-144932950 TTAAGATTGACTTTGTGATGCGG - Intergenic
1000204413 5:159044905-159044927 TGAAGATTTTCTTTTTCCTGTGG - Intronic
1001527791 5:172441009-172441031 TTAGGATTGATTTGGGCCTGTGG - Intronic
1002830414 6:815414-815436 TTTAGGTTTAGTTTGTTCTGAGG - Intergenic
1003005725 6:2379641-2379663 TTATGCTTTAATTTGTCCTTTGG + Intergenic
1003954757 6:11151566-11151588 TTAAGGCTCCTTTTGTCCTGGGG + Intergenic
1004298954 6:14439802-14439824 TGCAGATTTGATTTGTCCTGAGG + Intergenic
1004527949 6:16426824-16426846 CTTAGATGTATCTTGTCCTGTGG + Intronic
1004940379 6:20550309-20550331 TGGATATTTATTTTATCCTGTGG + Intronic
1005335323 6:24790376-24790398 TTAAGAATTATTTCATCCAGAGG - Intergenic
1005439024 6:25845198-25845220 AAAAGATTTTTTTTTTCCTGTGG - Exonic
1005792564 6:29319834-29319856 TTAAGCTTTATTTTTACATGTGG - Intergenic
1006762665 6:36477113-36477135 TTTAGATTTGTTCTGTTCTGTGG + Intronic
1007981051 6:46158373-46158395 TTCAGGACTATTTTGTCCTGGGG + Intergenic
1008178792 6:48302083-48302105 CTAAGACCTATGTTGTCCTGAGG + Intergenic
1008314015 6:50016718-50016740 TTAATATTTTTTTTTTCCTGAGG - Intronic
1008867450 6:56230108-56230130 GTAAAATTTATTTCTTCCTGTGG + Intronic
1009274415 6:61656954-61656976 TTTGGATTTGTTTTCTCCTGAGG + Intergenic
1009549652 6:65071690-65071712 TTAAGAATTATCTTGTCTTCAGG - Intronic
1009668228 6:66710233-66710255 TTCAGAATTATTTTGTCTTGTGG + Intergenic
1011138643 6:84128704-84128726 TTAAGTTATACTTTGTTCTGGGG + Intronic
1011666076 6:89635435-89635457 TTCAGAATTATTTTGTCTTGTGG + Exonic
1011760433 6:90559101-90559123 TTAAGCTTTTATTTTTCCTGAGG - Intronic
1012022426 6:93941127-93941149 TTATGATTTAATTTTTCCTAGGG + Intergenic
1012220683 6:96645503-96645525 TAAAGACTTATTTTGACCTCCGG + Intergenic
1012818923 6:104060347-104060369 TTAAGTTTTATTTTGCATTGTGG - Intergenic
1012860912 6:104558233-104558255 TGAAGATTTATTTTTGCTTGAGG + Intergenic
1013494768 6:110687861-110687883 TTCAGATTAATGTTGTCCTTAGG - Intronic
1014082830 6:117307458-117307480 TTAAAATTTATTTTGTATTTAGG + Intronic
1014084115 6:117322676-117322698 TTAAAATTTGTATTGTGCTGAGG - Intronic
1014202546 6:118621987-118622009 TAAAGATAAATTTTGTCCCGTGG - Intronic
1014441878 6:121483090-121483112 TAAAGATATATTTTGTTGTGGGG - Intergenic
1014909624 6:127075666-127075688 TTAAGATGTATTTCATACTGTGG + Intergenic
1015987914 6:138904098-138904120 TTAAGATTTATTCTGTCTATAGG - Exonic
1017088349 6:150735838-150735860 TTAACATTTATTTTTTCCTGAGG + Intronic
1018298958 6:162379468-162379490 TTAGTATTTATTTAGTCTTGAGG - Intronic
1018382699 6:163273318-163273340 TTAAGATTTTTTTTCTCTGGAGG - Intronic
1018562370 6:165115129-165115151 TTTTGTTTTATTTTTTCCTGTGG - Intergenic
1019551960 7:1607684-1607706 TTAAGATTTAATTTATCATCAGG - Intergenic
1021237144 7:18156010-18156032 ATAATATTTATGTTGTCCTGAGG - Intronic
1021831889 7:24621037-24621059 TTAAAAGTACTTTTGTCCTGTGG - Intronic
1022826538 7:34020165-34020187 TACTGACTTATTTTGTCCTGAGG + Intronic
1023097689 7:36679049-36679071 TTTAACTTTATTTTGTCCTTTGG - Intronic
1024492708 7:50003839-50003861 TGAAGATTTATTTTTATCTGTGG - Intronic
1024776760 7:52796536-52796558 TTAAGATTAATTTTTTCCTATGG + Intergenic
1025220858 7:57106414-57106436 TTAAAAATTATTTTGGGCTGGGG - Intergenic
1025541732 7:62097700-62097722 TGTACATTTATTTTGTCCTGAGG - Intergenic
1025631670 7:63278232-63278254 TTAAAAATTATTTTGGGCTGGGG - Intergenic
1025650911 7:63468155-63468177 TTAAAAATTATTTTGGGCTGGGG + Intergenic
1026067412 7:67087382-67087404 TTAAAATTTATATTCTCTTGAGG + Intronic
1026990759 7:74584050-74584072 TAAAGATTTATTTTGCCATGGGG + Intronic
1028235194 7:88352894-88352916 TTAAAATATATTGTGTCCTTAGG + Intergenic
1028735033 7:94199478-94199500 TTACAATTCATTTTGTCCTTAGG + Intergenic
1030359668 7:108581429-108581451 TCTAGTTTTATTTTCTCCTGAGG - Intergenic
1030957023 7:115866194-115866216 TTCATATTTATATTGTCCTTTGG + Intergenic
1031244275 7:119288052-119288074 TTAGGAGGTATTGTGTCCTGGGG - Intergenic
1031618854 7:123912075-123912097 TTAAGATTTCCTGTGTCCTCAGG - Intergenic
1031814093 7:126410922-126410944 TTAATATTTTTTTTCTCTTGTGG + Intergenic
1031990541 7:128195634-128195656 TTAAAAATTATTTTTTCCTATGG + Intergenic
1032925082 7:136594966-136594988 TAAACATTTATTTTCTCCTTTGG + Intergenic
1033057168 7:138067925-138067947 ATAAGATGTATTTTGTAATGTGG - Intronic
1033535817 7:142311068-142311090 TTTAGATTTGTTTTAACCTGGGG - Intergenic
1033768140 7:144517311-144517333 TTGGGATTTATTTTTTCCTCTGG - Intronic
1033878323 7:145850451-145850473 ATAAGATTTATTATGTAGTGAGG + Intergenic
1033984223 7:147203000-147203022 TGAAGCTTTTTTTTTTCCTGTGG - Intronic
1034729421 7:153371564-153371586 GTAATATTTTATTTGTCCTGTGG - Intergenic
1036580355 8:10068505-10068527 TCTAGATTTATTTTTGCCTGTGG + Intronic
1040787784 8:51187114-51187136 TTAATATTTATTTTATGCTTTGG - Intergenic
1041657591 8:60369569-60369591 TAAAGATTTGTTTTTTCCTCTGG - Intergenic
1041987917 8:63948393-63948415 TCAATATTTATTTTTTGCTGAGG - Intergenic
1042524756 8:69752474-69752496 TGGAGATTTAATTTGTCCTTTGG + Intronic
1042772201 8:72392506-72392528 TAAAGATAAGTTTTGTCCTGTGG - Intergenic
1043238863 8:77905417-77905439 TCAAGATTTATATTTTCCTTAGG - Intergenic
1044320636 8:90796992-90797014 TCAAGCTGTATTTTGTCCTCAGG - Intronic
1045958947 8:107944558-107944580 TTAAGATTTTTTTTGTGTTATGG - Intronic
1045996037 8:108363192-108363214 TTAGTATTTATTTTTTCCTTTGG + Intronic
1046152424 8:110245170-110245192 TTAAGTCATATTTTTTCCTGAGG + Intergenic
1046685216 8:117217802-117217824 TCAAGATTTATGTTGCACTGAGG + Intergenic
1047003870 8:120599479-120599501 TTCAGATTTATTTTGAAATGAGG - Intronic
1047978179 8:130152572-130152594 AAAAGTTTTATCTTGTCCTGTGG - Intronic
1048206338 8:132418206-132418228 TTTATATTTATCTTGTCCTCAGG - Intronic
1048825047 8:138416149-138416171 TTAAGATTTATTTTGTCCTGGGG - Intronic
1049066954 8:140323697-140323719 ATAAAATATATTTTGTTCTGTGG - Intronic
1049367477 8:142247540-142247562 TCAAGACATGTTTTGTCCTGAGG - Intronic
1049874265 8:145005431-145005453 CTAAGATCTAGTCTGTCCTGTGG + Intergenic
1050883514 9:10735437-10735459 TTAATATTCATTTTTTCCTTGGG + Intergenic
1051563274 9:18467337-18467359 TTAAGAGTTATTTTCCTCTGTGG - Intergenic
1052131131 9:24848240-24848262 TCAAGATTCATTATTTCCTGAGG - Intergenic
1052869234 9:33486971-33486993 TGGATATTTATTTTGTCCTACGG - Intergenic
1053447322 9:38163120-38163142 TGAAGATCTATTGTGTGCTGGGG + Intergenic
1053659522 9:40257962-40257984 TAAAGATTTATTCTGTTTTGTGG + Intronic
1053909895 9:42887320-42887342 TAAAGATTTATTCTGTTTTGTGG + Intergenic
1054121617 9:61213955-61213977 TAAAAATTAATTTTGTCCTTTGG + Intergenic
1054371650 9:64404259-64404281 TAAAGATTTATTCTGTTTTGTGG + Intronic
1054525076 9:66118255-66118277 TAAAGATTTATTCTGTTTTGTGG - Intronic
1054679268 9:67893978-67894000 TAAAGATTTATTCTGTTTTGTGG + Intronic
1055400538 9:75919440-75919462 TTAAGTTTTAATTTTTCTTGAGG + Intronic
1055758587 9:79582044-79582066 TTAACTTTTATCTTTTCCTGTGG + Intronic
1056335503 9:85564416-85564438 TCAAGGTATAATTTGTCCTGAGG - Intronic
1057526076 9:95803095-95803117 TTAGGATTTTTTTTTTCCTCTGG - Intergenic
1059357880 9:113715115-113715137 TTAATTTTCATTTTGTCATGAGG - Intergenic
1061128948 9:128696380-128696402 TAAAGATTTTTTTTGGACTGGGG + Exonic
1062305378 9:135903553-135903575 TTGAGATTTTTGGTGTCCTGGGG - Intronic
1203694045 Un_GL000214v1:78640-78662 TAAAGATTTATTCTGTTTTGTGG - Intergenic
1203450955 Un_GL000219v1:115759-115781 TGAATATTTATTTTTACCTGTGG + Intergenic
1203705502 Un_KI270742v1:38785-38807 TAAAGATTTATTCTGTTTTGTGG + Intergenic
1203558497 Un_KI270744v1:27020-27042 TAAAGATTTATTCTGTTTTGTGG - Intergenic
1203642228 Un_KI270751v1:25423-25445 TAAAGATTTATTCTGTTTTGTGG + Intergenic
1185804071 X:3040733-3040755 TTAAAATTAATTTTGTTGTGTGG - Intergenic
1187153247 X:16700900-16700922 ATGTGATTTATTTTGTCCTATGG - Intronic
1187656093 X:21475676-21475698 TAAATCTTTATTTTGTCCAGAGG + Intronic
1187834465 X:23417287-23417309 TTAAAACTTATTTTGTTTTGAGG + Intergenic
1188576877 X:31662261-31662283 TTAATATTTATTTAATCCTTCGG - Intronic
1188618362 X:32188268-32188290 TTATGATTTATTTTGCTCTATGG + Intronic
1188780606 X:34279422-34279444 TTGAGTTTTATTTTGTCTTGAGG + Intergenic
1189082264 X:37987232-37987254 TTGAGAATAATTTTGTCCTCTGG + Intronic
1189439564 X:41022728-41022750 TTAAAATCTATTTTGTACTTTGG + Intergenic
1191932693 X:66391739-66391761 TTTAGTTGTATTTTTTCCTGTGG + Intergenic
1192276256 X:69634312-69634334 TTTATTTTTATTTTATCCTGAGG + Intronic
1193019151 X:76770812-76770834 TTAACACTTGTTTTGTCCTTGGG - Intergenic
1193513855 X:82438860-82438882 TTAAGATTTATTTGGCTCTTTGG - Intergenic
1193987093 X:88256636-88256658 TTAAGATTTGTTCTGACCTGAGG + Intergenic
1194214832 X:91117339-91117361 TTAATTTTTATTTTATCCTCTGG - Intergenic
1194529404 X:95026281-95026303 TTAACCTTTCTTTTGTCTTGGGG - Intergenic
1195657981 X:107351117-107351139 ATAATATATAATTTGTCCTGTGG - Intergenic
1196426336 X:115573614-115573636 TTAAGTTTTATTTTGACTCGTGG + Intronic
1196583281 X:117400068-117400090 TTGAGAATTATTTTGTCTTGTGG - Intergenic
1197513691 X:127399571-127399593 TAAAGACAAATTTTGTCCTGTGG - Intergenic
1197872261 X:131071421-131071443 GTAAGATTTATTTAATTCTGGGG + Intronic
1197952191 X:131909535-131909557 TTAATATGTATTATGTGCTGAGG + Intergenic
1198706639 X:139456109-139456131 TAAATATTTATTTTATCCTATGG + Intergenic
1198824747 X:140687757-140687779 TAAATATTTTTTTTGTCCTATGG + Intergenic
1199022254 X:142895238-142895260 TCAAGATTTATTTATTCCTTCGG - Intergenic
1200735117 Y:6785657-6785679 TTCAGAGTTGTTTTGGCCTGCGG - Intergenic
1201334080 Y:12860831-12860853 TTAAGAAGACTTTTGTCCTGTGG + Exonic
1201441373 Y:14012440-14012462 GAAAGATTTATTTTGTCTTTAGG + Intergenic
1201443198 Y:14030268-14030290 GAAAGATTTATTTTGTCTTTAGG - Intergenic
1201639986 Y:16168316-16168338 TAAAGATAAATTTTGTCCTGGGG + Intergenic
1201662827 Y:16417009-16417031 TAAAGATAAATTTTGTCCTGGGG - Intergenic