ID: 1048825048

View in Genome Browser
Species Human (GRCh38)
Location 8:138416150-138416172
Sequence ATTAAGATTTATTTTGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 464}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048825048_1048825050 -8 Left 1048825048 8:138416150-138416172 CCCAGGACAAAATAAATCTTAAT 0: 1
1: 1
2: 1
3: 36
4: 464
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data
1048825048_1048825051 6 Left 1048825048 8:138416150-138416172 CCCAGGACAAAATAAATCTTAAT 0: 1
1: 1
2: 1
3: 36
4: 464
Right 1048825051 8:138416179-138416201 TACTTTTGGAGTACAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048825048 Original CRISPR ATTAAGATTTATTTTGTCCT GGG (reversed) Intronic
900233184 1:1572858-1572880 ATTAACAATAATTTTGTCTTGGG + Intronic
900259893 1:1721260-1721282 ATTAAGGTTTACTCTTTCCTAGG - Intronic
901099834 1:6711446-6711468 ACTAAGACTGATTCTGTCCTAGG + Intergenic
902076012 1:13786535-13786557 ATTAAGGTTTGTTTTGTTTTGGG - Intronic
903152172 1:21417839-21417861 TTTAAGATATATTTGGTCCAAGG + Intergenic
903199261 1:21720285-21720307 ATTAATATTAATTCTGTTCTAGG - Intronic
904954185 1:34269150-34269172 ATATATATATATTTTGTCCTTGG + Intergenic
905266183 1:36755775-36755797 AATTAGATTTATTTTATCTTGGG - Intergenic
907715169 1:56920006-56920028 ATTAAGATTTAATTTGTTTCGGG - Intergenic
908818713 1:68059917-68059939 ATTTTCTTTTATTTTGTCCTTGG - Intergenic
908921231 1:69195447-69195469 ATCATGATTTATCTTGTCTTTGG + Intergenic
909031573 1:70547535-70547557 ATTAAGATTTTTGATATCCTAGG + Intergenic
909312941 1:74176416-74176438 ATTAAGATATTTTTTGGCATTGG + Intronic
909379435 1:74981411-74981433 ATTAATATTTAATCTGTCTTTGG - Intergenic
909388775 1:75092820-75092842 ATTGATACTTATTTTGTTCTTGG - Intergenic
909648607 1:77947024-77947046 ATAAATATATATTTTGTCATTGG - Intronic
909861465 1:80610983-80611005 ATTAAGTTTTATTTTTTCAGAGG + Intergenic
910514426 1:88043494-88043516 ATTTACATTTATTTTGTTCCAGG - Intergenic
911763367 1:101642510-101642532 ACCAAGATTTAATTTGTTCTGGG + Intergenic
912017744 1:105062310-105062332 ATAAAGCATCATTTTGTCCTTGG - Intergenic
912188077 1:107304652-107304674 ATGACGAATTGTTTTGTCCTAGG + Intronic
913444453 1:118935144-118935166 ATTAAATTTTATTTTTACCTAGG - Intronic
914372563 1:147041867-147041889 GTTTATATTTAGTTTGTCCTGGG - Intergenic
914576940 1:148980904-148980926 GTTTATATTTAGTTTGTCCTGGG + Intronic
915764658 1:158350643-158350665 ATTAATATATATTTTTTCTTTGG + Intergenic
915874349 1:159596492-159596514 ATTAACAGTTATATTGTGCTGGG - Intergenic
915998294 1:160587936-160587958 ATTATGATTTATTGAGTACTAGG + Intergenic
916289463 1:163148424-163148446 ATTAACATTTATTGAGTGCTCGG + Intronic
916335240 1:163663706-163663728 ATAAAACATTATTTTGTCCTAGG - Intergenic
916457405 1:164985132-164985154 TTTAAGTTTTATTTTGGGCTTGG + Intergenic
916525451 1:165605015-165605037 ATGGATATTTATTATGTCCTAGG + Intergenic
916618129 1:166466272-166466294 ATTAAGTTTTATTATGTTATTGG - Intergenic
916923838 1:169497064-169497086 TTAAAGATTAATTTTGTGCTAGG - Intergenic
917765336 1:178210390-178210412 CTTATGATTTCTTTTGTCCTTGG + Intronic
918135495 1:181670355-181670377 ATTAAAAGTTATTTTCCCCTTGG + Intronic
918557141 1:185816517-185816539 TTTAAAATTTATTCTGTCATGGG - Intronic
919340753 1:196303340-196303362 ATTAAGTTTTATTTTTCCTTTGG + Intronic
919797508 1:201330202-201330224 TTTTAGATTTTTTTTTTCCTTGG + Exonic
921233811 1:213102575-213102597 ATTACAATTTTTTTTTTCCTGGG + Intronic
923094691 1:230765700-230765722 ATTGATATTTATTTTCTACTTGG - Intronic
923785451 1:237063765-237063787 CTTAAGATTTATTTTATGATGGG + Intronic
923831427 1:237562078-237562100 ATTATAATTTATTTTCTCTTAGG + Intronic
923922648 1:238585830-238585852 AGTTAGCTTTATTTTGACCTGGG - Intergenic
1063431782 10:5997034-5997056 ATTTACATTTATTTAATCCTGGG - Intergenic
1064024002 10:11832433-11832455 TTTAAGATTAATTTTGTTCATGG + Intronic
1064254026 10:13729001-13729023 AATATGATTCCTTTTGTCCTTGG + Intronic
1065270419 10:24026793-24026815 TTTTAGATTTATTTTTTCCAAGG + Intronic
1066499874 10:35982430-35982452 ATTTATATTTTTGTTGTCCTTGG + Intergenic
1066627712 10:37426325-37426347 ATTTATATTTTTGTTGTCCTTGG + Intergenic
1067072784 10:43147920-43147942 GTTAATATTTGTTTTGTCTTTGG + Intronic
1067740561 10:48892620-48892642 ATTAAGTCTTATTTTGACCATGG + Intronic
1067785193 10:49240759-49240781 ATTAAGCTTTATTTTATTCCAGG + Intergenic
1067974045 10:51004071-51004093 ATTAATAGTTTTTTTGACCTAGG - Intronic
1069363152 10:67667550-67667572 ATTAACATTTATTTTCTCTTTGG - Intronic
1070844257 10:79508908-79508930 ATAAAGAATAATTTTGTCCATGG + Intergenic
1070929540 10:80251404-80251426 ATAAAGAATAATTTTGTCCATGG - Intergenic
1071815189 10:89225165-89225187 ATTAAAATGTTTTTTGCCCTGGG - Exonic
1074012973 10:109503235-109503257 ATTATGATTCATATTGTACTTGG - Intergenic
1074207065 10:111291991-111292013 TTTAAGATTTTCTTGGTCCTTGG + Intergenic
1074531726 10:114302951-114302973 ATTCAAATTTATTTTGTTCATGG + Intronic
1074954331 10:118373058-118373080 ATTAAAATTAATTTTGTTTTAGG + Intergenic
1075801108 10:125153827-125153849 ATAAAGTTTTTGTTTGTCCTGGG + Intronic
1076755410 10:132568428-132568450 ATTAAGAATTTTTGTGGCCTGGG + Intronic
1078378109 11:10813685-10813707 ATTCAGATTTATCTGGTCTTAGG - Intronic
1078630867 11:13002798-13002820 TTTAGGATCTATTTTCTCCTGGG + Intergenic
1078808777 11:14736615-14736637 ATACAGATGAATTTTGTCCTAGG + Intronic
1079671880 11:23180996-23181018 TTTAACATTTATTTTGTTCAGGG - Intergenic
1080185472 11:29479175-29479197 ATTAAGATTTTTTGTGGCTTTGG + Intergenic
1080310449 11:30884556-30884578 TTTAACATTTATTTTGTATTTGG - Intronic
1080596118 11:33775233-33775255 TTTAAAATTTATTTTGGCCAGGG + Intergenic
1080664994 11:34328068-34328090 ATAAAGATTTGGTTTGTGCTTGG + Intronic
1081273084 11:41111375-41111397 AATAAGATTGATTCTGTCCCTGG - Intronic
1081836828 11:46162586-46162608 ATGTAAATTTATTTTCTCCTAGG + Intergenic
1081959340 11:47122873-47122895 AATAAGATTTATTTTTTGGTTGG - Intronic
1082198605 11:49334237-49334259 ATTAAGAATTTTTTTCTCCCTGG + Intergenic
1083345405 11:61986660-61986682 CTTAACCTTTATTTTGACCTTGG - Intergenic
1084981994 11:72834378-72834400 ATAAAGGTTTGTTTTGTCCCAGG + Intronic
1085280506 11:75327017-75327039 TTTAAGAATAATTTTGTGCTGGG + Intronic
1085555167 11:77412737-77412759 ATTAAGAACTATTATGTACTAGG + Intronic
1086576463 11:88343797-88343819 TTGAACATTTATTTTGTGCTAGG - Intergenic
1086657207 11:89373901-89373923 ATTAAGAATTTTTTTCTCCCTGG - Intronic
1087077534 11:94139488-94139510 ATAAATATTTATTTGGTCTTTGG + Intronic
1087266261 11:96064802-96064824 TTGAAGATTTATTTTGTGCTAGG - Intronic
1087422215 11:97943896-97943918 ATGAAGAAGTATTTTGACCTAGG + Intergenic
1087461139 11:98449528-98449550 AATAGGATTCATTTTATCCTTGG - Intergenic
1087624076 11:100576041-100576063 ATAGATATTTATTTTGTACTCGG - Intergenic
1087963248 11:104378156-104378178 ATTAAGGTCTGTTTTTTCCTAGG + Intergenic
1088726653 11:112644340-112644362 ATTTAGATTTAATTTGTTATAGG - Intergenic
1089266168 11:117263567-117263589 ATTAAAATTTTTTTTCTGCTGGG - Intronic
1089279740 11:117365473-117365495 ATCATGATTTACTTTGACCTTGG + Intronic
1089424272 11:118358546-118358568 ATTTAGATTTATGTTGTATTAGG + Intergenic
1093141504 12:15515458-15515480 AATAAGATTTATTTAGAGCTGGG - Intronic
1093906114 12:24693495-24693517 AGTAATATTTATTTTTTTCTGGG + Intergenic
1094054089 12:26250917-26250939 ATTCTGACTTATTTTGTCTTGGG + Intronic
1094585039 12:31769825-31769847 ATTAAGAATTATTTTTGGCTGGG - Intergenic
1095526548 12:43132832-43132854 TTTCTGGTTTATTTTGTCCTGGG + Intergenic
1096910205 12:54975894-54975916 ATTATGTATTATTTTTTCCTAGG - Intronic
1098350739 12:69556647-69556669 ATTAATGTTTATTTAGTTCTAGG + Intronic
1098493472 12:71109129-71109151 ATAGAGATTTCTTTTATCCTTGG + Intronic
1098808103 12:75047457-75047479 ATCAAGATTTATTATCTTCTAGG + Intronic
1098926250 12:76352279-76352301 ATTCACATTCATTTTGTCATGGG + Exonic
1099031577 12:77531737-77531759 ATTAAGAATAATTTTAGCCTGGG + Intergenic
1099256462 12:80320149-80320171 TTAATAATTTATTTTGTCCTTGG - Intronic
1099463535 12:82954012-82954034 ATTATTATTTTTTTTGTCCAGGG + Intronic
1099641490 12:85292052-85292074 ATTAAGTTCTGTTTTGTACTAGG - Intronic
1099678433 12:85791897-85791919 ATTAATATTTACTTTTCCCTGGG + Intergenic
1100472602 12:94906832-94906854 AACATGATTTATTTTCTCCTTGG + Intronic
1100687378 12:97001945-97001967 ATTAGGATCTATTATGTGCTAGG + Intergenic
1100938296 12:99694956-99694978 ATTAATCTTAGTTTTGTCCTTGG + Intronic
1101197586 12:102401135-102401157 ATTCAGATTTTTTTTACCCTGGG - Intronic
1101230996 12:102740933-102740955 GTGAACATTTATTTTGTCCTGGG + Intergenic
1102326567 12:111990292-111990314 AATAATATTTACTTTGTGCTTGG - Intronic
1102603697 12:114052753-114052775 CTTAAGAGTTATTTAGTCCCAGG + Intergenic
1102730886 12:115108349-115108371 ATTAAACTTTTTGTTGTCCTTGG + Intergenic
1103114311 12:118312475-118312497 ATTAAGATTTTTCTTGGTCTGGG + Intronic
1104770318 12:131357637-131357659 ATTAAGGGTAATTTGGTCCTGGG - Intergenic
1106000974 13:25722949-25722971 ATTATGAGTTATTTTGTTCAAGG + Intronic
1106218488 13:27724241-27724263 ATTAAAAAATATTGTGTCCTGGG + Intergenic
1106288286 13:28337161-28337183 TTTAAGATTCTTTTTGTTCTTGG + Intronic
1107186047 13:37522249-37522271 ATTAAGAGTCATTTTGCTCTTGG + Intergenic
1107686142 13:42901097-42901119 ATTAAAATTTATTCTGCCTTAGG - Intronic
1107703000 13:43067513-43067535 ATAAAGATGTATTTTTTCCAGGG + Intronic
1108248974 13:48545902-48545924 ATTAGGATTTAGCTTTTCCTTGG + Intergenic
1108392553 13:49960815-49960837 ATTAAGAATTATTGTGTCAGCGG - Intergenic
1108452544 13:50581768-50581790 ATTCTGGTTTAATTTGTCCTGGG + Intronic
1108877475 13:55064014-55064036 ATTAAGAATAATTCTGACCTGGG - Intergenic
1109461159 13:62660032-62660054 CTTAAGATTTATTTTCTTCATGG + Intergenic
1109997235 13:70144850-70144872 ATTTAGATTTATTTTTTCAAGGG + Intergenic
1110609379 13:77471918-77471940 ATTAAGTTGTATTTTTTTCTGGG + Intergenic
1111232819 13:85365339-85365361 ATTATGACTTATTTTCTTCTGGG + Intergenic
1111620863 13:90723779-90723801 AATAAAATTTTGTTTGTCCTTGG - Intergenic
1111671500 13:91336131-91336153 ATTATGTTTTTTTGTGTCCTTGG + Intergenic
1112215221 13:97423509-97423531 AGTAAGATTTGTTTCCTCCTAGG - Intergenic
1114177043 14:20331458-20331480 ATTTATATTTATTTTGTACACGG - Intronic
1114749850 14:25190922-25190944 GTTGAAATTTAATTTGTCCTTGG + Intergenic
1114885268 14:26842107-26842129 ACAAATATTTATTTTCTCCTTGG - Intergenic
1115010939 14:28543887-28543909 TTTTACATTTATTTTGTGCTGGG + Intergenic
1115238493 14:31231829-31231851 ATTAAAATGTTTTTTTTCCTAGG - Intergenic
1115472883 14:33786448-33786470 ACTCAGATTTATTTTGTCTCTGG - Intronic
1116008044 14:39317602-39317624 ATTAAAATCTCTTGTGTCCTAGG + Intronic
1116617124 14:47154187-47154209 CTTATGTTTTATTTTATCCTAGG - Intronic
1116754482 14:48928991-48929013 AAAAAGATTAATTTTATCCTAGG - Intergenic
1116758539 14:48980421-48980443 ATTAGGATAAATGTTGTCCTTGG - Intergenic
1117086143 14:52203348-52203370 ATTCAAATTTATTTGGCCCTAGG - Intergenic
1117620365 14:57579857-57579879 ATTAATATTCATTTTGCACTGGG + Intronic
1118307559 14:64667917-64667939 ATTTTGATTTATTTTATCATAGG + Intergenic
1118313928 14:64713588-64713610 TTTAAGATATTTTTTGTCTTTGG + Intronic
1118500721 14:66360006-66360028 ATTAACATTTATTTTGTCCCTGG - Intergenic
1120281603 14:82445697-82445719 ATTTAATTTTATTTTGTCTTTGG + Intergenic
1120391899 14:83919562-83919584 ATAAAGATTTTTTGTTTCCTTGG - Intergenic
1120401162 14:84033758-84033780 ATTAAATTTTATTTTTTCCTTGG + Intergenic
1120993725 14:90398960-90398982 ATTAGGACTTATTTTGTAATTGG + Intronic
1121471707 14:94160445-94160467 ATTAAGATTTAATTTATTCATGG + Intronic
1124153447 15:27203526-27203548 AGAATGATTTATTTTGTCTTTGG + Intronic
1124201178 15:27679707-27679729 ATTTAGATTATGTTTGTCCTGGG + Intergenic
1125558946 15:40611444-40611466 ATTAAAATTAAATTTGTCCAAGG - Intronic
1125960793 15:43827848-43827870 ATTTGGATTTATATTGTCTTTGG + Intronic
1126223797 15:46245820-46245842 ATAATGATTTATATTTTCCTGGG + Intergenic
1126260850 15:46689116-46689138 AGTAAAATTTATTTTTTCTTTGG - Intergenic
1126401418 15:48274985-48275007 ATGAAGATTAATTCTTTCCTTGG + Intronic
1126671258 15:51117306-51117328 GTTAAAATTTATTTTATCTTAGG - Intergenic
1127030938 15:54862205-54862227 TTTTGGATTTAGTTTGTCCTTGG - Intergenic
1127847472 15:62883846-62883868 ATTCAGATTTAGTTGGTCTTGGG - Intergenic
1129065891 15:72903495-72903517 ATTAAGACTTATTATGTGCCAGG + Intergenic
1129131218 15:73498388-73498410 TTTATGTTTTATTTTGTCTTTGG + Intronic
1129555017 15:76498694-76498716 ACTAACATTTATTGTGTGCTTGG - Intronic
1130964697 15:88688370-88688392 ATTAAGTTTTTTTTTGGCTTTGG + Intergenic
1131000720 15:88937756-88937778 TCTAAGATTTATTTTGGGCTGGG + Intergenic
1133064627 16:3197312-3197334 ATTAAGATTAGTTTTGGGCTGGG - Intergenic
1135821502 16:25690743-25690765 ATTAACATTTTTTTTCTCTTTGG + Intergenic
1135841010 16:25876233-25876255 ATTAAGAATCATTTTGTGGTAGG + Intronic
1136386468 16:29929496-29929518 TCAAATATTTATTTTGTCCTTGG + Intergenic
1137414773 16:48265311-48265333 TTTAAAATATATTTTGTTCTAGG + Intronic
1138990856 16:62389101-62389123 ATAATGATTTATTTTCCCCTGGG - Intergenic
1139160537 16:64502183-64502205 AACATGATTTATTTTTTCCTTGG + Intergenic
1141113010 16:81285749-81285771 CTTCAAATTTATTTTATCCTAGG - Intronic
1141361834 16:83402498-83402520 ATTAACATATATTTTGTCTATGG + Intronic
1141949568 16:87331904-87331926 ATTAAGATTTTTTTTCACATTGG - Intronic
1146485023 17:33235731-33235753 ATTAAGATGAATTTTGCCCCAGG + Intronic
1147990937 17:44332937-44332959 ATTGAGATTTATATTGTGCCAGG - Intergenic
1150362691 17:64550787-64550809 ATTTAGATTCAATTTATCCTAGG + Intronic
1150515964 17:65809478-65809500 ATTTAGATTTATTTTAGACTTGG + Intronic
1150604785 17:66681529-66681551 TATAAGACTTACTTTGTCCTGGG + Intronic
1153648037 18:7212596-7212618 ATTTGGATTCAATTTGTCCTGGG - Intergenic
1155697833 18:28704379-28704401 ATAATGATTTATTTTTTGCTTGG + Intergenic
1155787483 18:29918363-29918385 ATTAATATTTATTTTTCTCTAGG + Intergenic
1155845391 18:30699118-30699140 ATAAATATTTTATTTGTCCTTGG - Intergenic
1155870191 18:31017366-31017388 ATTAATTTTTGTTTTGTTCTGGG + Intronic
1156256141 18:35398347-35398369 ATGAAGATTTTCTTGGTCCTGGG - Intergenic
1156661677 18:39353194-39353216 ATTAAGCCTTATTTTGTGCTAGG - Intergenic
1157025962 18:43843893-43843915 ATTCTGATTTATTTTATCATAGG - Intergenic
1157305653 18:46515441-46515463 ATAAAGATTTATTTTGTGAGGGG - Intronic
1159380297 18:67647943-67647965 ACTAAGATTAATTTTATGCTTGG - Intergenic
1160062311 18:75543680-75543702 ATTAAGATTAATTTTGTATGTGG - Intergenic
1161758752 19:6154805-6154827 ATTAAAATTTATTCTGGGCTGGG - Intronic
1162250786 19:9441796-9441818 AGTAAGATTAAATTAGTCCTAGG - Intergenic
1164208446 19:23076697-23076719 ATTAAGATTTTTTTGGTCAAAGG + Intronic
1166472990 19:43096326-43096348 TTTGAGATTTATTTTGTGCATGG + Intronic
1166940807 19:46364080-46364102 ATTAAGTTTTACATTATCCTTGG + Intronic
1167811387 19:51834582-51834604 ATTAAGATTTATTTGGCCCATGG - Intergenic
1168193004 19:54753794-54753816 AGTTAGATTTATTTTTTACTAGG + Intronic
1168195092 19:54768621-54768643 AGTTAGATTTATTTTTTCCTAGG + Intronic
1168197340 19:54785066-54785088 AGTTAGATTTATTTTTTCCTAGG + Intronic
1168638942 19:58017941-58017963 ATTAAGAATTTTTTTTTCCACGG + Intergenic
925543245 2:4989398-4989420 AATGAGATTTTTTTTTTCCTTGG - Intergenic
925546285 2:5020421-5020443 ATTAGGATTTAATTTGTCTGGGG + Intergenic
925552087 2:5087352-5087374 CTTAAGATGTATTGTGTCCAAGG + Intergenic
925565878 2:5253535-5253557 ATTTAGTTTGATTTTCTCCTTGG - Intergenic
925568520 2:5283667-5283689 CTTAAAATTTACTTTCTCCTTGG + Intergenic
926449228 2:12982078-12982100 ATTCAGAAATATTTTGTCATTGG - Intergenic
926665239 2:15514784-15514806 ATCCAGATTTTTTATGTCCTGGG + Intronic
927635432 2:24812339-24812361 CTTAAGATTTTCTTTGTCTTTGG + Intronic
927748802 2:25647365-25647387 ATTAAAATCTTTTTTGTCCTTGG - Intronic
927761209 2:25756412-25756434 ATTCAGCTTTATTTTCTACTGGG - Intronic
929939327 2:46320334-46320356 AGTAAGACTTAATTGGTCCTGGG + Intronic
930054494 2:47241428-47241450 ATTAAGATTGATTTGGGACTGGG - Intergenic
931056115 2:58473411-58473433 AAGAATATTTATTTTGGCCTTGG + Intergenic
931156855 2:59643422-59643444 ATTCAGATTTTCTTTGTCCTGGG + Intergenic
931325618 2:61219112-61219134 ATGAATATTTATTTTATCCTTGG + Intronic
931683284 2:64770273-64770295 ATTGAAATTTATTTTATGCTAGG + Intergenic
933193164 2:79359708-79359730 TTTAACATTTATTTGGTCTTTGG - Intronic
933689541 2:85168974-85168996 TCTCAGATTTATTCTGTCCTGGG - Intronic
935075133 2:99734736-99734758 TTTAAAATATATTTTGTACTTGG + Intronic
935316782 2:101842724-101842746 ATTAAGTTTTATGTTGTGCCAGG + Intronic
935339073 2:102043689-102043711 ACTAAGATTTATTATGTCACTGG + Intergenic
936584665 2:113745263-113745285 ATGAAGAATTTTTTTTTCCTGGG - Intronic
936712433 2:115147001-115147023 ACTAAGATATACTTTGTGCTAGG + Intronic
936811131 2:116403745-116403767 ATTATCATTTATTGTGCCCTTGG - Intergenic
936812517 2:116419033-116419055 ATTAAGATTAATTTTAGGCTGGG + Intergenic
937021742 2:118663563-118663585 ATTAAGAATTATTTTTTCAATGG - Intergenic
937643737 2:124242948-124242970 ATTTAGAATTATTCTGTCATTGG + Intronic
937752329 2:125491229-125491251 ATAATGATTTATTTTCTTCTGGG + Intergenic
938683622 2:133716162-133716184 ATTAAGATGTCTGATGTCCTAGG - Intergenic
940545926 2:155085215-155085237 CTTTAGTTTTATTTGGTCCTTGG + Intergenic
940576595 2:155514145-155514167 ATTTATATTTATTTTCTACTAGG + Intergenic
941012472 2:160316745-160316767 ATTAAGATTTCTTTTGGGGTGGG + Intronic
941020335 2:160401583-160401605 ATAAACATTTTTTTTGTCCTTGG - Intronic
941456930 2:165720323-165720345 ATTCATATTTATTTTGTGATGGG - Intergenic
941826685 2:169906493-169906515 ATTTATACTTGTTTTGTCCTTGG - Intronic
943029995 2:182674518-182674540 ATATAATTTTATTTTGTCCTAGG - Intergenic
944276409 2:197843502-197843524 ATTAAGAATTATTTCTACCTTGG - Intronic
944756225 2:202764571-202764593 ATTTAGATTTTTATTGTCATTGG + Intronic
945556675 2:211285163-211285185 AATAAGATTTTTTCTGTCTTAGG + Intergenic
945651520 2:212566813-212566835 AATAAGATTTATTTAGGCCACGG - Intergenic
946368376 2:219265172-219265194 ATTAAGATTTATCTGGGACTCGG - Intronic
946927270 2:224638195-224638217 TGTAACATTTATATTGTCCTGGG - Intergenic
947191834 2:227514527-227514549 ATTAATATATGTTTTGTACTGGG - Intronic
1170204977 20:13788516-13788538 ATTAAGAATTATTTTTTCTTAGG - Intronic
1170273195 20:14551186-14551208 ATTAAGATTTAATTTGTCCTAGG + Intronic
1173110764 20:40186971-40186993 ATTAAGACTTGTTTTGGCATAGG + Intergenic
1173588655 20:44206270-44206292 ATGTTGATTTATTTTGGCCTGGG + Intronic
1177052337 21:16252189-16252211 ATTTTCATTTATTTTTTCCTGGG + Intergenic
1177638563 21:23816945-23816967 ATTAATATTTAGTATGTCCCAGG - Intergenic
1178021311 21:28411689-28411711 GTTAAGAATTATTTAGTTCTAGG - Intergenic
1178036830 21:28593746-28593768 ATGAATATTTATTTTATACTTGG - Intergenic
1178042897 21:28660597-28660619 ATTAAGTTTTTTTATGTTCTAGG - Intergenic
1178153256 21:29820739-29820761 ATTAAAATTTATTATGCACTAGG + Intronic
1180124734 21:45782771-45782793 TTTAAGATTTTTTTTGTCTTTGG - Intronic
1181872625 22:25912113-25912135 ATAAGCATTTATTTTGTCCAAGG - Intronic
1184368795 22:44069473-44069495 ATTAAGATTTTCTTTTTCATAGG + Intronic
1184869144 22:47222634-47222656 TTTATGATTTATATTTTCCTAGG + Intergenic
949837518 3:8285435-8285457 GTTCAAATTTATTTTGTCCGAGG - Intergenic
951317323 3:21203561-21203583 CTGAAGATCTATTTTGCCCTGGG - Intergenic
951607486 3:24452205-24452227 ATTAATATTTATTTTACCATGGG + Intronic
951865734 3:27305235-27305257 ATAAAGATTTATTTTAACATAGG - Intronic
952109625 3:30107842-30107864 AATAAGATCTATTTTTTCCTAGG + Intergenic
952275856 3:31875951-31875973 AGTATGATTTATTCTCTCCTGGG - Intronic
952674809 3:36015208-36015230 ATTTAGATTCAGTTTGTGCTAGG + Intergenic
953185789 3:40637252-40637274 ATAATGATTTCTTTTCTCCTGGG - Intergenic
954552654 3:51494981-51495003 ACTAAGGTTTATATTTTCCTTGG - Intronic
955444460 3:58994612-58994634 ATTTAGATATATATTGTACTTGG - Intronic
956148558 3:66217300-66217322 AATAAGATTTATTTTCACTTAGG + Intronic
957385302 3:79488854-79488876 ATTAAGTTTTAATTTGTTGTGGG + Intronic
957468649 3:80628848-80628870 ATTAATATTTATTTTGCCATAGG + Intergenic
957854927 3:85862547-85862569 ATTAATGTTTATTTTATCCAGGG + Intronic
957859968 3:85933837-85933859 AGGAAGATTTATTTTCTACTTGG + Intronic
957988423 3:87599829-87599851 ATTATAATTTATTTTCTACTTGG - Intergenic
958648702 3:96907272-96907294 ATTAATATTTATTGTGTTCAAGG + Intronic
958736325 3:98013644-98013666 ATTATGAGCTAGTTTGTCCTAGG + Intronic
959102743 3:102031732-102031754 ATTAAGATCTATGTTGTGATGGG - Intergenic
959671808 3:108987034-108987056 ATTATGATTTCTTTTCTGCTGGG - Intronic
959752377 3:109853939-109853961 AATAACATTTATTATGTTCTAGG + Intergenic
959964606 3:112339070-112339092 TTTAACATTTATTATGTACTAGG - Intronic
963422668 3:145080508-145080530 ATTCAGATTTATATTGTTCTTGG + Intergenic
963613801 3:147508346-147508368 GTTAATGTTTATTTTGTGCTAGG - Intronic
963613927 3:147510347-147510369 ATTTAGATTTATGTGTTCCTTGG + Intergenic
965032045 3:163383510-163383532 ATTTAAATTTATCTAGTCCTGGG - Intergenic
965161942 3:165144286-165144308 ATTTAGATTTATTATTTCTTGGG - Intergenic
966237586 3:177719488-177719510 AACAAGATTAATTTTTTCCTTGG - Intergenic
966811254 3:183846981-183847003 AGGAGGATTTATTTTGACCTTGG + Intronic
967489742 3:190076608-190076630 ATTCAGCTTTATTTGGTTCTGGG - Intronic
967680162 3:192352673-192352695 ATTAAGAATTACTGTGTTCTAGG + Intronic
967872736 3:194245735-194245757 ATTTACATTTATTTAGTCATTGG - Intergenic
969706620 4:8795777-8795799 ATCATGATGTATTTTCTCCTTGG + Intergenic
969833530 4:9818711-9818733 ATTATTATTTTCTTTGTCCTGGG + Intronic
971109466 4:23567599-23567621 ATTATGTTTTGTTTTGTTCTGGG + Intergenic
971653726 4:29313709-29313731 AGTAGGATTGCTTTTGTCCTAGG + Intergenic
971670037 4:29544612-29544634 GTGAAGATTTATTTTCCCCTTGG - Intergenic
973084857 4:46045432-46045454 ATTAATTTCTATTTTCTCCTTGG - Intronic
973127640 4:46607558-46607580 ATTAAGATTGTTGTGGTCCTTGG + Intergenic
973153022 4:46911588-46911610 ATGAATATTTATTTTCTCCTAGG + Intergenic
974252395 4:59403675-59403697 ATTAAGATTTATTTTGCTAAAGG - Intergenic
974513969 4:62883634-62883656 ATAGAGATTCATATTGTCCTGGG + Intergenic
974529348 4:63087228-63087250 TTTAAGAGTTATTTTGTCAAAGG - Intergenic
974685987 4:65230437-65230459 AGAGAGATTTATTTTGTACTGGG + Intergenic
974693469 4:65332996-65333018 ATTAAGTTTTGTTTTGTATTTGG - Intronic
974901997 4:68011761-68011783 ATTAAGAAATAATTTGACCTAGG - Intergenic
975581024 4:75907111-75907133 AATAAGAATTATTTTGAGCTAGG + Intergenic
975643696 4:76525733-76525755 ATTAAAATATATTCTGTACTTGG - Intronic
976048817 4:80985780-80985802 ATGAAGACATCTTTTGTCCTGGG - Intergenic
976086544 4:81412646-81412668 ATCAAGTTTTATTATGTCTTTGG + Intergenic
976171899 4:82312936-82312958 ATAATGATTTATTTTCTTCTGGG - Intergenic
976518502 4:85999618-85999640 TTTAAGATGTATCTTGGCCTCGG - Intronic
976740787 4:88355292-88355314 ATTAAAATTGCTTTTTTCCTAGG - Intergenic
977276971 4:94989822-94989844 TTTAAGCTTTATTTGGTCATGGG + Intronic
977419864 4:96785909-96785931 ATTTAGACACATTTTGTCCTTGG + Intergenic
977760599 4:100731986-100732008 ATTAAAATCTATTGTTTCCTTGG - Intronic
978042274 4:104082775-104082797 CTTAAAATTTATTTTTTCATAGG + Intergenic
978073367 4:104498127-104498149 ATTAAGATTCCTTTTATCTTGGG + Intergenic
978176814 4:105742036-105742058 ATTAAGATTTTATTGGTACTTGG + Intronic
978629488 4:110727275-110727297 AATAACTTTTATTTAGTCCTGGG - Intergenic
979134937 4:117099080-117099102 ATAAGGATTTCTTTTGTCTTTGG - Intergenic
979475677 4:121154934-121154956 ATTTTGATTTTTTTTTTCCTGGG - Intronic
980040445 4:127933650-127933672 ACTCAGATGTATTTTGTACTTGG + Intronic
980096483 4:128496572-128496594 ATTAATATTTATGCTGACCTTGG + Intergenic
980176997 4:129357983-129358005 ATTTAGGTTTATTTTTTCCCTGG - Intergenic
980225841 4:129984316-129984338 ATGAAGATATATTTTATCATTGG - Intergenic
980375838 4:131947696-131947718 ATTTAGTTTTTTTTTCTCCTTGG + Intergenic
980428934 4:132664945-132664967 ATTAATATTTATCTTTTCTTTGG + Intergenic
981265779 4:142781694-142781716 ATAAAGATTTATTTTCCACTGGG - Intronic
981277003 4:142912266-142912288 ATAAAGATTTATTTGGCCCAAGG - Intergenic
981803461 4:148684887-148684909 ATGAATATTTATTTTGTGCCAGG + Intergenic
982324735 4:154118751-154118773 AATTAGATTTAGTTTTTCCTAGG + Intergenic
982519028 4:156389890-156389912 ATGAAAATTTATTCTTTCCTTGG - Intergenic
983030634 4:162797331-162797353 ATTCAGATTTCTTGTGTCCTAGG - Intergenic
983116162 4:163819007-163819029 ATTAAGATGAATATTGTCATTGG - Intronic
983127623 4:163973660-163973682 ATTAAGATTGACTTTTGCCTTGG - Intronic
984913062 4:184693252-184693274 TTTAAAATTTACTTTGTTCTTGG - Intronic
985237407 4:187891267-187891289 ATTAAGATTAATATTGTTATGGG + Intergenic
985375225 4:189329334-189329356 ATTATGATTTAAGTTGTCCAAGG - Intergenic
986009927 5:3704160-3704182 ATTATTTTTTATTTTGTCATTGG + Intergenic
987056649 5:14199780-14199802 CTTGAGATTTGTCTTGTCCTGGG + Intronic
987154340 5:15073306-15073328 ATTAAGAATAACTTTGTTCTAGG + Intergenic
987944631 5:24588531-24588553 CTTGAGATTTATTTTAGCCTAGG + Intronic
988602339 5:32651435-32651457 ATTAAAAATTATTTTCTGCTAGG + Intergenic
989295591 5:39822309-39822331 AATAAGGTTCATTTTATCCTAGG - Intergenic
990158830 5:52913410-52913432 ATTCAGATTTATTTTTTCTAAGG - Intronic
990199488 5:53355187-53355209 AGAGAGATTTATATTGTCCTAGG - Intergenic
990310388 5:54532139-54532161 ATTTAGATTTATTTTGGCTTGGG + Intronic
990731580 5:58814541-58814563 GACAAGATTTATATTGTCCTGGG - Intronic
991450710 5:66748108-66748130 ATTAAGACTATTTTTATCCTGGG - Intronic
991656078 5:68905008-68905030 ATTACTATTTATTTTGCCTTAGG - Intergenic
991719027 5:69478826-69478848 AATAATATTTATTTTGTGCCAGG + Intergenic
992344472 5:75862744-75862766 ATAAAGATGTCTTTTGTCTTGGG - Intergenic
992490648 5:77240451-77240473 ATTAAAATTTAAATTGCCCTTGG - Intronic
992771902 5:80056198-80056220 ATTCGGATTCAGTTTGTCCTAGG - Intronic
993474511 5:88348047-88348069 TTTAAGTTTTATTTTTTGCTTGG + Intergenic
994902207 5:105788810-105788832 ATTAACATTTTTTCTGTCTTTGG + Intergenic
995202139 5:109437950-109437972 ATGAATATGTATTTTGTCCTAGG - Intergenic
995283789 5:110364159-110364181 ATAGAGAATTATTTTCTCCTTGG + Intronic
995319125 5:110811512-110811534 TTTATGATTTATTTTATTCTTGG + Intergenic
995634772 5:114174770-114174792 ATTAAAATATATTCTATCCTTGG + Intergenic
995698651 5:114908042-114908064 ATTAAGATTTACGTCTTCCTAGG + Intergenic
996309962 5:122093374-122093396 AGTAAGAATTTTTTTCTCCTTGG - Intergenic
996644435 5:125796939-125796961 ATTTCCATTTATTTTCTCCTAGG + Intergenic
997019209 5:129977248-129977270 CTTTGGATTCATTTTGTCCTTGG - Intronic
997384808 5:133464310-133464332 ATGAAGAGTGATTTTGTTCTTGG - Intronic
998125847 5:139620863-139620885 ATTTAAATTTATTTTGTCAGAGG + Intronic
998223587 5:140307997-140308019 TTTAAGATTCACTTTGTCTTTGG + Intergenic
998484826 5:142492720-142492742 CTTAAGTTTTACTTTTTCCTGGG + Intergenic
999072687 5:148763643-148763665 CTTAAGATTTATTTTTTCTCAGG - Intergenic
999550460 5:152680826-152680848 TTTAAGATTTTTTCTGTCTTAGG - Intergenic
1001969023 5:175938853-175938875 ATTAAGTTTTCTTTTCTCTTGGG + Intronic
1002248420 5:177904892-177904914 ATTAAGTTTTCTTTTCTCTTGGG - Intergenic
1005137665 6:22589380-22589402 TTTAAGTTTAATTTTGTCCCAGG - Intergenic
1005981204 6:30838372-30838394 GTTAAAAATTATTTTGTCCTGGG + Intergenic
1007981050 6:46158372-46158394 ATTCAGGACTATTTTGTCCTGGG + Intergenic
1008063027 6:47018614-47018636 ATTAAGATTTATTTTAATCTGGG + Intronic
1008265245 6:49417174-49417196 ATAAAAATTTAATATGTCCTAGG - Intergenic
1008415161 6:51231177-51231199 TTTAATATTTAATTTTTCCTTGG + Intergenic
1009597741 6:65757362-65757384 ATTATGACTTATTTTCCCCTAGG + Intergenic
1010621875 6:78086213-78086235 ATTCAGGTTTATTTTGTCAGAGG + Intergenic
1011648055 6:89479029-89479051 ATGAATATTTACTTTGTGCTAGG + Intronic
1011902718 6:92320179-92320201 ATTATGATTTTTTTTTTCCAAGG + Intergenic
1012022425 6:93941126-93941148 GTTATGATTTAATTTTTCCTAGG + Intergenic
1012930370 6:105310038-105310060 ATTAAGATTGATTTTTTTATAGG + Intronic
1013357739 6:109361444-109361466 TTTGAGATTTATTTTGCCCTTGG - Intergenic
1014348065 6:120300813-120300835 ATTTCCATTTAGTTTGTCCTGGG + Intergenic
1014410077 6:121104277-121104299 ATTAAGATTAAGTTGATCCTGGG - Intronic
1014441879 6:121483091-121483113 ATAAAGATATATTTTGTTGTGGG - Intergenic
1014762300 6:125370225-125370247 ATTAAAAATTATTTTGCCCCTGG + Intergenic
1015043582 6:128751514-128751536 GTTACAATTCATTTTGTCCTTGG + Intergenic
1015297658 6:131616362-131616384 ATTTATATAGATTTTGTCCTAGG + Intronic
1015808061 6:137132566-137132588 ATTACGATTTTTTTTTTGCTTGG + Intergenic
1016088184 6:139941899-139941921 ATTAAAATTAAATTTGTGCTTGG + Intergenic
1016432574 6:144003206-144003228 ATCAAGATTTATTTTGTATATGG - Intronic
1016921156 6:149295271-149295293 ACTAAGACTTCTTTTGTCATTGG + Intronic
1017655451 6:156623751-156623773 ATTCAAATTTCTTATGTCCTAGG + Intergenic
1018607808 6:165617007-165617029 ATTAAGATGTATTTTCTCAAAGG - Intronic
1020714421 7:11652185-11652207 ATAAAGATTTACTTTGGCCCTGG - Intronic
1020853591 7:13389297-13389319 AATGACATTTTTTTTGTCCTGGG + Intergenic
1021338312 7:19431902-19431924 ATTATTATTTATTTTCTCCTTGG - Intergenic
1021342086 7:19477915-19477937 TTTAAGATTTTTTTTGTTCTTGG + Intergenic
1025159945 7:56648169-56648191 ATAAACATTTATTTAGTCCTTGG - Intergenic
1025755802 7:64339126-64339148 GTAAACATTTATTTAGTCCTTGG + Intronic
1025956042 7:66183852-66183874 ACTAAGATTTACTTTGCCATGGG + Intergenic
1026475896 7:70734974-70734996 ATTTATATTTATCTTGACCTTGG - Intronic
1026990758 7:74584049-74584071 TTAAAGATTTATTTTGCCATGGG + Intronic
1027659550 7:80972525-80972547 ATAAAAGTTTATTTTGTTCTAGG + Intergenic
1027890825 7:83971853-83971875 ATTAAGATGTCTTTGGTGCTGGG + Intronic
1028790334 7:94846709-94846731 ATTAATTTTTATTATGTCTTAGG + Intergenic
1030340142 7:108369002-108369024 AATAAGGTTTATTTTCTTCTTGG - Intronic
1030640422 7:111999294-111999316 ATTAAATTTTATTTTATACTTGG - Intronic
1031244276 7:119288053-119288075 ATTAGGAGGTATTGTGTCCTGGG - Intergenic
1031277948 7:119755242-119755264 AGTAAGAATTATTTTGTCTTGGG + Intergenic
1032297542 7:130654266-130654288 ATTTCTCTTTATTTTGTCCTTGG - Intronic
1032331650 7:130986199-130986221 CTGAAGATTTATTTTGGCCATGG - Intergenic
1033148651 7:138893764-138893786 ATTCTGATTTATTTTATCCCTGG - Intronic
1033250812 7:139757273-139757295 ATTAATTTTTATCTTTTCCTAGG - Intronic
1033535818 7:142311069-142311091 ATTTAGATTTGTTTTAACCTGGG - Intergenic
1033845475 7:145426716-145426738 ATTAAGATTTATTTTAGGCCGGG - Intergenic
1034014124 7:147563738-147563760 ATAGAGTTTTATTTTGTCTTTGG + Intronic
1037708022 8:21332031-21332053 ATTAAGTTTTATTTTCTAATCGG + Intergenic
1037844374 8:22270105-22270127 ATTAAGATATATTTTAGGCTGGG + Intergenic
1038007172 8:23442030-23442052 ATTGGCATTAATTTTGTCCTTGG - Exonic
1038731622 8:30133041-30133063 TTTAAGATTTATTTTGTGTGGGG - Intronic
1038962000 8:32530743-32530765 ATTAATAGGTAGTTTGTCCTTGG - Intronic
1040983169 8:53266482-53266504 ATTAATTTTTACATTGTCCTGGG - Intergenic
1041335061 8:56772853-56772875 ATTAACATTTATTTTTCCATTGG + Intergenic
1041644082 8:60233711-60233733 ATAAAAATTTATTTTAACCTTGG - Intronic
1042081253 8:65054500-65054522 ATTAAAATTTATTCTGTTTTAGG + Intergenic
1042341439 8:67684198-67684220 CTTAAAATTTAATTTTTCCTAGG + Intronic
1043088118 8:75862804-75862826 ATTAAGATTTTTTTAAGCCTTGG - Intergenic
1043277675 8:78420288-78420310 ATTTGTAATTATTTTGTCCTGGG + Intergenic
1043326190 8:79054769-79054791 ATTACGATTAATTATGCCCTTGG - Intergenic
1044062715 8:87659027-87659049 TTTAAAATATATTTTCTCCTTGG + Intergenic
1044343313 8:91072118-91072140 ACTAATATTTATTTTATCGTTGG + Intronic
1045155506 8:99465054-99465076 ATTAAGATTTTTATTTTACTTGG - Intronic
1045267510 8:100632398-100632420 ATTAAATTTTTTTTTGTCATGGG - Intronic
1045444202 8:102243129-102243151 TTTAAGATTTATTTGGGGCTGGG + Intergenic
1045539833 8:103073384-103073406 ATAAAGATGTCTTTTGCCCTTGG + Intergenic
1045875002 8:106970268-106970290 ATTAACATTTATGTTGTTCATGG - Intergenic
1046172686 8:110531240-110531262 TTTAATATTTATTATGTTCTTGG - Intergenic
1046200406 8:110920331-110920353 ATTAAGATTTATTATTTCTGAGG + Intergenic
1046256815 8:111710169-111710191 ATTTAGGTTTATATTGTCATAGG + Intergenic
1047012228 8:120684949-120684971 ATTAAGATTCAATTTTTGCTGGG - Intronic
1047955991 8:129976065-129976087 ATTAACATTTATTGTCTTCTGGG - Intronic
1048825048 8:138416150-138416172 ATTAAGATTTATTTTGTCCTGGG - Intronic
1049500106 8:142958143-142958165 ATTGAGATTTTTTTTCTCTTGGG - Intergenic
1050883513 9:10735436-10735458 TTTAATATTCATTTTTTCCTTGG + Intergenic
1051016446 9:12481338-12481360 GTTGTGATTTATTTTATCCTTGG - Intergenic
1051154524 9:14125997-14126019 TTTAAGATTTATTTAGTAATGGG - Intronic
1051489943 9:17651116-17651138 ATTAAAATTCATTATGTCTTAGG - Intronic
1051931748 9:22394582-22394604 ATAATGGTTTATTTTGTCCCGGG + Intergenic
1053079663 9:35164310-35164332 AGAAAGATGTATTTTGTGCTGGG - Intronic
1053268086 9:36730532-36730554 AGGAAGGTTTATTTAGTCCTTGG + Intergenic
1053640884 9:40078364-40078386 ATTTAGTTTTTTTTTTTCCTTGG + Intergenic
1053765251 9:41387108-41387130 ATTTAGTTTTTTTTTTTCCTTGG - Intergenic
1055011880 9:71575941-71575963 ATTTGGATTTATTTGGACCTTGG - Intergenic
1055298386 9:74857471-74857493 ATTAAGATTGACATTGCCCTTGG - Intronic
1055431007 9:76243749-76243771 ATTCATATTTATTATGTCCTGGG - Intronic
1055919259 9:81441064-81441086 ACTAAGCTTTATTTTGTAATAGG - Intergenic
1055996770 9:82168541-82168563 ACTAATAGTTCTTTTGTCCTAGG + Intergenic
1058556342 9:106172622-106172644 ATGAAGATTTACTGTGTGCTAGG - Intergenic
1059028304 9:110661211-110661233 ACTAACATTTATTTTCTCCATGG + Intergenic
1059726710 9:117015371-117015393 AGTAACCTTTATTTTGTGCTTGG + Intronic
1059823330 9:117998224-117998246 ATTAAAAATCATTATGTCCTAGG + Intergenic
1059978634 9:119744816-119744838 TTGAACAATTATTTTGTCCTGGG - Intergenic
1061128947 9:128696379-128696401 ATAAAGATTTTTTTTGGACTGGG + Exonic
1186604298 X:11073698-11073720 ATGGATATTTATTTTGTACTTGG - Intergenic
1186764086 X:12753216-12753238 ATTAAAATATATTTTTTCCAGGG - Intergenic
1187589889 X:20705915-20705937 ATCAAGAATTATTTTTTTCTTGG - Intergenic
1187610023 X:20932712-20932734 ATTATTATTGATTTTCTCCTTGG + Intergenic
1187651292 X:21410931-21410953 AATAAGATTTGTTTTGTATTAGG + Intronic
1187680792 X:21765899-21765921 AATAAAATTTATTTTTTCTTGGG + Intergenic
1188074884 X:25763127-25763149 ATTCAGTTTTATTTTGTCTTGGG - Intergenic
1188603019 X:31992785-31992807 AATAAGATTTATTTTTACCTTGG - Intronic
1189508254 X:41634893-41634915 ATTAATAATTATTTTGGCCAAGG + Intronic
1189575567 X:42349501-42349523 ATTTTGATTTATTTTGTCTAAGG - Intergenic
1190623053 X:52307832-52307854 ATTCATATTTATTTTCTACTTGG - Intergenic
1191661028 X:63650561-63650583 AATAAGATTTAGTTTGTGATAGG + Intronic
1192743596 X:73916816-73916838 ATTACCATTCATTTTGCCCTTGG - Intergenic
1193019152 X:76770813-76770835 ATTAACACTTGTTTTGTCCTTGG - Intergenic
1193679396 X:84500190-84500212 ATTCAGGTTTATTTAGTCATTGG + Intronic
1193859062 X:86641187-86641209 ATTGTGATTCATATTGTCCTGGG - Intronic
1194095599 X:89635228-89635250 ATTTACATTTGTTTTGACCTAGG - Intergenic
1194209149 X:91048583-91048605 AATAAGATTTATTTTGTATGAGG - Intergenic
1194460624 X:94162936-94162958 ATTTAGATTTGTTTTGTGTTTGG + Intergenic
1194642963 X:96425533-96425555 CTTAAAATTTATTTTGTCCCTGG - Intergenic
1195683643 X:107566692-107566714 ATTATGATTTCTTTGGTCATGGG + Intronic
1196140075 X:112251791-112251813 ATTAAAAGCTATTTTATCCTGGG - Intergenic
1196310420 X:114157848-114157870 ATTAAGATTCAATTACTCCTTGG + Intergenic
1196377555 X:115050764-115050786 ATTAATATTTATTTTTGGCTGGG - Intergenic
1197048758 X:122032517-122032539 ATAAAGATTTATTTTCCTCTGGG + Intergenic
1197462544 X:126760577-126760599 ATTTATATTTATTTTGCCATAGG - Intergenic
1198147807 X:133875371-133875393 ATTCATATTTATTTAGTTCTAGG + Intronic
1198229336 X:134674499-134674521 AACCAGGTTTATTTTGTCCTGGG - Intronic
1199026463 X:142944415-142944437 ATAATGATTTATTTTACCCTTGG - Intergenic
1199547826 X:149025946-149025968 ATTGGCATTTTTTTTGTCCTAGG - Intergenic
1199760693 X:150902027-150902049 AATAATATTTTTTTTCTCCTGGG - Intergenic
1201639985 Y:16168315-16168337 ATAAAGATAAATTTTGTCCTGGG + Intergenic
1201662828 Y:16417010-16417032 ATAAAGATAAATTTTGTCCTGGG - Intergenic
1201672045 Y:16533919-16533941 ATAATGATTTATTTTCTTCTGGG + Intergenic