ID: 1048825049

View in Genome Browser
Species Human (GRCh38)
Location 8:138416151-138416173
Sequence AATTAAGATTTATTTTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 548}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048825049_1048825050 -9 Left 1048825049 8:138416151-138416173 CCAGGACAAAATAAATCTTAATT 0: 1
1: 0
2: 1
3: 44
4: 548
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data
1048825049_1048825051 5 Left 1048825049 8:138416151-138416173 CCAGGACAAAATAAATCTTAATT 0: 1
1: 0
2: 1
3: 44
4: 548
Right 1048825051 8:138416179-138416201 TACTTTTGGAGTACAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048825049 Original CRISPR AATTAAGATTTATTTTGTCC TGG (reversed) Intronic
900233183 1:1572857-1572879 AATTAACAATAATTTTGTCTTGG + Intronic
901851894 1:12021097-12021119 AATTAAATTTTTTTTTGGCCAGG + Intronic
902076013 1:13786536-13786558 AATTAAGGTTTGTTTTGTTTTGG - Intronic
903335748 1:22623346-22623368 AAATAAGAATTAGCTTGTCCAGG - Intergenic
905153247 1:35949925-35949947 ATTAAAGATTTATATTGGCCAGG + Intronic
907715170 1:56920007-56920029 GATTAAGATTTAATTTGTTTCGG - Intergenic
908352218 1:63297676-63297698 AATTAAGAATTTCTCTGTCCGGG + Intergenic
908539986 1:65113186-65113208 AAATAATATTTATAGTGTCCAGG - Intergenic
908543885 1:65146751-65146773 AATCAATATTTATTATTTCCCGG - Intergenic
908635496 1:66159534-66159556 AAAAAAGTTTTATTTTGGCCAGG - Intronic
908697527 1:66860678-66860700 AATTGAGATTTATTTTTTGTGGG + Intronic
908720014 1:67115464-67115486 AATTAATTTTTATTTCTTCCAGG - Exonic
909093744 1:71260460-71260482 AATGAAGATTTATAATCTCCAGG - Intergenic
909969520 1:81963724-81963746 ACTAAAAATTTAATTTGTCCAGG + Intronic
910093805 1:83496681-83496703 ATTTAAGATTTATTTGGTAGAGG + Intergenic
910899612 1:92105546-92105568 ATTTAAGATATATTTTGGCTGGG - Intronic
911002186 1:93178404-93178426 GATTAAATTTTATTTTCTCCAGG + Intronic
911372153 1:97006555-97006577 AAATATGATTTGTTTTCTCCAGG + Intergenic
911763366 1:101642509-101642531 AACCAAGATTTAATTTGTTCTGG + Intergenic
912378224 1:109230169-109230191 AATGTAGATTTTTTTTTTCCAGG - Intronic
912451730 1:109771630-109771652 AATTACCATTTATTTTGTGTGGG - Intronic
912730554 1:112098988-112099010 AATTAAGATTCATTTCATGCTGG + Intergenic
913384857 1:118248324-118248346 AATTCACATTTATTTTGGCCGGG - Intergenic
914372564 1:147041868-147041890 AGTTTATATTTAGTTTGTCCTGG - Intergenic
914388446 1:147195426-147195448 GATTAAGATTTATTTTGGCTGGG - Intronic
914576939 1:148980903-148980925 AGTTTATATTTAGTTTGTCCTGG + Intronic
914738404 1:150440760-150440782 GTTTAAGATTTCTTTAGTCCTGG + Intronic
914989105 1:152482910-152482932 AATTAATATTTTTTTTTACCAGG + Intergenic
915454701 1:156032295-156032317 AATAAAGACTCATTTTGGCCGGG - Intergenic
915627781 1:157126319-157126341 ACTTAATATTTATTGTGTACAGG - Intronic
915874350 1:159596493-159596515 AATTAACAGTTATATTGTGCTGG - Intergenic
916276369 1:162998465-162998487 AATTCAGATTTTATTTGTCTAGG - Intergenic
917150485 1:171938494-171938516 AATTAAAATATATTTTGTGGAGG + Intronic
917577308 1:176337303-176337325 AAGTAAGATTTTTTTTTTCTAGG - Intergenic
917851355 1:179067307-179067329 AATAATAATTTATTTTGGCCAGG + Intronic
918116151 1:181499711-181499733 AATTTGGATTTAATTTGTCTTGG - Intronic
918183631 1:182108298-182108320 AATTAGAATTTATATTGTCTAGG + Intergenic
918514375 1:185346201-185346223 AATTCAGATTTCTTTTCTTCAGG + Intergenic
918557142 1:185816518-185816540 ATTTAAAATTTATTCTGTCATGG - Intronic
918572008 1:186007106-186007128 AATAAAGTTTTATTTTTTCTAGG + Exonic
918697768 1:187564765-187564787 TATCAAGTTTTATTTTCTCCCGG - Intergenic
918853026 1:189717260-189717282 CATAAAGATTTATTTAGTTCTGG + Intergenic
918916770 1:190650749-190650771 AATTAAGATTTAGTTTGCGGTGG - Intergenic
918917183 1:190658220-190658242 AGGTTATATTTATTTTGTCCTGG + Intergenic
919596019 1:199563268-199563290 ATTTAAGAATTATTTTGGGCCGG + Intergenic
920586338 1:207166039-207166061 AATTAAGATTTTATTTTTCAAGG + Intergenic
920670096 1:207997494-207997516 AATTAAGAATTATATTATCGAGG + Intergenic
920753925 1:208709289-208709311 AAATATCATTTATTTTGTGCAGG + Intergenic
920807987 1:209252988-209253010 AATTTAGATTTTTTTTCCCCTGG - Intergenic
921208407 1:212869884-212869906 CATTTAGATTTATTTTGCCATGG + Intronic
921225082 1:213010836-213010858 CATTAAGATTTTTATTGTCCTGG + Intronic
921233810 1:213102574-213102596 AATTACAATTTTTTTTTTCCTGG + Intronic
922635771 1:227169337-227169359 ATTTAACATTTATTATGTTCAGG - Intronic
922918753 1:229282393-229282415 AATTATGATGTATCTTGTCATGG + Intronic
923755830 1:236790488-236790510 AATTAAGAATGCTTCTGTCCAGG + Intergenic
923975829 1:239261381-239261403 AATTATTATTTATTTTTTCAAGG - Intergenic
923991512 1:239442400-239442422 AACTAACATGTATTTTGGCCGGG - Intronic
924159367 1:241215066-241215088 AATCAAAAGTTATTTTGACCAGG - Intronic
924818219 1:247461728-247461750 AATTATGATTTCTATTGTACTGG - Intergenic
1063431783 10:5997035-5997057 AATTTACATTTATTTAATCCTGG - Intergenic
1063571821 10:7222393-7222415 AACAAAAATTTATTTTGTCATGG + Intronic
1063577545 10:7275267-7275289 AAATAAAATTTATTTTTTCAAGG + Intronic
1064302705 10:14136854-14136876 CATTTAGGTTTATTTTGTCAAGG - Intronic
1064521308 10:16205281-16205303 TTTTAAGATTTATTTTGGCCAGG + Intergenic
1064906689 10:20354698-20354720 AATTAAAATTAATTTTGTAGAGG - Intergenic
1065073233 10:22049416-22049438 AATTAATATTTAGTTTGTTCAGG - Intergenic
1065579674 10:27157787-27157809 ACTTAAGATTTTTTTTTTCTAGG + Intronic
1065999319 10:31089698-31089720 AATAATGATGTATCTTGTCCCGG + Intergenic
1066238263 10:33507900-33507922 AATTAAGATTTCCCTAGTCCAGG - Intergenic
1066278705 10:33893323-33893345 AATTAACATGTATATTTTCCAGG + Intergenic
1066500997 10:35994618-35994640 AATTAAGATTTTTTTTTTTTTGG + Intergenic
1067324719 10:45256587-45256609 AAATAATATTTATTTTGCCTAGG + Intergenic
1067397320 10:45934019-45934041 AAGTAAAATTTTTTTTGGCCGGG - Intergenic
1067423127 10:46175930-46175952 AATTCACATTTAATTTGTACTGG + Intergenic
1067865645 10:49903120-49903142 AAGTAAAATTTTTTTTGGCCGGG - Intronic
1068066412 10:52138021-52138043 AATTAAGATTTAAATTATCAGGG + Intronic
1068153933 10:53170895-53170917 AATAAAATATTATTTTGTCCAGG + Intergenic
1068275855 10:54795325-54795347 AATGGACATTTATTTTGTCCTGG - Intronic
1068403406 10:56559429-56559451 AATAAAGAGTGATTTTGTCCTGG + Intergenic
1068593332 10:58873573-58873595 AAATTAGATTTATTTTTTCTTGG - Intergenic
1068733154 10:60382439-60382461 AATTTAGATTTAATTGGTTCTGG - Intronic
1069031341 10:63598934-63598956 AATTAAAAATTATTTGGTCATGG + Intronic
1069149234 10:64934787-64934809 TATTATGATTCATTTTATCCTGG + Intergenic
1069289965 10:66766433-66766455 AATTCAGGTTTTTTTTTTCCAGG + Intronic
1069345178 10:67460819-67460841 AATGAAAATATATTGTGTCCAGG + Intronic
1071056281 10:81512329-81512351 AATTAAAATATATTTTGTATTGG + Intergenic
1071175999 10:82927325-82927347 AAATAAAAATTATTTTGTCAGGG - Intronic
1071671719 10:87615263-87615285 AATCAACATTTAGTTTGTCGAGG + Intergenic
1071755213 10:88529831-88529853 ACTTCAGATCTATTTTGTGCTGG - Intronic
1072666749 10:97398976-97398998 TATTAAGATTAATTTGGGCCGGG + Intronic
1073371819 10:102996407-102996429 AATTAAGACTTCTTTGGGCCAGG + Intronic
1073501099 10:103937841-103937863 AATTTGGATTCATTTTCTCCTGG + Intergenic
1073785494 10:106884725-106884747 AATTATGATTTTTTTTGGGCAGG - Intronic
1075042691 10:119121108-119121130 AATCTACATTTATTTTGGCCGGG - Intronic
1075801107 10:125153826-125153848 AATAAAGTTTTTGTTTGTCCTGG + Intronic
1076755409 10:132568427-132568449 AATTAAGAATTTTTGTGGCCTGG + Intronic
1077070571 11:669245-669267 GATTACGATTTATTTCGGCCAGG - Intronic
1079477526 11:20846968-20846990 AATTAAGTTTTTTCTTTTCCAGG - Intronic
1079671881 11:23180997-23181019 TTTTAACATTTATTTTGTTCAGG - Intergenic
1079804995 11:24919881-24919903 ATTTAAGAATTATTTTATACTGG + Intronic
1080229995 11:30010137-30010159 AATTAAAATTTATTTTTAACTGG - Exonic
1080358415 11:31481351-31481373 AATTAAGTATTATTTTATCCTGG - Intronic
1080596117 11:33775232-33775254 CTTTAAAATTTATTTTGGCCAGG + Intergenic
1080997620 11:37623158-37623180 AATTATGATTTATTTAGGCAAGG - Intergenic
1081036432 11:38152247-38152269 AATTGATATTCATTTTTTCCAGG - Intergenic
1082650715 11:55788436-55788458 AACTAAAATTTATTTTCTCATGG - Intergenic
1083144049 11:60744996-60745018 AAGTAAGTTTTATTTTCTCTAGG - Intergenic
1083353649 11:62048940-62048962 TATTAAGAATTACTTTGGCCTGG - Intergenic
1084193706 11:67511248-67511270 AACTAAAATTTATTTTCTCATGG + Intergenic
1085142615 11:74161380-74161402 AATTAAAATATATTTTTACCTGG + Exonic
1085796821 11:79549203-79549225 ACTTAAGATGTATTTTTTTCTGG + Intergenic
1086512295 11:87572149-87572171 AATTAAGCTTTCTTTACTCCAGG + Intergenic
1086748387 11:90458779-90458801 AAGTCAGATTTTTTTTTTCCTGG + Intergenic
1086955296 11:92929378-92929400 ATTTAACAAATATTTTGTCCAGG + Intergenic
1086978451 11:93165149-93165171 ATTTTAGATCTATTTTGTCTGGG + Intronic
1088809982 11:113385703-113385725 AATTCAGAGGTATTTTGTTCGGG + Intergenic
1089266169 11:117263568-117263590 AATTAAAATTTTTTTTCTGCTGG - Intronic
1089511484 11:119000502-119000524 AAAAAAAATTTTTTTTGTCCAGG + Intronic
1089804541 11:121071805-121071827 AATGAAGGCTTATTTTGTCTTGG + Intronic
1089923984 11:122238139-122238161 AATTAAGAGTCATTTTGGCTAGG + Intergenic
1090164262 11:124531026-124531048 ATTAAAGATGTATTTTATCCTGG - Intergenic
1090709055 11:129369683-129369705 AATGCAGTTTTATTTTGTCATGG + Intergenic
1093045568 12:14440184-14440206 AATTGAGATTTATTTTTTCTAGG - Intronic
1093732769 12:22584966-22584988 AATTATGCTATATTTTGTCATGG + Intergenic
1093906113 12:24693494-24693516 AAGTAATATTTATTTTTTTCTGG + Intergenic
1094054088 12:26250916-26250938 AATTCTGACTTATTTTGTCTTGG + Intronic
1094178469 12:27565943-27565965 AATTATAAGTTATTTTTTCCTGG + Intronic
1094278321 12:28705490-28705512 AAGCAAGTATTATTTTGTCCAGG - Intergenic
1095042826 12:37462637-37462659 AATTATGATGGATTTTTTCCTGG - Intergenic
1095384600 12:41635984-41636006 AATTATGAAGTATTTTGTGCAGG + Intergenic
1095594554 12:43944495-43944517 CATTAACATTTTTTTTTTCCAGG + Intronic
1096061020 12:48700496-48700518 AATACAGATTTTTTTTTTCCTGG - Intronic
1096062319 12:48712088-48712110 AATTAAGATTTTTGTGGGCCAGG - Intronic
1096089329 12:48888297-48888319 AAGTAACCTTTATTTTGGCCAGG - Intergenic
1096151115 12:49313426-49313448 AATTAAGAAGTATTTTGTGGGGG - Intergenic
1096293694 12:50364740-50364762 AAATAAAATTTTTTTTGGCCAGG + Intronic
1096929186 12:55185770-55185792 AATTATGAGTTATTTTATGCGGG - Intergenic
1097025358 12:56051393-56051415 ACTTAAAATTTTTTTTGGCCGGG + Intergenic
1097134358 12:56839168-56839190 AATTAATATTTACTTTCTCAAGG - Intergenic
1097290726 12:57912419-57912441 TATTAAAATTAATTTTGGCCAGG - Intergenic
1097393595 12:59045759-59045781 AATTAATATTTTGTTTGTTCCGG + Intergenic
1098421911 12:70306593-70306615 AATTGAGATTTTTTTTTACCAGG - Intronic
1098807627 12:75039674-75039696 AATTTATATTTATGTTTTCCAGG - Intergenic
1099463534 12:82954011-82954033 GATTATTATTTTTTTTGTCCAGG + Intronic
1099533722 12:83819976-83819998 AACTAGGATTTGTTTTGTCAGGG - Intergenic
1099545580 12:83976060-83976082 GCTTATGATTTATTGTGTCCTGG + Intergenic
1099674397 12:85739618-85739640 AAGTATCATTTATTTTTTCCAGG - Intergenic
1100487682 12:95046133-95046155 ATTTAAGATTTTTATTGGCCGGG - Intronic
1101230995 12:102740932-102740954 AGTGAACATTTATTTTGTCCTGG + Intergenic
1101508678 12:105373097-105373119 AATTAAAATTTTTTTTGTAGAGG + Intronic
1101869753 12:108555818-108555840 ATTTTAGAATTATTTTGTCAAGG - Intronic
1102340521 12:112117842-112117864 TATTAATATTTATTTAGCCCTGG - Intergenic
1102424585 12:112832544-112832566 AATTAAGATATATATTAGCCAGG + Intronic
1103014508 12:117483327-117483349 AAACAAGATTCACTTTGTCCGGG + Intronic
1103114310 12:118312474-118312496 AATTAAGATTTTTCTTGGTCTGG + Intronic
1106515707 13:30451483-30451505 AAATAATATTGATTTTGGCCAGG - Intergenic
1106671202 13:31907297-31907319 AATCAACTTTTATTTTGGCCAGG - Intergenic
1107249881 13:38347174-38347196 CATTAAGATTTATTTTTGGCTGG - Intergenic
1107702999 13:43067512-43067534 GATAAAGATGTATTTTTTCCAGG + Intronic
1107704481 13:43086823-43086845 AATTACGATTTATTTTGAGATGG + Intronic
1108127920 13:47265171-47265193 AATTGATAATTACTTTGTCCAGG + Intergenic
1109309027 13:60671219-60671241 AAAAAAGATTTATTTTTTGCAGG + Intergenic
1109381776 13:61570828-61570850 AATTAAGATGCATTTTTACCAGG - Intergenic
1109488774 13:63066020-63066042 AATTAAGAATTTTTTTTTCTTGG - Intergenic
1109729879 13:66398849-66398871 AATTACAAATTATTTTGTCTGGG - Intronic
1109997234 13:70144849-70144871 CATTTAGATTTATTTTTTCAAGG + Intergenic
1110274390 13:73627507-73627529 AATAAGGATTTTTTTTTTCCTGG - Intergenic
1110778246 13:79434289-79434311 AATTATGATTTTTTTCTTCCAGG - Intergenic
1111060124 13:83006759-83006781 AATTTAAAATTATTTTTTCCTGG - Intergenic
1111265439 13:85806209-85806231 AATTTGGATTTATATTGCCCAGG - Intergenic
1111372892 13:87339961-87339983 ACTTTAGAAATATTTTGTCCGGG + Intergenic
1111458314 13:88512151-88512173 AATAGAGATTAATTTTGTTCAGG + Intergenic
1111555146 13:89871217-89871239 AATTAATATTTTTCATGTCCTGG - Intergenic
1111943862 13:94643090-94643112 ACTTAACATTTATTTTATCATGG - Intergenic
1112659696 13:101493524-101493546 CATCAAGATTTTCTTTGTCCGGG + Intronic
1114753861 14:25236303-25236325 AAACAAGATTAATTTTTTCCTGG - Intergenic
1114954470 14:27800252-27800274 AAGGAAGATTCATGTTGTCCAGG + Intergenic
1115074680 14:29373425-29373447 TTTTAAGATTTATTTTTGCCTGG - Intergenic
1115223566 14:31081099-31081121 TCTTAAGATTTTTTTTTTCCAGG + Intronic
1115269929 14:31540138-31540160 AAATAATATTGATTTTGGCCAGG - Intronic
1116215620 14:42013470-42013492 AGTTATGATTTATTTTTTTCTGG - Intergenic
1116277752 14:42858503-42858525 AAATAAAATTTATGTTTTCCAGG - Intergenic
1116713580 14:48399480-48399502 ACATAAGATTTATTATATCCAGG + Intergenic
1116982414 14:51185558-51185580 AATTAGTATTTAATTTGTGCTGG + Intergenic
1117779712 14:59220013-59220035 AATACAGATTTTTTTTTTCCAGG + Intronic
1117889470 14:60403035-60403057 GATTAAGATTTACTTTGATCTGG + Intronic
1118701861 14:68441245-68441267 GATTAAGATTAATTTAGGCCAGG + Intronic
1120174624 14:81279889-81279911 AATTTAGATTTATTTTCTTAGGG - Intronic
1120453167 14:84697201-84697223 TATTAAGGCTTATTTTGTGCTGG + Intergenic
1123785537 15:23667837-23667859 TATTATGATTTATTCTGTCTGGG - Intergenic
1125063450 15:35452968-35452990 AACTAAGATTTATTTTTTTATGG - Intronic
1125095549 15:35846623-35846645 AATTAAAATTTATTTAGTCATGG + Intergenic
1125193102 15:37016054-37016076 AATCAAAATTTGTTTTTTCCTGG - Intronic
1127947068 15:63765999-63766021 AATTTAGGTTTATTTTGTCAAGG - Intronic
1128165371 15:65459657-65459679 AATTAATTTTTGTTTTGGCCAGG + Intronic
1128509090 15:68302611-68302633 AATTCAGATCTGTTTTGTCTTGG + Exonic
1128963486 15:72033144-72033166 AATTATGATTTATTTTGGCTGGG - Intronic
1130246537 15:82255352-82255374 AATACAGATTTATTTTGTTTTGG + Intronic
1130454112 15:84087784-84087806 AATAAAGATTTATTTTGTTTTGG - Intergenic
1131000719 15:88937755-88937777 ATCTAAGATTTATTTTGGGCTGG + Intergenic
1131326162 15:91448211-91448233 AATGAAGGTTTATTTTGGCAAGG - Intergenic
1131708700 15:95027746-95027768 AATTAGGATCTATTTTGACCAGG + Intergenic
1131931264 15:97444821-97444843 AATTCTGATTTATCTAGTCCTGG - Intergenic
1132308869 15:100841411-100841433 AGTTAATTTTTTTTTTGTCCTGG - Intergenic
1132762131 16:1514071-1514093 AATCAAGATTTTTGTTGGCCAGG + Intronic
1133087536 16:3376458-3376480 AACTGATATTTATTTTGCCCAGG - Intronic
1135223077 16:20630380-20630402 ACTTAAACTTTATTTTGACCGGG - Intronic
1137227525 16:46528992-46529014 AATTAAGTTTTAGTATCTCCGGG - Intergenic
1137924412 16:52526442-52526464 GATTAACACTTATTTTGTTCAGG - Intronic
1138149796 16:54645990-54646012 AATTAAGAATTGTATTTTCCAGG - Intergenic
1138801941 16:60043473-60043495 AACCAAGATTTGTGTTGTCCAGG + Intergenic
1139229302 16:65267499-65267521 AGTTAAGATTCATCTTGTTCTGG + Intergenic
1139729672 16:68932384-68932406 AATTAAATTTTATTTTGGCCAGG - Intronic
1140380462 16:74482285-74482307 GATTAATATATATTTTGGCCAGG - Intronic
1141174437 16:81709833-81709855 AGTCAAGAGTTATTTTGTCGCGG - Exonic
1143430035 17:6874879-6874901 AATTAATATTAAACTTGTCCAGG - Intergenic
1144502483 17:15800895-15800917 AATTAAGGTTTATTTTTTGCAGG + Intergenic
1144857824 17:18279853-18279875 ATTTAAAATTTTTTTTGGCCAGG + Intronic
1145164660 17:20603549-20603571 AATTAAGGTTTATTTTTTGCAGG + Intergenic
1146255612 17:31390383-31390405 AATTAAGACATATCTTGCCCTGG + Intergenic
1146485861 17:33242021-33242043 AAATAGGATTTATTCTGGCCAGG + Intronic
1147111141 17:38262637-38262659 AATTGAGATGTACTTTGTGCAGG - Intergenic
1147180442 17:38681515-38681537 AATTAAGATGTATTATAGCCGGG + Intergenic
1148418372 17:47525807-47525829 AATTGAGATGTACTTTGTGCAGG + Intronic
1148507454 17:48139172-48139194 AAAAAAAATTTATTTTGGCCAGG - Intronic
1149951755 17:60995760-60995782 AATTAGTGTTTATTGTGTCCAGG + Intronic
1150344699 17:64395316-64395338 AATAAAGCTTTATTTTATCATGG - Intronic
1150604784 17:66681528-66681550 ATATAAGACTTACTTTGTCCTGG + Intronic
1150951168 17:69803190-69803212 AAATGAGATATATTTTGTCTAGG + Intergenic
1153345307 18:4019261-4019283 AATTAGAATCTATTTTATCCAGG + Intronic
1153659300 18:7312502-7312524 AATCCAGATTCCTTTTGTCCAGG + Intergenic
1155141993 18:23052095-23052117 AATTGAGGTTTCTTTTCTCCAGG - Intergenic
1155201941 18:23525239-23525261 AAATAAGATTTCTTTAGGCCGGG - Intronic
1155783012 18:29862720-29862742 TTTTAGCATTTATTTTGTCCAGG + Intergenic
1155813407 18:30269889-30269911 TATTAAAGTTCATTTTGTCCTGG - Intergenic
1157305654 18:46515442-46515464 AATAAAGATTTATTTTGTGAGGG - Intronic
1157382237 18:47229322-47229344 ATTTAAAATTAATTTTTTCCAGG - Intronic
1157892094 18:51427543-51427565 AATTTAGATTTTTTTTGCCAGGG - Intergenic
1158521469 18:58174776-58174798 AATTAACATTTTTTTTCCCCAGG + Intronic
1159089961 18:63837036-63837058 AAAAAAGATATATTTTGGCCAGG + Intergenic
1162638451 19:11988293-11988315 AAAGAAGTTTTATTTTGACCTGG + Intergenic
1162882884 19:13673315-13673337 GATTTTGATTTATTTTGTCTGGG - Intergenic
1163076499 19:14897015-14897037 AAATAACATTTATTTTATTCAGG + Intergenic
1163735451 19:18977535-18977557 TTTTAAGATTTATTTTGTCTGGG - Intergenic
1164025278 19:21345975-21345997 AATTAATATTTATTTTGCCTGGG + Intergenic
1165021614 19:32929041-32929063 AATAAATAATTATTTTGTCTAGG - Intronic
1166605473 19:44139139-44139161 AATTTAAAATTATTTTTTCCAGG - Intergenic
1167904259 19:52645509-52645531 AACTAAGATTTATCTTGGCCAGG + Intronic
925546284 2:5020420-5020442 GATTAGGATTTAATTTGTCTGGG + Intergenic
926248587 2:11139784-11139806 ACTTAAAAATTATTTTGTTCTGG + Intronic
926665238 2:15514783-15514805 AATCCAGATTTTTTATGTCCTGG + Intronic
926844926 2:17125853-17125875 AATTTAGGTTTCTTTTGTCAAGG - Intergenic
927352369 2:22131926-22131948 CATAAAAATTTATTTTGACCAGG - Intergenic
927631554 2:24778607-24778629 AATAAAGATTTATTGAGTGCAGG - Intergenic
928822924 2:35384512-35384534 AATTATTTTTTATATTGTCCTGG - Intergenic
928986537 2:37187801-37187823 AATTAATATGTATTTTCTACAGG + Intronic
929202194 2:39247410-39247432 AAATTAGATTTTTTTTCTCCAGG - Intergenic
930102452 2:47613868-47613890 CAGAAAGTTTTATTTTGTCCAGG - Intergenic
930423062 2:51177632-51177654 AATTCAGAGATATTTTCTCCTGG - Intergenic
930471270 2:51817593-51817615 AATTGAGATTTATTTTTTGATGG - Intergenic
930498775 2:52184007-52184029 AATTAAGAATTTTTTTGGCTGGG + Intergenic
930671574 2:54157048-54157070 AAATCACATTTATTTTGTACTGG - Intronic
930921802 2:56764483-56764505 AATAAAGAGCTTTTTTGTCCTGG + Intergenic
931156854 2:59643421-59643443 CATTCAGATTTTCTTTGTCCTGG + Intergenic
931172771 2:59822231-59822253 AATTTAAATTAATTTTGTTCTGG + Intergenic
931330643 2:61278349-61278371 AATTGACATTTATATTGTCGAGG - Intronic
931351413 2:61492212-61492234 AATATTCATTTATTTTGTCCTGG + Intronic
931405575 2:61974376-61974398 TATTAATATTTTTTTTGGCCGGG + Intronic
931504403 2:62908623-62908645 AATTAGGAAGTATTTTGACCTGG - Intronic
931971887 2:67596758-67596780 AATAAACATTTATTTTGTGAAGG - Intergenic
933100154 2:78245543-78245565 AATGAAAATTTATTTTCTCGTGG + Intergenic
933481426 2:82861990-82862012 AAGAAAGACTTATTATGTCCTGG - Intergenic
933609101 2:84415675-84415697 TATTAACATTTTTTTTTTCCTGG + Intergenic
933873400 2:86593158-86593180 AATTTAGATCTTTTATGTCCCGG - Intronic
934482842 2:94669038-94669060 AAGGAAGATTCATGTTGTCCAGG - Intergenic
934782010 2:96976386-96976408 TATTAAGAATTGTTTTGGCCAGG - Intronic
935299162 2:101678723-101678745 CATTAAAATCTATTTTGTCATGG - Intergenic
938111684 2:128571829-128571851 AAACAAGATTAATTTTTTCCTGG + Intergenic
938172943 2:129098496-129098518 ATTTGAGATTTATTTGTTCCAGG - Intergenic
938896715 2:135759051-135759073 AATTAAAATTTATTTTGGCTGGG - Intronic
939462084 2:142510233-142510255 AATTAATATTTGTTTGTTCCTGG + Intergenic
939590754 2:144061218-144061240 ACAAAATATTTATTTTGTCCAGG + Intronic
939595967 2:144122802-144122824 AATTCAGATTTATTTTGTCTAGG + Intronic
939863649 2:147448011-147448033 AATTAATGTTTATTTTATACTGG - Intergenic
941014674 2:160341598-160341620 AATTAAGATTTATTTTCTTGTGG - Intronic
941713089 2:168735575-168735597 ACTTAAGAAGTATTTTGGCCAGG + Intronic
942286709 2:174425252-174425274 AATAAGGATTTATTTTTTTCTGG + Intronic
942653008 2:178188398-178188420 GATTAAGTCTTATTTTGGCCGGG - Intergenic
942852214 2:180501460-180501482 TATTTAGATTTATATTGTCTTGG - Intergenic
943159206 2:184225545-184225567 ATTTAAGATTTATTTTGGCTGGG + Intergenic
943595355 2:189848892-189848914 ACTTAAGATTGCTTTTGGCCAGG - Intronic
944767171 2:202876087-202876109 AATAAAGATATATTTGGTTCAGG + Exonic
944961362 2:204877727-204877749 AATTAAGATTTATTTAGTGATGG + Intronic
944984743 2:205162794-205162816 ATTTGCGTTTTATTTTGTCCAGG + Intronic
945068275 2:205965666-205965688 ATTTCAGATTTATTTTGGTCAGG - Intergenic
945086736 2:206139480-206139502 AATTAAAATTTTTTTAGGCCGGG - Intronic
945176054 2:207044685-207044707 AATGAAGATTTAGTTTGTATCGG - Intergenic
946011166 2:216564606-216564628 AATTTAGATTTATTAGGTTCGGG + Intronic
947191835 2:227514528-227514550 AATTAATATATGTTTTGTACTGG - Intronic
947917843 2:233846073-233846095 TATTCAGATTTTTTTTTTCCTGG - Intronic
948074625 2:235156276-235156298 AATTCAGATGTACTTTGACCTGG - Intergenic
1169681827 20:8223821-8223843 AGTTAAGATATATTTTATTCTGG - Intronic
1170041795 20:12046592-12046614 AATTGAGACCTATTTTCTCCTGG - Intergenic
1170667140 20:18395937-18395959 AATTAACATTTATTAGGCCCTGG - Intronic
1171222707 20:23414570-23414592 AATTAAGGTATATTTTTTCATGG - Intronic
1172818939 20:37714730-37714752 AATTAGGTTTTATTTTGTGTTGG + Intronic
1173013509 20:39204114-39204136 GATTAAGATTTATTTTTACTTGG + Intergenic
1173588654 20:44206269-44206291 AATGTTGATTTATTTTGGCCTGG + Intronic
1173699873 20:45060031-45060053 TATTAAGAATTATTTTTTGCTGG + Intronic
1173882080 20:46423038-46423060 ATTTTGGATTTATTTTTTCCTGG + Intronic
1174235339 20:49085858-49085880 AATTAAGATTACTGTTGGCCAGG - Intronic
1176514167 21:7771023-7771045 AACTAAGAGTGATTTTTTCCAGG + Intronic
1177349398 21:19915713-19915735 GATTGAGATATATTTTGTCTGGG - Intergenic
1177401635 21:20613115-20613137 AAATAAGATTTAGTTTTTTCAGG + Intergenic
1178076276 21:29015852-29015874 AATTAGGATTGCTTTTGTCTAGG - Intronic
1178112610 21:29383897-29383919 AATTTAGGTTTATTTTTTTCAGG + Intronic
1178139189 21:29662863-29662885 TATTCTGATTTATTTTGTCTGGG + Intronic
1178239023 21:30877639-30877661 AATTAAAATTTTTTTTATCATGG - Intergenic
1178446666 21:32650043-32650065 AATTAGAATGTATTTTGGCCAGG - Intronic
1178648280 21:34401547-34401569 AACTAAGAGTGATTTTTTCCAGG + Intronic
1181660740 22:24346439-24346461 AATTGAGATTTATTTGAACCAGG + Intronic
1182123998 22:27803411-27803433 AATTAAAATTTTTTTTGGGCGGG - Intergenic
1185145356 22:49131921-49131943 AATTAACATATATTCTGACCTGG - Intergenic
949203130 3:1404906-1404928 AATTCAGATGTATCTTGGCCAGG - Intergenic
949236690 3:1817908-1817930 TATTGAGAATTAATTTGTCCAGG + Intergenic
950374455 3:12559040-12559062 AATTAAAATTTATTTATTGCAGG + Intronic
950637868 3:14328263-14328285 TCTTAAGATATATTTTGGCCAGG - Intergenic
951039547 3:17973884-17973906 ACTTAAGATGTATTTTGTAAGGG - Intronic
951439419 3:22706440-22706462 AACAAAGATTTATTTTTTCTAGG - Intergenic
951975869 3:28507992-28508014 AATAAAGATTTATTTGGCTCAGG + Intronic
952160627 3:30689924-30689946 AAGTAACATTTATTTTATTCTGG - Intronic
952165048 3:30738866-30738888 AATTATGATTCATTTTCTCACGG + Intronic
952224646 3:31362904-31362926 AAACTAGATTTATTTTGTCATGG - Intergenic
952275857 3:31875952-31875974 AAGTATGATTTATTCTCTCCTGG - Intronic
952411111 3:33050931-33050953 CCTTAAAAATTATTTTGTCCAGG + Intronic
954187660 3:48931248-48931270 AACAAAAATTTATTTTGGCCAGG + Intronic
955298456 3:57755752-57755774 AACTAAGATTTTTTTTTTCCGGG + Intronic
955848681 3:63195746-63195768 TGTTTGGATTTATTTTGTCCAGG + Intergenic
956141243 3:66148851-66148873 ACGTAAAGTTTATTTTGTCCAGG - Intronic
956472576 3:69583059-69583081 AGTTAGGGTTTATTTAGTCCTGG - Intergenic
957319867 3:78616411-78616433 AATATATATTTATTTTGGCCAGG - Intronic
957385301 3:79488853-79488875 AATTAAGTTTTAATTTGTTGTGG + Intronic
957700525 3:83705049-83705071 ATTCAAGGTTTATATTGTCCAGG + Intergenic
957854926 3:85862546-85862568 TATTAATGTTTATTTTATCCAGG + Intronic
958142189 3:89575531-89575553 AATTCACATTTATTTTCTACAGG + Intergenic
958696206 3:97530106-97530128 AATAAATATTTGTTTTGTTCTGG + Intronic
958940971 3:100314399-100314421 AATAAAAATTTTTTTTGTGCCGG - Intronic
959035761 3:101361599-101361621 AATTAAGATTTATTTTATATGGG - Intronic
959557864 3:107743282-107743304 TATAAAGATATATTTTGTTCTGG + Intronic
959617096 3:108360727-108360749 ACTTAAGAATTATTTATTCCTGG + Intronic
960544777 3:118901787-118901809 AATTACTGTTTATTTTTTCCTGG - Exonic
961139923 3:124547293-124547315 AAATAAAAATTATTTTGGCCTGG - Intronic
961299537 3:125913841-125913863 AATAAAGATTTCTTCTGGCCGGG + Intergenic
962719937 3:138163858-138163880 AATCATGATTCATATTGTCCAGG - Exonic
963180297 3:142348335-142348357 TATTAATATTTATATTGTCAAGG + Intronic
963370674 3:144395931-144395953 AATTAAATTTTATTTTATTCGGG + Intergenic
963544899 3:146644115-146644137 AATTAAAATATATTTTGGCCAGG - Intergenic
963644616 3:147897591-147897613 GATTAAGAATTATTTTGAACTGG - Intergenic
965015760 3:163154413-163154435 AATTAATATTAATATTTTCCAGG - Intergenic
965427167 3:168541413-168541435 ACTTAAGATTTCTCTTGGCCGGG + Intergenic
965702912 3:171476946-171476968 AAATAAATTTTATTTTGCCCAGG + Intergenic
966248317 3:177833558-177833580 AATTAAGACTTATCTTGGCAGGG + Intergenic
967371341 3:188749978-188750000 AATGAAAATTTATTTTATCACGG + Intronic
967383541 3:188886785-188886807 AAATAAGATTTATTTTCTGAAGG - Exonic
967433783 3:189420719-189420741 AATGAACATTTCTGTTGTCCTGG - Intergenic
970273938 4:14377046-14377068 AATAAACATTTATTTTCTTCAGG + Intergenic
971814781 4:31473533-31473555 AAATAAAATTTATTTTTTCTAGG - Intergenic
973043507 4:45504782-45504804 AATTAAGGTAAATTTTGACCAGG + Intergenic
974128472 4:57724360-57724382 AATTAGCTTTTATTTTGTCAAGG - Intergenic
975246747 4:72129207-72129229 AAATAAGATTTATTATGTGTAGG + Intronic
975437592 4:74371265-74371287 CATTAAAATTAATTTTGTCTTGG - Intronic
975624740 4:76334494-76334516 TATTGAAAGTTATTTTGTCCAGG - Intronic
976048818 4:80985781-80985803 AATGAAGACATCTTTTGTCCTGG - Intergenic
976130917 4:81883050-81883072 AATTTGGATTTTTTTTTTCCTGG - Intronic
976387383 4:84476345-84476367 ACTTTAGAGTTATTTTTTCCTGG - Intergenic
976790020 4:88868012-88868034 AGTTAAGATTGATTTTGCCAAGG + Intronic
977283460 4:95070877-95070899 AATTTACCTTTAGTTTGTCCTGG + Intronic
977442992 4:97093844-97093866 AATTATGATTTATTTTGACTTGG + Intergenic
977453805 4:97232094-97232116 AAACAACATTTATTTTGTTCTGG + Intronic
978543909 4:109850288-109850310 AATTTAGATTCATTTTAGCCTGG - Intronic
978629489 4:110727276-110727298 AAATAACTTTTATTTAGTCCTGG - Intergenic
978712128 4:111796781-111796803 AGTGAAGATTTATTTTCTCAAGG + Intergenic
978742132 4:112148308-112148330 AATAAAGATACATTTTGTTCTGG - Intronic
978757390 4:112317852-112317874 AAGTAACATTTATTTTGTAATGG - Intronic
979212146 4:118117841-118117863 AATCAAGATTTCTTTTCTGCTGG + Intronic
979475678 4:121154935-121154957 AATTTTGATTTTTTTTTTCCTGG - Intronic
979576697 4:122300302-122300324 AATTAACATATATTTGGGCCAGG - Intronic
979747182 4:124231466-124231488 AATCAATATGTATTTTCTCCTGG - Intergenic
979872070 4:125835441-125835463 AATTAAGAATTAATTTGCCTTGG - Intergenic
979988724 4:127348345-127348367 TATTCAGATTTTTTTTTTCCTGG - Intergenic
980182454 4:129417936-129417958 GTTTAAGACTTATTTTGTCTTGG + Intergenic
980194554 4:129571851-129571873 AATTAAAATTTATTTGGACGTGG + Intergenic
980208001 4:129747483-129747505 AATTATGAATTATTTGGCCCAGG + Intergenic
980306481 4:131066911-131066933 AAGTAAGATTTATTCTGTAATGG + Intergenic
980493846 4:133565822-133565844 TATGAAGATTTAATTTGTCTAGG + Intergenic
981498040 4:145415675-145415697 AAATAAGCTTTATTATTTCCTGG - Intergenic
982996855 4:162360046-162360068 AATTATGATGTATTTTGGCATGG + Intergenic
983070622 4:163264034-163264056 AATCAGCATTTATTTTCTCCAGG - Intergenic
983304601 4:165970468-165970490 ACTCAATATTTATTTTCTCCTGG + Intronic
983722285 4:170870511-170870533 AATTAAGATCTATTTTTTTGTGG - Intergenic
983742617 4:171154168-171154190 AATGAAGATTAATTTTGATCAGG - Intergenic
984344380 4:178503809-178503831 AATTGAGATTTACTGTGTGCAGG + Intergenic
984385378 4:179049104-179049126 AACTAAGATTTATGATGCCCTGG - Intergenic
984473507 4:180208492-180208514 AATTAATTTTTATTTAGTTCAGG + Intergenic
986507002 5:8462248-8462270 AACAAACATTGATTTTGTCCAGG - Intergenic
986795416 5:11206107-11206129 AATTAATTTGTATTTTGGCCGGG - Intronic
986890406 5:12297640-12297662 ACTTTAAATGTATTTTGTCCTGG - Intergenic
987535259 5:19178573-19178595 AATAAAGCTTTATTTTTTTCTGG + Intergenic
987586221 5:19860151-19860173 AATTTAAATTCATTTTTTCCTGG + Intronic
987634405 5:20521023-20521045 AATTAAAATTTTTTTTCTCCAGG - Intronic
987664603 5:20921188-20921210 GATTGAGATGTAGTTTGTCCAGG + Intergenic
987989992 5:25198508-25198530 AGTTAAAATTAATTGTGTCCTGG - Intergenic
988039262 5:25867990-25868012 AATAAATATTTATGTTGTGCTGG - Intergenic
988143781 5:27277465-27277487 AATTAAGTTTCATTTTTTTCAGG + Intergenic
988368022 5:30327290-30327312 AAAAAAGAATTATTTTGTACAGG - Intergenic
988758082 5:34280994-34281016 GATTGAGATGTAGTTTGTCCAGG - Intergenic
990310387 5:54532138-54532160 TATTTAGATTTATTTTGGCTTGG + Intronic
990675281 5:58177427-58177449 AAATAAGATTCTTTGTGTCCTGG + Intergenic
990731581 5:58814542-58814564 AGACAAGATTTATATTGTCCTGG - Intronic
991264842 5:64705730-64705752 AATTTAGGTTTATTTTGCCAAGG + Intronic
993252917 5:85551141-85551163 AATAAAATTTTATTTTGTTCCGG - Intergenic
994199843 5:96960231-96960253 AATTAAGATAAATTTTGGCCAGG - Intronic
994306339 5:98209800-98209822 ACTTAACATTTATTTTTTTCAGG + Intergenic
994363774 5:98886836-98886858 AATTAAAAATTATTCTCTCCAGG + Intronic
995534607 5:113122580-113122602 AATTAAAATTTAATTTTTCAAGG - Intronic
996510131 5:124307610-124307632 AATTAAGATTGTTCCTGTCCCGG + Intergenic
996873421 5:128216439-128216461 AATTCAAATTTACTTTGACCAGG + Intergenic
997300572 5:132800842-132800864 AATAAAGGATTATTTTGCCCAGG + Intronic
997813115 5:136991245-136991267 AAATAAGATTTTTTTTCCCCTGG - Intronic
997914384 5:137909829-137909851 ACTTAAGATTTCTTTTGGCTGGG - Intronic
998151444 5:139759681-139759703 AATTATGATTTATCTTGTAGTGG - Intergenic
999033104 5:148316539-148316561 CATTGAAATTTATTTTCTCCAGG + Intergenic
999659443 5:153843638-153843660 AATTCAGTTTTATTTTATCAGGG - Intergenic
999835839 5:155370914-155370936 AATTAAGTTTTACTTTTTCATGG - Intergenic
999945122 5:156587486-156587508 AATCAAGATTTATGCTCTCCTGG - Intronic
1000456796 5:161459569-161459591 AATTAACAGCTATTTTGTTCAGG + Intronic
1000556058 5:162727386-162727408 AATTAAGAATTTTTTTGTTAAGG - Intergenic
1001856779 5:175018632-175018654 AATTTAGGTTTATTTTGCCAAGG - Intergenic
1001969022 5:175938852-175938874 AATTAAGTTTTCTTTTCTCTTGG + Intronic
1002248421 5:177904893-177904915 AATTAAGTTTTCTTTTCTCTTGG - Intergenic
1004094695 6:12541164-12541186 CATTAAGATTTTTATTATCCAGG - Intergenic
1004254009 6:14046101-14046123 AAATAATATTTTTTTTGGCCGGG - Intergenic
1004585889 6:16999959-16999981 AAACAAGATTTATTTTGGCTAGG + Intergenic
1005117000 6:22350134-22350156 AATTAAGATTTAATTTGCAGGGG + Intergenic
1005198604 6:23317634-23317656 AATTATGATTTATTTTCAACAGG + Intergenic
1005294946 6:24416214-24416236 AATTAAGAATCAATTTGGCCAGG - Intronic
1005632740 6:27723619-27723641 ATTTAAGATTTTTTTTAGCCGGG - Intergenic
1005981203 6:30838371-30838393 TGTTAAAAATTATTTTGTCCTGG + Intergenic
1006097976 6:31667885-31667907 CAGTAAGATTAAATTTGTCCTGG - Exonic
1007225714 6:40312544-40312566 AATAATCATTTATTTTGTTCAGG - Intergenic
1007456055 6:41978077-41978099 CATTAAGATTTTTTTTGACAGGG + Intronic
1008063026 6:47018613-47018635 GATTAAGATTTATTTTAATCTGG + Intronic
1008072312 6:47110162-47110184 AATAAAGATCTATTTTGGCTGGG + Intergenic
1008393749 6:50983107-50983129 AATTTTGAATTATTTTGTCCAGG + Intergenic
1008637518 6:53425700-53425722 CTTTAAGATATATTTTGGCCTGG + Intergenic
1008684918 6:53914761-53914783 ACTCAAGCTTTATTTTCTCCAGG + Intronic
1009503527 6:64447452-64447474 AATTCTGATTTTTTTTTTCCTGG + Intronic
1009540745 6:64955198-64955220 AATTAAGATTTTTTTTTTGTTGG - Intronic
1009993658 6:70875620-70875642 AATTTAGAATTATTTTCTTCTGG + Intronic
1010585551 6:77653973-77653995 AATAAATATTTATTTTTTTCTGG - Intergenic
1010685525 6:78850628-78850650 AATTAGTATTTATTTTGTTAAGG - Intergenic
1010709843 6:79161349-79161371 AATTAAGAATCATCTTGTCAGGG - Intergenic
1011926375 6:92650476-92650498 GCTTAAGATTTTTTTTTTCCAGG - Intergenic
1013611166 6:111796891-111796913 ATTTAATATTTATTGTATCCAGG + Intronic
1014178393 6:118355112-118355134 AATTCTGATTTAATTTGTCTGGG + Intergenic
1014441880 6:121483092-121483114 AATAAAGATATATTTTGTTGTGG - Intergenic
1014833563 6:126131206-126131228 ATATAAGAATTATTTTATCCTGG + Intergenic
1015006800 6:128292527-128292549 ATTTTAGATTTATTTTCCCCAGG + Intronic
1016309537 6:142718589-142718611 TATTTAGATTTATTTTGTTTGGG + Intergenic
1016371467 6:143378909-143378931 AATTAAGTCATATTTTCTCCAGG - Intergenic
1017261952 6:152397705-152397727 AAAAATGATTTATTTTGGCCGGG + Intronic
1017354782 6:153490941-153490963 AAATAATATTTATGTTGTCCTGG - Intergenic
1017405946 6:154118389-154118411 AATTAAAATGTATTTTTTCAAGG + Intronic
1017458694 6:154627780-154627802 GAATAAGAATTATTTTGGCCGGG + Intergenic
1022159211 7:27692022-27692044 ACTAAAGACTTATTTTATCCAGG + Intergenic
1022347075 7:29527118-29527140 AATCAAGATATAATCTGTCCAGG + Intergenic
1022433151 7:30347800-30347822 AATCTAGATTTATATTCTCCAGG + Intronic
1023707399 7:42955500-42955522 AATGAATCTTTATTTTTTCCAGG - Intergenic
1023738405 7:43255301-43255323 AAATAAGATTTATTCAGGCCGGG + Intronic
1024422864 7:49189960-49189982 AATTACGATTCATATTGTCATGG + Intergenic
1025214403 7:57043647-57043669 AATAAAGATATATTTTTTCTGGG - Intergenic
1025288723 7:57692226-57692248 AATTATGATGGATTTTTTCCTGG - Intergenic
1025657550 7:63533166-63533188 AATAAAGATATATTTTTTCTGGG + Intergenic
1026224848 7:68431264-68431286 AAAAAATATTTATTTTGGCCAGG - Intergenic
1027113725 7:75461704-75461726 TCTTAAGATTTGTTTTGGCCGGG - Intronic
1027285977 7:76646299-76646321 TCTTAAGATTTGTTTTGGCCGGG - Intergenic
1027630270 7:80595569-80595591 AATTTAGATTTGATTTGACCAGG + Intronic
1027890824 7:83971852-83971874 AATTAAGATGTCTTTGGTGCTGG + Intronic
1028291168 7:89066529-89066551 AATTAAGGATAATTTTGGCCAGG - Intronic
1028731101 7:94149400-94149422 AATTAATGTTTATTTTCTACAGG + Intergenic
1029002861 7:97173845-97173867 TATTAAGAATTATTTTGGCCAGG - Intronic
1029802864 7:102967879-102967901 AATTTGGTTTTCTTTTGTCCAGG - Intronic
1029971961 7:104798336-104798358 AATTCAGATTTTTTTGATCCAGG - Intronic
1030373981 7:108733396-108733418 AATTTAGATTAATATTTTCCAGG - Intergenic
1030738902 7:113085320-113085342 ACTTAAGATATATTTTGCACGGG - Intronic
1031161150 7:118170142-118170164 AATTAACAAATATTTTATCCAGG - Intergenic
1031277947 7:119755241-119755263 CAGTAAGAATTATTTTGTCTTGG + Intergenic
1031287576 7:119889743-119889765 ACACAAGATTTATTGTGTCCAGG + Intergenic
1031636999 7:124113513-124113535 ATTTAAAATTTATTCTCTCCTGG - Intergenic
1032715259 7:134503815-134503837 AAGAAAGATATATTTTGTTCAGG - Intergenic
1033132108 7:138753430-138753452 AATAAAGATTTATTCTGTCATGG - Intronic
1033535819 7:142311070-142311092 AATTTAGATTTGTTTTAACCTGG - Intergenic
1033845476 7:145426717-145426739 TATTAAGATTTATTTTAGGCCGG - Intergenic
1033968678 7:147010883-147010905 AATTAAGAATTATTTGGGGCGGG - Intronic
1034043783 7:147906461-147906483 AATAAAGATCTATCTTGGCCAGG - Intronic
1034487981 7:151378030-151378052 GATTTAGATATATTTTCTCCAGG + Exonic
1034636780 7:152573740-152573762 GAAAAAGATTTATTTTTTCCAGG + Intergenic
1036009770 8:4709004-4709026 AATAGACATTTATTTTGTCAAGG - Intronic
1036915611 8:12800717-12800739 TATTAAGATATATTTGGGCCGGG + Intergenic
1037369005 8:18153350-18153372 AATTAAGAATGATTTTGGCCAGG - Intergenic
1037399377 8:18478623-18478645 AAATATGAGTTAATTTGTCCAGG + Intergenic
1038006866 8:23438049-23438071 AATTAATGTTTATTTTCTACAGG - Intronic
1038082554 8:24155662-24155684 AACTGAGATTTTTTTTTTCCAGG - Intergenic
1038409538 8:27347453-27347475 AACGGAGATTTATTTTCTCCCGG + Intronic
1038625506 8:29189336-29189358 AGTTAAGATTCATTTGGTCTAGG - Intronic
1038731623 8:30133042-30133064 TTTTAAGATTTATTTTGTGTGGG - Intronic
1038765462 8:30423674-30423696 AACTAAGATTTACTATTTCCGGG - Intronic
1038890358 8:31714324-31714346 TATTAAGATTTTTTTTGTATTGG + Intronic
1039357517 8:36837388-36837410 AATTAAAATCTAATTTTTCCAGG + Intronic
1040297545 8:46165964-46165986 AATTAAGCTTTACTTTGACACGG - Intergenic
1040652664 8:49466084-49466106 AATTATAATTTATTTTGTTGGGG + Intergenic
1041317323 8:56578007-56578029 AAGTATAATTTATTTGGTCCAGG - Intergenic
1041995100 8:64045437-64045459 AATTAAGAATATTTTTGTCCTGG - Intergenic
1042590985 8:70398497-70398519 AAGTAAGATTTAAGTTGGCCAGG + Intronic
1043509948 8:80940305-80940327 AATAAAGATTTATGCTGGCCGGG - Intergenic
1044279923 8:90342521-90342543 AATGAAAATTTACTTTGTGCTGG + Intergenic
1044490928 8:92813992-92814014 AATTAAAATTTTTTTCTTCCGGG - Intergenic
1044778668 8:95721115-95721137 AATAAAGATTAATTTAGGCCGGG - Intergenic
1045444201 8:102243128-102243150 ATTTAAGATTTATTTGGGGCTGG + Intergenic
1046416668 8:113924012-113924034 AATAAAGATCTATTATGTCTAGG + Intergenic
1047012229 8:120684950-120684972 AATTAAGATTCAATTTTTGCTGG - Intronic
1047065085 8:121272932-121272954 ATTTCAGATTTAATTTGTCTGGG + Intergenic
1047577189 8:126169538-126169560 CTTTAATCTTTATTTTGTCCAGG - Intergenic
1047955992 8:129976066-129976088 AATTAACATTTATTGTCTTCTGG - Intronic
1048020879 8:130537846-130537868 AATAAAGATTACTTTTGGCCGGG - Intergenic
1048103295 8:131378896-131378918 AATTATGTTTTTTTTTCTCCTGG - Intergenic
1048359377 8:133683668-133683690 AATTAAGTCTTGTTTTTTCCGGG - Intergenic
1048825049 8:138416151-138416173 AATTAAGATTTATTTTGTCCTGG - Intronic
1049500107 8:142958144-142958166 AATTGAGATTTTTTTTCTCTTGG - Intergenic
1049912956 9:287421-287443 AATTAAGATTCATATCCTCCTGG + Intronic
1050430000 9:5552648-5552670 AATTAAAATTAATTTTTTCATGG + Intronic
1051668443 9:19487157-19487179 TATTATTATTTTTTTTGTCCAGG + Intergenic
1051931747 9:22394581-22394603 GATAATGGTTTATTTTGTCCCGG + Intergenic
1052054590 9:23889798-23889820 AATTAAACTTTTTTTTTTCCTGG + Intergenic
1052973445 9:34394852-34394874 AATTAATTTTTATTTTGTGTTGG - Intronic
1053674988 9:40415682-40415704 AAGGAAGATTCATGTTGTCCAGG + Intergenic
1053924781 9:43042041-43042063 AAGGAAGATTCATGTTGTCCAGG + Intergenic
1054288265 9:63254214-63254236 AAGGAAGATTCATGTTGTCCAGG + Intergenic
1054386091 9:64555749-64555771 AAGGAAGATTCATGTTGTCCAGG + Intergenic
1054509631 9:65960611-65960633 AAGGAAGATTCATGTTGTCCAGG - Intergenic
1055032151 9:71781496-71781518 GACTAAGATTTTTTTTCTCCAGG - Intronic
1055161024 9:73128317-73128339 AATAAACATTTATTTTCTCAAGG + Intergenic
1055204926 9:73717306-73717328 CATTGATATTTATTTTGCCCAGG + Intergenic
1055431008 9:76243750-76243772 AATTCATATTTATTATGTCCTGG - Intronic
1056089178 9:83187569-83187591 AATTCAGATGTAGATTGTCCAGG - Intergenic
1056345385 9:85689356-85689378 AATTAAGATTTAATTGGTTTGGG + Intronic
1056532589 9:87499380-87499402 AATTAAATCTGATTTTGTCCAGG - Intronic
1057333641 9:94139936-94139958 AATCAAGATTTTTTTTGTTTTGG - Intergenic
1058257204 9:102782029-102782051 TATTAATATTTTTTTTGTCATGG - Intergenic
1058638940 9:107064427-107064449 GATTAATCTTTATTTTGTCGGGG - Intergenic
1058986384 9:110211989-110212011 AATTAAATTTAATTTTGTCCAGG - Intergenic
1059115635 9:111598497-111598519 AATTAAGACTTTTTTTGTGACGG + Intronic
1059193734 9:112351078-112351100 AATTAAGAATTACTTGGGCCAGG - Intergenic
1059835132 9:118143239-118143261 AAATCATATTTATTTGGTCCTGG + Intergenic
1059978635 9:119744817-119744839 ATTGAACAATTATTTTGTCCTGG - Intergenic
1060229567 9:121816855-121816877 AATTTAGACTTATTTTGTGAGGG + Intergenic
1061690496 9:132324109-132324131 TATTAAGATTTATTTCCTTCAGG - Intronic
1186144607 X:6612378-6612400 AACAAAGATTTATTTTCTCACGG + Intergenic
1186263040 X:7801480-7801502 ATTTCAGTTTTATTTAGTCCAGG - Intergenic
1186550134 X:10495525-10495547 TATTAGGATTTATTTTCTCCAGG + Intronic
1186764087 X:12753217-12753239 AATTAAAATATATTTTTTCCAGG - Intergenic
1187649520 X:21386935-21386957 AATTAAAATTAATTTTGTTTGGG + Intronic
1187680791 X:21765898-21765920 AAATAAAATTTATTTTTTCTTGG + Intergenic
1187957467 X:24533676-24533698 AATTAAAATATGTTTTGTTCTGG + Intronic
1187985884 X:24810563-24810585 AATTATTATTTATATTGTCAGGG - Intronic
1188068314 X:25688654-25688676 AATAAACATTTTTTTTGTACCGG + Intergenic
1188074885 X:25763128-25763150 TATTCAGTTTTATTTTGTCTTGG - Intergenic
1188391711 X:29629090-29629112 AATAAAGATTTCTTATTTCCTGG + Intronic
1188760117 X:34017457-34017479 AAATAAAATTTATTTTGCACAGG - Intergenic
1190540866 X:51477012-51477034 AATTAAGCTTTTTTTTGACCTGG - Intergenic
1191992627 X:67055331-67055353 AATTAAAAGTAATTTTGTCAAGG - Intergenic
1193346939 X:80414428-80414450 AATTTAGGTTTATTTTGCCAAGG + Intronic
1193772912 X:85608882-85608904 AATAAATATTGAGTTTGTCCTGG + Intergenic
1196140076 X:112251792-112251814 AATTAAAAGCTATTTTATCCTGG - Intergenic
1196377556 X:115050765-115050787 AATTAATATTTATTTTTGGCTGG - Intergenic
1196766364 X:119248753-119248775 TAATAAGATTAATTTTCTCCTGG + Intergenic
1197791575 X:130259695-130259717 AATAAATATTTGTTTTGGCCAGG + Intronic
1198596873 X:138245759-138245781 AATTATTATTTATTTTATTCAGG + Intergenic
1198609049 X:138376706-138376728 AATCAAAATTAATTTTGTTCTGG - Intergenic
1200784239 Y:7245490-7245512 AAATAAGAAATATTTTGGCCTGG + Intergenic
1201380354 Y:13369631-13369653 ACTGAATATTTATTTTGCCCAGG + Intronic
1201639984 Y:16168314-16168336 TATAAAGATAAATTTTGTCCTGG + Intergenic
1201662829 Y:16417011-16417033 TATAAAGATAAATTTTGTCCTGG - Intergenic
1201898008 Y:19014873-19014895 AAATAAGATACATTTTGTCCAGG + Intergenic