ID: 1048825050

View in Genome Browser
Species Human (GRCh38)
Location 8:138416165-138416187
Sequence ATCTTAATTCTCTGTACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048825048_1048825050 -8 Left 1048825048 8:138416150-138416172 CCCAGGACAAAATAAATCTTAAT 0: 1
1: 1
2: 1
3: 36
4: 464
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data
1048825047_1048825050 -7 Left 1048825047 8:138416149-138416171 CCCCAGGACAAAATAAATCTTAA 0: 1
1: 0
2: 1
3: 49
4: 453
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data
1048825049_1048825050 -9 Left 1048825049 8:138416151-138416173 CCAGGACAAAATAAATCTTAATT 0: 1
1: 0
2: 1
3: 44
4: 548
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data
1048825044_1048825050 2 Left 1048825044 8:138416140-138416162 CCCTTGATCCCCCAGGACAAAAT 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data
1048825045_1048825050 1 Left 1048825045 8:138416141-138416163 CCTTGATCCCCCAGGACAAAATA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data
1048825046_1048825050 -6 Left 1048825046 8:138416148-138416170 CCCCCAGGACAAAATAAATCTTA 0: 1
1: 0
2: 3
3: 40
4: 332
Right 1048825050 8:138416165-138416187 ATCTTAATTCTCTGTACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048825050 Original CRISPR ATCTTAATTCTCTGTACTTT TGG Intronic
No off target data available for this crispr