ID: 1048827151

View in Genome Browser
Species Human (GRCh38)
Location 8:138439392-138439414
Sequence ATGGTGTAGTGGAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 1, 2: 10, 3: 49, 4: 389}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048827151_1048827155 0 Left 1048827151 8:138439392-138439414 CCATTCTCATTCCACTACACCAT 0: 1
1: 1
2: 10
3: 49
4: 389
Right 1048827155 8:138439415-138439437 GTGACCTCAGTAGTCCTCATGGG 0: 1
1: 0
2: 0
3: 8
4: 91
1048827151_1048827154 -1 Left 1048827151 8:138439392-138439414 CCATTCTCATTCCACTACACCAT 0: 1
1: 1
2: 10
3: 49
4: 389
Right 1048827154 8:138439414-138439436 TGTGACCTCAGTAGTCCTCATGG 0: 1
1: 0
2: 1
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048827151 Original CRISPR ATGGTGTAGTGGAATGAGAA TGG (reversed) Intronic
901588618 1:10319751-10319773 CTGGGGTAGTGGTAGGAGAAAGG - Intronic
902451874 1:16501413-16501435 ACGGTGTAGAGGAAAGAGCATGG - Intergenic
902716598 1:18277019-18277041 ATGGTGTTGGGGAAAGAGACAGG + Intronic
904233143 1:29094213-29094235 ATGGTGTACTGGTATGAAAATGG - Intronic
904991278 1:34594859-34594881 GTGGTACAGTGGAATGAGTATGG - Intergenic
905406149 1:37733725-37733747 TTGGGGGAGAGGAATGAGAAGGG - Intronic
905568559 1:38985846-38985868 TTGTTTTAGTGGAATGGGAAGGG + Intergenic
907391458 1:54160946-54160968 ATGGTTTTGTGGAAGGAGCAAGG + Intronic
908480716 1:64536332-64536354 ATTGTGTAGTGGAAAGAGCATGG - Intronic
909584467 1:77274153-77274175 ATGGAGTACTAGAATAAGAATGG - Intergenic
911207956 1:95111683-95111705 ATGGTGCAGTGGACTGTGGAAGG + Intergenic
911449993 1:98050041-98050063 ATGGTTTAGTAGAATGGGAGGGG + Intergenic
912252342 1:108024565-108024587 ATGGTGTGGTGATAGGAGAAGGG + Intergenic
913185210 1:116364472-116364494 ATGGTGCAGTGGAAAGAGAAGGG + Intergenic
913387586 1:118276655-118276677 ATGGCATAGTGCAATGACAAAGG + Intergenic
914867546 1:151444366-151444388 ATTTTGTAGTGGAATTAGACTGG - Intronic
915604542 1:156942307-156942329 ATGGTACAGTGGAAGGAGACAGG - Intronic
916600043 1:166283807-166283829 ATGGTGTTGTGGAATGACACTGG + Intergenic
917499899 1:175576618-175576640 ATGGTGTGGTGGGATGATGATGG - Intronic
917509098 1:175655514-175655536 CTAGTGTGGTGGAAAGAGAATGG - Intronic
917657294 1:177138970-177138992 ATGGCGGAGTGGAAAGAGCATGG - Intronic
919349043 1:196425332-196425354 ATGGACTAGAGGAATCAGAAAGG - Intronic
919565930 1:199187909-199187931 AGGGCTTAGTGGAATAAGAATGG + Intergenic
920112858 1:203599308-203599330 AGGGTCTAGGGGAAGGAGAAAGG - Intergenic
921353035 1:214256939-214256961 ATGGAGTGGAGGACTGAGAAGGG + Intergenic
921685995 1:218089789-218089811 ATGGTGGAGTGGAGAGAGGAGGG - Intergenic
922301660 1:224306780-224306802 ATGGTGGAGTGGCATGATCACGG - Intronic
923081852 1:230665187-230665209 ATGGTGCAGTGGAAAGAGCATGG + Intronic
923638051 1:235721241-235721263 ATGGTGTAGTAGAAACAGCACGG + Intronic
1063161082 10:3419253-3419275 CTTGTGTGGTGGAAGGAGAATGG + Intergenic
1063561538 10:7132776-7132798 ATGATGTAAAGGAAGGAGAATGG - Intergenic
1063817714 10:9795398-9795420 TGGATGCAGTGGAATGAGAAAGG - Intergenic
1064269326 10:13850741-13850763 ATGGTGCAGTGAAAAGAGAATGG + Intronic
1065443990 10:25778794-25778816 GTGTTGTAGTGAAATGAGAGTGG + Intergenic
1066236320 10:33488436-33488458 CTGATGTAGTAAAATGAGAAAGG - Intergenic
1067013514 10:42737417-42737439 ATGATGTAGTGGAAAAAGCATGG + Intergenic
1067276347 10:44838486-44838508 ATGGTGGAGGGAAATGAAAAGGG - Intergenic
1067427163 10:46218993-46219015 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067427172 10:46219031-46219053 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067582589 10:47454823-47454845 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067939331 10:50640432-50640454 ATGGGGCAGTGGAATGTGAGGGG - Intergenic
1068650821 10:59520519-59520541 ATGGTGTGGTGGGAACAGAAAGG - Intergenic
1069509786 10:69033442-69033464 GTGGTGGAGGGGAATGAGTAGGG - Intergenic
1070970237 10:80559686-80559708 ATAGTGTAGTGGTATGATCATGG + Intronic
1071167607 10:82824765-82824787 TTAGTGTAGTGGCATGATAATGG + Intronic
1071429021 10:85590995-85591017 ATGCTGCAGTGTAATGAGAAAGG + Intergenic
1072443803 10:95480472-95480494 GTGGTGTGGTGGAAAGAGCATGG + Intronic
1073388831 10:103154487-103154509 ATGGTGTAATGGAAAGAGAATGG + Intronic
1075739729 10:124687381-124687403 TTGGTGTAGTGGAAAGGGCAAGG + Intronic
1076069155 10:127472255-127472277 ATGGTGCAGGGGAGAGAGAAGGG + Intergenic
1078844421 11:15108482-15108504 ATGATGTAGGGGAAAGACAAAGG + Intergenic
1079225598 11:18602107-18602129 CTGGTCTAGTGGAATGAGTATGG - Intergenic
1080570558 11:33552884-33552906 ATGGTGTAGTGGATTGACTCAGG - Intronic
1082044074 11:47710744-47710766 CTGGTGTAGTGGAGTGAGAAAGG + Intronic
1083072033 11:59994536-59994558 ATGTTGTAATGGTATGGGAAGGG - Intergenic
1085189154 11:74602790-74602812 GTGCTGTAGTGGAATAAGGACGG - Intronic
1085985279 11:81779656-81779678 ATGATGTAGTGAAATGAGCACGG + Intergenic
1086017668 11:82186528-82186550 ATGGGGTAATGGAAAGAGCAGGG - Intergenic
1086213896 11:84353944-84353966 ATGGAGGAGAGGAATGAGAGTGG - Intronic
1087639422 11:100740573-100740595 ATGGTATAGGGGGAGGAGAATGG + Intronic
1088843210 11:113643977-113643999 ATGCTGCATTGGAATGAAAAGGG + Intergenic
1090276192 11:125421444-125421466 ATGGTGTAGCGCAAGGAGCAAGG + Intronic
1091652530 12:2320587-2320609 GTGGTATAGAGGAAGGAGAAGGG + Intronic
1092944734 12:13442176-13442198 AGGGAGAAGTGGAAAGAGAAGGG - Intergenic
1094441882 12:30486718-30486740 TTGGTGAAGTGGAAACAGAATGG - Intergenic
1094467199 12:30766027-30766049 ATGGCATAGTAGAAAGAGAACGG + Intergenic
1094500624 12:31017698-31017720 AGGGTTTATTTGAATGAGAAAGG + Intergenic
1095471815 12:42545052-42545074 ATGGTGCAGTGGTATGATCATGG + Intronic
1096009692 12:48202451-48202473 ATGGTGTACAGGAGGGAGAAAGG + Exonic
1096171428 12:49474386-49474408 GTGCTGTAGTGTTATGAGAAAGG + Intronic
1096860537 12:54524199-54524221 CTGGTTTAGTAGAATGAGCAAGG + Intronic
1097285051 12:57870656-57870678 GCTGTGTAGTGCAATGAGAAGGG + Intergenic
1097473982 12:60031433-60031455 ATGAAGTGGTGGAATGAGCAAGG + Intergenic
1098462521 12:70747995-70748017 AGGGTGTGGGGGAAGGAGAAGGG + Intronic
1098519274 12:71417430-71417452 ATGTTGTAGTGGAAAAAGCAGGG + Intronic
1098751796 12:74302167-74302189 ATGGAGTGGTGGAAAGAGAGTGG - Intergenic
1098957194 12:76699668-76699690 ATGGTGTAGTGAAATGAGCAAGG + Intergenic
1099565819 12:84245003-84245025 AAGAGGTAGTGGAATGAGAGTGG + Intergenic
1099579709 12:84428691-84428713 AGGGTTTAGTGGAAAGAAAAAGG - Intergenic
1099820433 12:87701953-87701975 GTGGTGTAGTGTTATGAGGATGG + Intergenic
1100690288 12:97032264-97032286 ATGGTAAAGTGGGAAGAGAAAGG + Intergenic
1100947915 12:99808047-99808069 ATGGTATAGTGGAAAGAGCATGG - Intronic
1101854086 12:108427718-108427740 AGGGTGTGGTGGGCTGAGAAAGG + Intergenic
1103147578 12:118609009-118609031 AAGGTGTAGTGGGGAGAGAAAGG + Intergenic
1106814615 13:33393398-33393420 ATGGTGTAGTGGGCTGCGTATGG + Intergenic
1108275895 13:48809363-48809385 ATGGTTTTGTGGAAAGAGAGTGG + Intergenic
1108328434 13:49359065-49359087 ATGGTGGAGTAGAAAGACAAGGG + Intronic
1108378018 13:49831208-49831230 ATGGTTTAGTGGAGGGAGACTGG - Intergenic
1109106462 13:58257928-58257950 TTGGTGGAGTGGAGCGAGAAAGG + Intergenic
1109300561 13:60586140-60586162 ATAGTTTAGTGGAATAGGAATGG - Intergenic
1110310560 13:74044426-74044448 ATGGTGTATGGGTATGAGTATGG + Intronic
1110565227 13:76951000-76951022 ATAGTGTAGGGTGATGAGAATGG - Intronic
1113428906 13:110232042-110232064 AAGCTGTAGTGAAATCAGAAGGG - Intronic
1113591313 13:111503261-111503283 ATGGAGTGCTGGAATGAGAAGGG - Intergenic
1114190032 14:20433986-20434008 ATGGCCTAGTGGAAGGAGACTGG + Intronic
1114786808 14:25609611-25609633 ATGGTGTCATTCAATGAGAAAGG + Intergenic
1115664403 14:35532583-35532605 TTGGTGTAGTGGAAAGAGTCTGG + Intergenic
1115959210 14:38816223-38816245 ATGATGTAGTGGAATATGAGGGG + Intergenic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116789481 14:49325245-49325267 GTGGTGTGATGGAATGAGAAGGG + Intergenic
1116965088 14:51005870-51005892 AGGGTGGTGTGGAATCAGAATGG + Intronic
1118520410 14:66576378-66576400 ATGGCATAATGGAAGGAGAAAGG + Intronic
1118593378 14:67418290-67418312 GTGGAGTAGTGGAAAGAGCAAGG - Intergenic
1118866365 14:69707229-69707251 ATGATGTAGTTGTATCAGAAAGG + Intronic
1120691858 14:87601591-87601613 AAGGTGTAATGGAATGAGAATGG - Intergenic
1120911211 14:89668756-89668778 ATGGGGTAGTGGAATGAATAGGG - Intergenic
1121399796 14:93664067-93664089 ATCTTGTATTAGAATGAGAAAGG - Intronic
1121967089 14:98320374-98320396 ATGGTGAAATGGAATCATAAGGG - Intergenic
1122097582 14:99382881-99382903 AGAGTGTGGTGGAAAGAGAATGG + Intergenic
1122196030 14:100086547-100086569 ATGGTGTACTGGAAAGGGCATGG + Intronic
1202923835 14_KI270724v1_random:6643-6665 ATAGTGTAGTGAGATGAGCAAGG - Intergenic
1125325387 15:38531287-38531309 CAGGTATAGTGGAAAGAGAAGGG - Intronic
1125413427 15:39428567-39428589 ATGGTGAAGTGGAATGATAATGG - Intergenic
1125499303 15:40228807-40228829 ACGGCCTTGTGGAATGAGAATGG - Intergenic
1126904437 15:53349204-53349226 ATTGTGAAGTGGCAGGAGAAAGG + Intergenic
1128168641 15:65490470-65490492 ATACTGCAGTGGAATGAGATTGG - Intronic
1128485722 15:68085550-68085572 ATGGTTTAGTGGAAAGAGCATGG + Intronic
1130236350 15:82138122-82138144 CAGGTGTTGTGGAATGAGAATGG - Intronic
1130260793 15:82352869-82352891 ATTGTGTAGTGAAGGGAGAAAGG - Intergenic
1130280441 15:82516138-82516160 ATTGTGTAGTGAAGGGAGAAAGG + Intergenic
1130471814 15:84232321-84232343 ATTGTGTAGTGAAGGGAGAAAGG + Intergenic
1130479308 15:84346892-84346914 ATTGTGTAGTGAAGGGAGAAAGG + Intergenic
1130492462 15:84441237-84441259 ATTGTGTAGTGAAGGGAGAAAGG - Intergenic
1130594111 15:85236958-85236980 ATTGTGTAGTGAAGGGAGAAAGG + Intergenic
1130601703 15:85279665-85279687 ATGGTGTAGTGACTTCAGAAAGG + Intergenic
1130767182 15:86882411-86882433 ATGGTGTAGTGACTTCAGAAAGG - Intronic
1133084069 16:3348193-3348215 ACAGTGCAGAGGAATGAGAATGG + Intergenic
1134439409 16:14288892-14288914 ATGGTGGAGATGGATGAGAATGG - Intergenic
1135147514 16:19975416-19975438 CAGGGGTATTGGAATGAGAATGG - Intergenic
1135147818 16:19978473-19978495 ATGGTGTGGTGGAAGAAGATGGG + Intergenic
1136271867 16:29153399-29153421 ACGGTGGTGTGGAAAGAGAAAGG + Intergenic
1137867816 16:51919042-51919064 ATGGTGTAGTGGAAACAGTATGG - Intergenic
1138322309 16:56126146-56126168 ATAATGTAGTAGAATGAGTATGG - Intergenic
1139599113 16:67976048-67976070 ATGGTTCAGTGGTTTGAGAAGGG - Intronic
1140970653 16:80009426-80009448 GTGATGTAGTGGAATAAGCAAGG - Intergenic
1141365003 16:83434471-83434493 ATGGGAGAGTGGAATGAGATGGG - Intronic
1142075533 16:88115555-88115577 ACGGTGGTGTGGAAAGAGAAAGG + Intronic
1143161405 17:4874041-4874063 TTGGTGTGGTGGAAAGAGCATGG - Intronic
1143250066 17:5516814-5516836 ACAGTGTAGTGGAAAGAGGATGG - Intronic
1143734040 17:8897834-8897856 ATGGTGGAGTGGAAAGATGAGGG + Intronic
1144468706 17:15517828-15517850 ATGGTGCAGTGGGAAGAGAATGG - Intronic
1145048317 17:19637307-19637329 ATGGTTTTGTGGAATGTTAAGGG - Intergenic
1146008740 17:29178421-29178443 AGGGATTAGGGGAATGAGAAGGG - Intronic
1146364825 17:32214606-32214628 ATTGGGTGGTGGGATGAGAATGG + Intronic
1146536341 17:33656011-33656033 ATGGCATAGTGGAAGTAGAAAGG + Intronic
1146908384 17:36632386-36632408 GTGGTGGAGTGGAAAGAGAGTGG + Intergenic
1147410114 17:40244638-40244660 TTGGTGTATTGGACAGAGAAGGG + Intronic
1147504840 17:41005686-41005708 TTGGTGTAGTGGAAAGAGAAGGG + Intergenic
1147549062 17:41425685-41425707 ATGATGAAGTGAAAAGAGAATGG - Intergenic
1149396540 17:56250710-56250732 ATGGTCTATTGTACTGAGAAGGG - Intronic
1149853632 17:60058465-60058487 TTGGTACAGTGGAATGAGCAGGG + Intronic
1150037784 17:61822730-61822752 AATGTGTAGTGGGATGTGAATGG + Intronic
1150054409 17:62000017-62000039 ATGGTGCAGTGGCATGATCATGG - Intronic
1150181130 17:63122121-63122143 AAGCTGTAGTGGGATGAGAAAGG + Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150510949 17:65752539-65752561 CTGGAGAGGTGGAATGAGAAAGG - Intronic
1151393542 17:73803996-73804018 ATGGTGCCGGGAAATGAGAAGGG - Intergenic
1152990199 18:356439-356461 AGTGTGTATTGGAATGAGATGGG - Intronic
1153335641 18:3921420-3921442 ATGGTGTGGTGGAAAGAACATGG + Intronic
1153429027 18:4995025-4995047 TTGGTGTGATGGAATGAAAATGG - Intergenic
1153741549 18:8134854-8134876 ATGCTGTAGTGCAATGAAATAGG + Intronic
1155541228 18:26870540-26870562 ATTGTGTAGTGGAAGGAGAAGGG + Intergenic
1155638725 18:27986473-27986495 TTATTATAGTGGAATGAGAATGG - Intronic
1155647729 18:28100422-28100444 ATGGTGTAGTCCAATCTGAAGGG - Intronic
1155686454 18:28558008-28558030 ATGGTATAGGGGGATGAGTATGG - Intergenic
1155900842 18:31388292-31388314 AGAGTGTAGTGGAATAAGAAGGG - Intronic
1156369721 18:36461823-36461845 GTGATGTAGTGGAAAGAGTATGG + Intronic
1157829298 18:50841762-50841784 ATGGTATAGTGGAAAGAATATGG + Intergenic
1158135566 18:54204062-54204084 GCAGTGTAGTGGAATAAGAAGGG - Intronic
1159940513 18:74403589-74403611 ATGGTGCAGTGGCATGATCATGG + Intergenic
1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG + Exonic
1164511862 19:28904109-28904131 ATGGGGAAGTGGAAGAAGAAAGG - Intergenic
1165437476 19:35804113-35804135 ATGCTGTAGTTGAAGGAGAGGGG - Intronic
1165693693 19:37884293-37884315 TTGATATAGTGGAAAGAGAATGG - Intergenic
1167322753 19:48806596-48806618 ATGGTGGAATGGAATGACAAGGG - Exonic
1202646703 1_KI270706v1_random:148470-148492 TTGGTGCAGTGGAATGAGGCTGG + Intergenic
925626502 2:5846654-5846676 AGGTTGGAGTGGAATGAGCATGG - Intergenic
925869932 2:8261302-8261324 GTGGTGAGATGGAATGAGAAAGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927666584 2:25036984-25037006 ATAGTGTGGTGGAAAGAAAATGG + Intergenic
928996527 2:37297783-37297805 TTGGTAGAGTGCAATGAGAATGG - Intronic
930086273 2:47499547-47499569 ATGGTGTAGTGAAATGAGAAAGG + Intronic
930360553 2:50372990-50373012 ATGGTGTTGTGGAGTGCTAATGG - Intronic
930532362 2:52605771-52605793 ATGGTGAGAGGGAATGAGAATGG - Intergenic
931028808 2:58146577-58146599 ATGGTTTTGTTAAATGAGAAGGG + Intronic
932543381 2:72680817-72680839 ATGGTGTGGTGAAATGGGGATGG - Intronic
932546972 2:72722646-72722668 ATGGTTTAGTGTAAACAGAATGG + Intronic
932759256 2:74428760-74428782 GTGAGGTAGGGGAATGAGAAGGG + Intronic
933050887 2:77600582-77600604 GTGATGTTCTGGAATGAGAAGGG - Intergenic
934509861 2:94928888-94928910 TTGGTGCAGTGGAATGAGGCTGG + Intergenic
935944343 2:108271824-108271846 AGGGTGTGGTGGGATAAGAAGGG - Intergenic
936286714 2:111186911-111186933 GTGGTGTAGAGGGATGAGCATGG + Intergenic
936959890 2:118061840-118061862 ATGGTGTAATGGAAGGGGAAGGG + Intergenic
937194734 2:120143156-120143178 CTGGTGAAGTGAAATGAGCATGG + Intronic
937325351 2:120986815-120986837 ATGGTGCAGTTGAAAGAGCATGG - Intronic
938180982 2:129182181-129182203 ATGAGGGAGTGGAAAGAGAAGGG - Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938894899 2:135740245-135740267 ATGGGCTAGTGGAGTCAGAAAGG - Intergenic
939088869 2:137755222-137755244 ATGATGTAGTGGAAGGATAGGGG - Intergenic
939672802 2:145034312-145034334 AATGTGGAGTGAAATGAGAAGGG + Intergenic
940074501 2:149726065-149726087 ATGGTGTAGCAGAAAAAGAAGGG + Intergenic
940112028 2:150165598-150165620 GTGGTCTGATGGAATGAGAATGG - Intergenic
940477899 2:154189784-154189806 ATGGTGGAGTAGGATAAGAATGG + Intronic
940619385 2:156092110-156092132 ATAGTGTGGGGGAAGGAGAAAGG - Intergenic
941204862 2:162559104-162559126 ATGGTGCAGTTGAAAGAGTATGG + Intronic
941662381 2:168208524-168208546 ATGGTGGAGTGGATTCATAAGGG - Intronic
942382668 2:175408231-175408253 ATGGTGTAGTGGAAAGAGTGTGG + Intergenic
943710378 2:191087503-191087525 ATGGGGTAGTGGGATGGAAAGGG - Intronic
944153526 2:196587889-196587911 ATGATGGGGTGGAATGACAAGGG - Intronic
944365899 2:198919287-198919309 ATGGTGTAGTGTGATTAGATTGG + Intergenic
944472535 2:200069833-200069855 ATGTTGAAGAGAAATGAGAATGG - Intergenic
945058933 2:205891706-205891728 ATGGTGTAGAGAAAAAAGAATGG - Intergenic
945192280 2:207201362-207201384 ATGGTGCAGTAGAAAGAGAATGG - Intergenic
946555116 2:220847831-220847853 ATGATGGAGAGGAATGAGAAGGG + Intergenic
946807504 2:223485880-223485902 ATGGTGGAAGGGAAGGAGAAAGG - Intergenic
947356255 2:229299245-229299267 ATGGTGTAATGGGATGTGACAGG + Intergenic
1169779188 20:9291035-9291057 ATGCTGGAATGGAAAGAGAAGGG - Intronic
1170512278 20:17090436-17090458 ATGCTGTAGTGGAAAGAGCATGG + Intergenic
1172939683 20:38645876-38645898 CTGGTTTGGTGGAATGAGGAGGG - Intronic
1173084954 20:39907012-39907034 ATGGTGTGATGGAAGGAGAATGG + Intergenic
1175178919 20:57131171-57131193 CTGGTTTAGTCCAATGAGAATGG - Intergenic
1175700399 20:61132741-61132763 ATGTTCTAGTGGAAGGAGACAGG - Intergenic
1176588329 21:8612717-8612739 ATTGTTTAGTGGAATAAGGATGG + Intergenic
1176605163 21:8824294-8824316 TTGGTGTAGTGGAATGAGGCTGG - Intergenic
1176791963 21:13328452-13328474 ATGGTGAACAGGAATGGGAATGG - Intergenic
1177639049 21:23822462-23822484 CTTGTGAAGTGGAAAGAGAATGG + Intergenic
1178021665 21:28415281-28415303 GTGGTGGAGAGGAAAGAGAATGG + Intergenic
1178111903 21:29377117-29377139 ATGGGGTAGGGGAATGAGAGGGG + Intronic
1178158377 21:29881697-29881719 ATGGTGCAGTAGAAGAAGAAAGG - Intronic
1178402919 21:32302716-32302738 ATGGAGTAAGGGAATAAGAACGG + Intronic
1179632540 21:42687775-42687797 AAGGTGTGGTGGGATGGGAAGGG - Intronic
1180271161 22:10589713-10589735 ATTGTTTAGTGGAATAAGGATGG + Intergenic
1180347456 22:11715899-11715921 TTGGTGTAGTGGAATGAGGCTGG - Intergenic
1180355220 22:11834007-11834029 TTGGTGCAGTGGAATGAGGCTGG - Intergenic
1180383031 22:12158320-12158342 TTGGTGCAGTGGAATGAGGCTGG + Intergenic
1181780469 22:25189256-25189278 ATGGTGTGGAGGCAGGAGAATGG - Intronic
1181905652 22:26193596-26193618 TTGGTGCAGTGGGATGAGGATGG - Intronic
1181961253 22:26623234-26623256 ATGGTGGTGTGGGATGAGGACGG + Exonic
1182189606 22:28445051-28445073 ATGGTGTTGTAGATAGAGAAAGG - Intronic
1183375861 22:37464664-37464686 AGGGAGGAATGGAATGAGAATGG - Intergenic
949139002 3:609041-609063 ATTGTTTAGTGGAATAAGGATGG - Intergenic
952716482 3:36485321-36485343 ATGGTGGAGTGGAAAGAACACGG + Intronic
953085907 3:39667014-39667036 ATGGTACAGTGGAAAGAGCATGG + Intergenic
953528322 3:43713982-43714004 ATGGGGTAGTGGTAGCAGAAAGG + Intronic
955086588 3:55708761-55708783 ATGGAGGAGTGGAAGAAGAAAGG + Intronic
955555696 3:60134939-60134961 ATGGAGTAGAGGAAAGAGAAAGG + Intronic
956184818 3:66552369-66552391 GTGGTATAGTGGAATTAGAGTGG - Intergenic
956570960 3:70694200-70694222 ATTTTTTAGTGTAATGAGAATGG - Intergenic
957661363 3:83158248-83158270 ATAGTCAAGTGGAATGATAAAGG - Intergenic
958056182 3:88415428-88415450 CTGGTGTAGCGGAATCAGATAGG + Intergenic
959146741 3:102555897-102555919 ATGATGGACTGGATTGAGAAGGG - Intergenic
959380601 3:105636725-105636747 ATGGTATAGTGGTAGGATAATGG - Intergenic
960715242 3:120568780-120568802 ATGGTGTCGTGGAAAGAACAAGG - Intergenic
960758194 3:121042828-121042850 ATGGGGTACTGAAATGAGAAAGG + Intronic
963326589 3:143869806-143869828 ATAGTGCAGTAGAATAAGAATGG - Intergenic
964380114 3:156090140-156090162 ATGGTGCAGTGGAGTGAGCTGGG - Intronic
965137592 3:164791987-164792009 TTAGTGTAGTGTAAAGAGAAAGG - Intergenic
965285757 3:166817718-166817740 ATGTAGTAGTGGAAGGAGAGAGG - Intergenic
965936218 3:174116199-174116221 GTGGTGTACAGCAATGAGAATGG - Intronic
966281239 3:178231956-178231978 ATGGTGAAATGAAAAGAGAATGG - Intergenic
967292897 3:187938777-187938799 ATTGTGTAGTTGAAAGAGAGTGG - Intergenic
967945328 3:194799438-194799460 ACGGTTTAGTGGAAAGAGCATGG - Intergenic
968562584 4:1292416-1292438 CTGGTGAAGTGGGAAGAGAATGG + Intronic
969118752 4:4891249-4891271 ATTAAGTAGTGAAATGAGAAGGG + Intergenic
969449152 4:7263268-7263290 CTGGTGTAATGGAAGGAAAATGG + Intronic
969741960 4:9035020-9035042 ATGGCCTCGTGGGATGAGAAAGG - Intergenic
969937301 4:10695034-10695056 ATGGAGGAGTGGACTGGGAAAGG + Intergenic
969977132 4:11115104-11115126 ATGGTGTAATGCATTGATAATGG - Intergenic
970170262 4:13282296-13282318 ATGGTGTTTTGGAATCATAAGGG - Intergenic
971080329 4:23202804-23202826 AAGGTGTAGTATAAAGAGAAAGG - Intergenic
971694433 4:29880716-29880738 ATGATGTAGTTATATGAGAATGG + Intergenic
972436294 4:39038739-39038761 ATGGTGTGGAGGGAGGAGAATGG - Intergenic
972958538 4:44422646-44422668 AGGGTATAGTAGAATGAGATAGG + Intronic
973134112 4:46684892-46684914 ATGGTGCCGTGGAATGAGAATGG - Intergenic
973372943 4:49266610-49266632 TTGGTGCAGTGGAATGAGGCTGG + Intergenic
973388056 4:49528449-49528471 TTGGTGCAGTGGAATGAGGCTGG - Intergenic
974107632 4:57488681-57488703 AAGTTGAAGTGGAATGAAAAGGG + Intergenic
975371001 4:73587734-73587756 ATTGTGTAGTAGTATGAAAAAGG + Intronic
975857862 4:78643518-78643540 GTGGTAGAGTGGAATGAGCATGG - Intergenic
976229005 4:82821169-82821191 AAGGTTTAGTGCAATGAGATAGG - Intronic
976358394 4:84147857-84147879 ATGGTATAGAGGAATGACTAGGG + Intergenic
976819122 4:89185093-89185115 ATGATGTAATGGAAAGAGCATGG - Intergenic
977161048 4:93636025-93636047 ATGATGTAGTGCAAGAAGAATGG - Intronic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
978290547 4:107133809-107133831 ATGTTGTAGTGGAAAAATAAAGG - Intronic
979940751 4:126759061-126759083 ATGCTGTCGGGGCATGAGAAAGG + Intergenic
980981146 4:139655516-139655538 AGGGTGGACTGGAAGGAGAAAGG - Intergenic
981249085 4:142577529-142577551 ATGGAGTCGTGGATTGAGACTGG + Intronic
981565044 4:146091837-146091859 CTTGTGTAGTTAAATGAGAATGG - Intergenic
981579517 4:146237802-146237824 ATGGAGTAGGGGCAGGAGAAAGG + Intergenic
982992349 4:162293855-162293877 ATGGTGCAGTGTAATGTTAATGG + Intergenic
983313271 4:166093671-166093693 ATGGCATCGTGGGATGAGAAAGG - Intronic
983459776 4:168013969-168013991 ATTGTGTAGGGAAATGACAAGGG + Intergenic
983698669 4:170564926-170564948 ATGGTGAAATGGAAAGAGCATGG - Intergenic
983819700 4:172178052-172178074 ATGGTGTAATGTAAAGTGAATGG + Intronic
985348170 4:189029107-189029129 ATGATGTATTGGAAAGAGAATGG + Intergenic
985564987 5:611284-611306 ATGGTGTAGGGGAGTGTGTAGGG - Intergenic
986098800 5:4586415-4586437 ATGCTGTCCTGGAATGATAAAGG - Intergenic
987592127 5:19943307-19943329 ATGGTGTAGTGGAATAAAAATGG - Intronic
988057275 5:26114380-26114402 TTGGTGTATTAGAAAGAGAAGGG + Intergenic
989017507 5:36956322-36956344 ATTGTGTGGTGGAATATGAAGGG - Intronic
990219578 5:53573018-53573040 ATAGGGTAGTGGTATGATAATGG + Intronic
991075236 5:62528647-62528669 ATTTTGTAGTGGAATGAGATAGG + Intronic
992018265 5:72597239-72597261 ATGGTGAAATGAGATGAGAAAGG - Intergenic
992025221 5:72663233-72663255 ATGGGGCAGTGCAATGAGAAGGG - Intergenic
992955494 5:81904072-81904094 ATAGTGGAGAGGAAGGAGAATGG - Intergenic
993035058 5:82747484-82747506 AATGTGTGGTGGAATGAGTAGGG - Intergenic
993058734 5:83013627-83013649 GTGGGGTAGTGGAATCACAAAGG + Intergenic
998226878 5:140334036-140334058 TTGGTGGAGGGGAATCAGAAGGG + Exonic
999535571 5:152513149-152513171 ATGGTATACTGGGATGAGAGTGG - Intergenic
999541363 5:152576023-152576045 ATGGTGAGGAGGAATGGGAAGGG + Intergenic
1000063565 5:157676564-157676586 GTGGTGTAGTGGAAATAGATGGG + Intronic
1001278433 5:170367789-170367811 ATGGTGTGGAGGAGTCAGAAAGG - Intronic
1003527363 6:6909498-6909520 AAGGTGGAGTTGAAGGAGAAAGG - Intergenic
1003887492 6:10534539-10534561 GAGGTGGTGTGGAATGAGAACGG - Intronic
1004827602 6:19440390-19440412 ATGGTGTAGTGGAAAGAACATGG - Intergenic
1005211889 6:23475177-23475199 ATGGTGCAATGGGATCAGAAAGG - Intergenic
1005503438 6:26450026-26450048 AACGTGTAGTGAAAGGAGAATGG + Intronic
1005972727 6:30774034-30774056 CTGGAGTAGTGGCATGATAATGG - Intergenic
1007083735 6:39127857-39127879 AAGGTGTAGTGGCATGATGAAGG - Intergenic
1007820250 6:44555696-44555718 ATGGTGGGGTGGAGAGAGAAAGG + Intergenic
1008541753 6:52551922-52551944 ATGCTGTGGGGGACTGAGAAGGG - Intronic
1008600772 6:53091823-53091845 ATGGTCTAGTGGTATAAGAGTGG - Intronic
1008870169 6:56263430-56263452 ATGGAGTAGTGAATGGAGAATGG + Intronic
1009193718 6:60660353-60660375 ATGGCCTCATGGAATGAGAAAGG + Intergenic
1009939165 6:70269212-70269234 CTAGTCTAGTGGAATGGGAAGGG - Intronic
1011201682 6:84843875-84843897 CTGGTGTAGTGGAAAGAGAGTGG - Intergenic
1011781903 6:90799045-90799067 ATGGTGGAATGGAAAGAAAATGG - Intergenic
1011917511 6:92526597-92526619 AGAGTGTAGTGGAATGACAGTGG - Intergenic
1012549259 6:100452851-100452873 TTGGTGTCTTGGAAGGAGAAAGG + Intronic
1013034241 6:106364640-106364662 GTGGTGTGGTGGAATGAGCATGG + Intergenic
1013951901 6:115792795-115792817 ATTGTGTAATAGCATGAGAAAGG + Intergenic
1013959424 6:115881091-115881113 CTGGTGTAGTGGGATGAGGGTGG - Intergenic
1014161834 6:118178584-118178606 ATGGTTTTGTGGAATAAAAAAGG - Intronic
1014406653 6:121060880-121060902 GGGGTGTATTGGAAGGAGAACGG + Intergenic
1014475776 6:121870983-121871005 ATTGTTAAGTGAAATGAGAATGG - Intergenic
1014583667 6:123170285-123170307 ATGGTGAAGTGAAAGGAGCATGG + Intergenic
1015828254 6:137338990-137339012 GTGGTGGAGTGGAAACAGAACGG + Intergenic
1016065343 6:139676925-139676947 ATGGTATGATGTAATGAGAATGG + Intergenic
1016335011 6:142995271-142995293 ATGGTGTACTGGAAAGTGACGGG + Intergenic
1020437181 7:8176929-8176951 GTGGTTTAGTGAAATGAGCAGGG - Intronic
1021109159 7:16674227-16674249 ATGGCATAGGGGAATAAGAAGGG - Intronic
1021459577 7:20871103-20871125 ATGGTGTAGTGCTAGGACAATGG + Intergenic
1022138628 7:27472817-27472839 ATGGTGGTGTAGAAAGAGAAAGG - Intergenic
1022267231 7:28768946-28768968 ATGGTCTGGAAGAATGAGAAAGG - Intronic
1022646069 7:32229521-32229543 AAGGTCTAGTGGAAAAAGAAAGG - Intronic
1022796885 7:33738866-33738888 ATGGTGGGGGGGAATGATAAAGG + Intergenic
1022990710 7:35704522-35704544 ATGGAACAGTGGAAGGAGAAGGG - Intergenic
1024196694 7:47066215-47066237 ATGCTGTAGTGAAAGAAGAATGG - Intergenic
1024788308 7:52933763-52933785 ATGGTGAAGTGGGATGTGAATGG + Intergenic
1024801450 7:53085135-53085157 ATGGTTTAGTTGAATGAAAATGG + Intergenic
1026224246 7:68426741-68426763 ATAGGGGAGTGGAGTGAGAAGGG + Intergenic
1026525512 7:71150109-71150131 ATGGTGAACAGGAATGAGAAGGG - Intronic
1027333460 7:77123273-77123295 ATGGTGCGGTGGAAAGAGCAGGG + Intronic
1027718017 7:81698641-81698663 ATTATATAGTGGCATGAGAAAGG + Intergenic
1028153021 7:87397018-87397040 ATGGTGTGATGAAATGAGAAAGG - Intronic
1028741824 7:94284097-94284119 ATGGAGTAGAGAAATGAAAATGG - Intergenic
1029228122 7:99043452-99043474 ATGCTGTAGTGGAAAGAGTTGGG - Intronic
1029476010 7:100785052-100785074 ATGGTATAGTGGAAAGACCATGG + Intronic
1029782335 7:102748038-102748060 ATGGTGCGGTGGAAAGAGCAGGG - Intergenic
1030856634 7:114565688-114565710 ATGGTGGTGTGGACTGAGGAAGG - Intronic
1031038963 7:116818587-116818609 ATGGTGTAACAGAATGAGATAGG + Intronic
1031328356 7:120431334-120431356 ATGGTCCAGTGGAAAAAGAAAGG + Intronic
1032425445 7:131819005-131819027 ATGGGGCAGGGGAAAGAGAAAGG + Intergenic
1033044586 7:137950151-137950173 ATGGTGTATTGGAAAGAGTGTGG - Intronic
1033143930 7:138854706-138854728 CTGATGTAGTTGGATGAGAATGG - Intronic
1033344052 7:140513493-140513515 ATGGTGTGGAGGCAGGAGAATGG + Intergenic
1033465536 7:141585962-141585984 ATGGTGTAGTGGAAAGAACATGG + Intronic
1034042327 7:147892445-147892467 ATGGTGTAAAGGAATGAGCCAGG + Intronic
1034718747 7:153267751-153267773 ATGGGGTTGTGGAAGGAGTATGG + Intergenic
1035519843 8:266955-266977 ATCCTGCAGTGGAATGTGAAGGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1036918062 8:12824034-12824056 CTGGTGCAGTGTAATGACAAGGG - Intergenic
1037659405 8:20913972-20913994 ATGATGTAGTGGAATGTGCCTGG + Intergenic
1038077386 8:24091605-24091627 CTGGTGAAGTGGAGTGAGCAAGG + Intergenic
1041062299 8:54046229-54046251 ATGGTGTGGTTGACTTAGAATGG - Intergenic
1041517821 8:58721195-58721217 ATGGCTTAGTGGAAGGAGCAAGG + Intergenic
1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG + Intergenic
1042343108 8:67701091-67701113 ATGGTATAGTGGAAAGAGCATGG + Intronic
1042864225 8:73343576-73343598 ATGCTGTAGTAGATGGAGAAGGG + Intergenic
1043084511 8:75811767-75811789 ATAGTGTAGTGGCATGATCATGG + Intergenic
1044112473 8:88292058-88292080 ATTGTGCAATGGAATAAGAATGG - Intronic
1044371431 8:91416111-91416133 ATAATGTGGTGGAATGAAAAGGG - Intergenic
1044377218 8:91489730-91489752 AAGGTGTAGTTGAAGCAGAATGG + Intergenic
1044899732 8:96931393-96931415 ATGGTGTTGTGGAAATAGTAAGG - Intronic
1045054671 8:98358693-98358715 ATGGTTTAGGGGAATGAGGGGGG + Intergenic
1045207526 8:100057378-100057400 ATGGTGTTTTGAAATGTGAAAGG + Intronic
1047220448 8:122914356-122914378 ATGGTGAAGTGGGGGGAGAAAGG + Intronic
1048203162 8:132393819-132393841 GTTCTGTAGTGGAATGAGCAGGG - Intronic
1048590297 8:135815137-135815159 GTGGTTTAGGGAAATGAGAAGGG + Intergenic
1048610425 8:136016329-136016351 ATGGGGTAGTAGCATAAGAAAGG + Intergenic
1048827151 8:138439392-138439414 ATGGTGTAGTGGAATGAGAATGG - Intronic
1048860698 8:138722769-138722791 CTGGTGTAGTGGAAGGAGCCTGG - Intronic
1048912507 8:139149453-139149475 CTGGTGTAGTGGAAAGCCAAAGG + Intergenic
1049010674 8:139884937-139884959 CTGGTGGAGTGCAAGGAGAAAGG + Intronic
1050481453 9:6091660-6091682 ATAGTGCAGTGGTATGAGCATGG + Intergenic
1051023675 9:12578267-12578289 AAGGTATAGTGAAAGGAGAAAGG + Intergenic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051771828 9:20587486-20587508 ATTGTGAAGTGGAAAGAGTAGGG - Intronic
1052078558 9:24175110-24175132 ATGATGCAGTGGAAAGAGCATGG + Intergenic
1052299014 9:26932682-26932704 ATGATGTAGTGGAAGGAGGGGGG + Intronic
1052622678 9:30934510-30934532 ATTGTGTAATGAAATGAAAAGGG - Intergenic
1053453737 9:38214707-38214729 AAGGGGTAGAGGAAGGAGAAGGG + Intergenic
1053905907 9:42844582-42844604 TTGGTGCAGTGGAATGAGGTTGG - Intergenic
1054351938 9:64025394-64025416 TTGGTGCAGTGGAATGAGGCTGG - Intergenic
1054896850 9:70323076-70323098 ATGGTGTAGTGGAAAGAACATGG + Intronic
1055582570 9:77722705-77722727 ACAGTGTAGTGGAATGATCATGG + Intronic
1055803897 9:80071593-80071615 ATCCTTTAGTGGAATTAGAAGGG + Intergenic
1056108070 9:83367245-83367267 ATGGCATAGGGAAATGAGAAGGG + Intronic
1057372497 9:94486944-94486966 TTGGTGCAGTGGAATGAGACTGG - Intergenic
1057396493 9:94685068-94685090 ATAGTTTAGTGGAAAGAGAATGG - Intergenic
1058022926 9:100109581-100109603 AAGTTGTAGTAGAATCAGAATGG - Intronic
1058031869 9:100209055-100209077 ACGGTGTAATAAAATGAGAATGG - Intronic
1058536251 9:105963337-105963359 ATGGTGCAGTGAAAAGAGCAAGG - Intergenic
1058621358 9:106886753-106886775 CTGTTGTAGTGGAATAAGCATGG - Intronic
1058694345 9:107546856-107546878 ATGGTGTACTGGAAAAAGCATGG - Intergenic
1058764341 9:108166709-108166731 ATGGTTCAGGGGAAAGAGAATGG - Intergenic
1059306751 9:113359630-113359652 CTGGTGTAGGGGAATGGGACTGG + Intronic
1060059550 9:120446819-120446841 ATGGTGAAGTGGCATTTGAAGGG - Intronic
1060093359 9:120764563-120764585 CTGGTGTTGTGGAAGGAGCACGG - Exonic
1060254447 9:122014805-122014827 ATGATGTAGTGGAAAGATGACGG + Intronic
1060840955 9:126792878-126792900 ATGGTGTGGTGGGGTGAGAGGGG - Intergenic
1061173045 9:128973145-128973167 GTGGTGCACTGGAATGACAAAGG - Exonic
1203696653 Un_GL000214v1:104635-104657 TTGGTGCAGTGGAATGAGGCTGG + Intergenic
1203552562 Un_KI270743v1:176393-176415 TTGGTGCAGTGGAATGAGGCTGG - Intergenic
1186189189 X:7052571-7052593 ATGGGGTAATGGAAAGAAAAAGG - Intronic
1186598265 X:11007739-11007761 ATGGTGTAGTGAAAGGAGCATGG + Intergenic
1187080794 X:15985044-15985066 ATGGTGGAGGGCAATGGGAAGGG - Intergenic
1187187123 X:16997640-16997662 ATTGTGTTTTGGAAAGAGAAAGG - Intronic
1187229503 X:17407294-17407316 ATGGTTTATAGGGATGAGAAGGG - Intronic
1187260775 X:17683392-17683414 ATGGGGTAGGGGAGTGAGAATGG - Intronic
1188787137 X:34361162-34361184 ATGGTGTAATGGAATGATGTAGG + Intergenic
1190407865 X:50105465-50105487 CTGGTGTAGTAGAAAGAGCATGG + Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1191681728 X:63847642-63847664 GTGGAGGAGTGGAATGAGCACGG + Intergenic
1192195932 X:69028160-69028182 GTGGTGTAGAGGAAGGAGAAAGG + Intergenic
1192499332 X:71639160-71639182 ATGGTCTGGGAGAATGAGAATGG - Intergenic
1192794628 X:74416676-74416698 ATGGCTGAGTGGTATGAGAAAGG + Intergenic
1194538693 X:95142448-95142470 TTGGATTAGTGGAATGAGTAAGG + Intergenic
1195544928 X:106103556-106103578 ATTTTGTAGTGGAGTAAGAAGGG - Intergenic
1195662362 X:107392685-107392707 GTGGTGTAGTGGAAAGTGAGTGG - Intergenic
1195683806 X:107568104-107568126 ATATTGTAGTGAAAAGAGAAAGG + Intronic
1196070385 X:111514746-111514768 CTAGTCTAGTGGAATGAAAAAGG - Intergenic
1196545042 X:116952843-116952865 ATGGTGTAGTGGAAAGATGATGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198777258 X:140193299-140193321 ATGGTGTAATTGAAGGACAACGG + Intergenic
1198966982 X:142237666-142237688 ATGGTGTTTTGAAATGTGAAAGG + Intergenic
1201153826 Y:11111966-11111988 TTGGTGCAGTGGAATGAGGCTGG - Intergenic
1201274816 Y:12287258-12287280 CTCCTATAGTGGAATGAGAAAGG + Intergenic