ID: 1048829128

View in Genome Browser
Species Human (GRCh38)
Location 8:138459050-138459072
Sequence CTGTGGGCTGATTTGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 380}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048829128_1048829137 -8 Left 1048829128 8:138459050-138459072 CCCACCCCCAAATCAGCCCACAG 0: 1
1: 0
2: 6
3: 30
4: 380
Right 1048829137 8:138459065-138459087 GCCCACAGCCAAAGGAACTGGGG No data
1048829128_1048829135 -10 Left 1048829128 8:138459050-138459072 CCCACCCCCAAATCAGCCCACAG 0: 1
1: 0
2: 6
3: 30
4: 380
Right 1048829135 8:138459063-138459085 CAGCCCACAGCCAAAGGAACTGG No data
1048829128_1048829136 -9 Left 1048829128 8:138459050-138459072 CCCACCCCCAAATCAGCCCACAG 0: 1
1: 0
2: 6
3: 30
4: 380
Right 1048829136 8:138459064-138459086 AGCCCACAGCCAAAGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048829128 Original CRISPR CTGTGGGCTGATTTGGGGGT GGG (reversed) Intronic
900338274 1:2175508-2175530 GTGGGGGTTGAGTTGGGGGTTGG - Intronic
900438778 1:2643264-2643286 CTGTTGGCTCATTTCCGGGTGGG + Intronic
900476365 1:2878208-2878230 CTGCTGGCTGTTGTGGGGGTGGG + Intergenic
901105255 1:6750729-6750751 CTGTGGACTAATATGGGAGTTGG + Intergenic
901137260 1:7005977-7005999 CTGTTGGCGGATTTTGGTGTTGG + Intronic
903265202 1:22153947-22153969 GTATGGGCTGATGTGGGGGCAGG + Intergenic
903649909 1:24916128-24916150 CTGTGGGGTGAAGTGGGAGTAGG - Intronic
903776761 1:25798898-25798920 CGGTCGACTGAGTTGGGGGTGGG - Intergenic
904153969 1:28466726-28466748 CTGTGAGCTGGTTTAGGGGGAGG - Exonic
904362283 1:29984049-29984071 CTGTGTGCTTATTTGGGGGCTGG - Intergenic
906682395 1:47738044-47738066 TTTTGAGCTAATTTGGGGGTAGG - Intergenic
906928756 1:50147771-50147793 CAGTGGGAGGATTGGGGGGTGGG + Intronic
907402049 1:54230227-54230249 CTGTGAGCTGCTTTGGTGGGGGG - Intronic
907808568 1:57845296-57845318 GTTGGGGCTGGTTTGGGGGTTGG + Intronic
908074172 1:60495973-60495995 CTGGGGACTGCTGTGGGGGTGGG + Intergenic
910294716 1:85632957-85632979 CTGAGGACTGATTTAGGGGTTGG + Intergenic
911504513 1:98732178-98732200 CAGTGGGCTTATTGGGAGGTAGG + Intronic
911812924 1:102307316-102307338 CTGGGGCCTGTTGTGGGGGTCGG - Intergenic
912382789 1:109256266-109256288 CTGTGGGCTGGTGTCTGGGTGGG + Intronic
913531597 1:119737705-119737727 CAGAGGGCTCATTTGGGAGTAGG - Intronic
913640654 1:120809291-120809313 ATGTGGGGTCATTTGGTGGTAGG + Intronic
914211871 1:145587333-145587355 ATGTGGGGTCATTTGGTGGTAGG - Intergenic
914380616 1:147112779-147112801 CAGTGGGCTGTTATGGGTGTAGG - Intergenic
914431770 1:147625075-147625097 CCGAGGGCTGCTTTGGGGGAGGG + Exonic
914755348 1:150558999-150559021 CTGTGGTCTGCCTTGGGAGTGGG + Exonic
914963868 1:152235072-152235094 CTTTCTGCTGATTTGGGGTTTGG + Intergenic
915563212 1:156699742-156699764 CTCTGGGCTGGTTTGGGGCTAGG + Exonic
915601621 1:156926244-156926266 CTGTGAGATGACCTGGGGGTGGG + Intronic
915607721 1:156963730-156963752 CTGTGCTCTGATTTTGGGGGCGG - Intronic
916748877 1:167705948-167705970 CAGTGTGCTGATTTGGTAGTTGG + Exonic
918942042 1:191013104-191013126 CTGGGGACTGTTGTGGGGGTGGG - Intergenic
919800964 1:201354399-201354421 CCGTGGGCTGACTTGGGGTGAGG - Intergenic
919974806 1:202603425-202603447 CTAGGGGCTGGTGTGGGGGTAGG + Intronic
921606743 1:217165118-217165140 CTGTAGGCTGCTGTTGGGGTGGG - Intergenic
922232114 1:223696556-223696578 CTATGGGCTGATTTGGGCTGTGG - Intergenic
922732556 1:227958712-227958734 ATTTGGGCTGCTTTGGGGTTTGG - Intergenic
922770344 1:228178666-228178688 CTAAGGCCTGATTTGGAGGTGGG - Exonic
923055558 1:230424362-230424384 CTGTGCACTGCTTTGGGGGTGGG - Intronic
924169978 1:241328806-241328828 CTGTAGATTTATTTGGGGGTAGG - Intronic
1064344187 10:14515944-14515966 CTGGGGGCTGTTTTGGGGTGGGG + Intergenic
1064635745 10:17364730-17364752 CTGTGGGCCAAGTTGGGGATAGG + Intronic
1066243101 10:33556772-33556794 CTGTGGGCTGATGAGAGGGGCGG - Intergenic
1067796798 10:49326871-49326893 CTCTGGGTTCATCTGGGGGTGGG - Exonic
1068528333 10:58156607-58156629 CTGGGACCTGTTTTGGGGGTAGG + Intergenic
1069080985 10:64087943-64087965 CAGAGGCCTGATTTGGGGTTGGG + Intergenic
1070406919 10:76105402-76105424 ATGTGGGCTTATTTGGGGGGTGG + Intronic
1070965193 10:80526012-80526034 ATGTGGGTGGAATTGGGGGTTGG - Exonic
1071083089 10:81836453-81836475 CTTTTAGCTGATTTGGGGGGCGG - Intergenic
1071558077 10:86621772-86621794 CTGGGGACTGTTGTGGGGGTGGG + Intergenic
1072428591 10:95351641-95351663 CTTTGGGCTGAGCCGGGGGTAGG - Intronic
1072603833 10:96960207-96960229 CTGTGTGCTTACTTGGGGGTAGG - Intronic
1074360655 10:112822082-112822104 CTGGGGGCAGATTTTGGGTTTGG + Intergenic
1074546920 10:114408413-114408435 TCCTGGGCTGCTTTGGGGGTGGG + Intergenic
1074993347 10:118732182-118732204 CTGTGAGCTGATATGGGGTTGGG + Intronic
1075225202 10:120622596-120622618 CTGTGGCCTTATTTGGGGGAAGG - Intergenic
1075280681 10:121135667-121135689 CTGTGGGCGGAGTGTGGGGTGGG + Intergenic
1075838082 10:125473369-125473391 TGGTTGGGTGATTTGGGGGTGGG + Intergenic
1077102405 11:828020-828042 CTGTGGGCTCAGTTGTGGGGAGG + Intronic
1077191960 11:1259341-1259363 CTGTGGGCTCACCTGGGGGCAGG - Intronic
1077730138 11:4721777-4721799 TTGTGAGCTGACTTGGGGTTGGG + Intronic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1078353889 11:10618941-10618963 GTGTGAGCTGGGTTGGGGGTTGG + Intronic
1079460595 11:20674728-20674750 CTGTGTTCTCATTTGGGGGTGGG + Intronic
1081767852 11:45624351-45624373 GGGTGGCCTGACTTGGGGGTGGG - Intergenic
1082809238 11:57468600-57468622 ATGTGGGCAGACTTGAGGGTGGG - Intronic
1083007214 11:59357955-59357977 TTTTGGGTTTATTTGGGGGTGGG - Intergenic
1083366530 11:62144906-62144928 CTGTGGGCAGCTTTTGGGGCTGG + Intronic
1084145932 11:67265464-67265486 CTATGAGCTGGTTGGGGGGTGGG + Intergenic
1085318422 11:75560012-75560034 CTGAGGGCCAATGTGGGGGTGGG + Intergenic
1085856628 11:80182665-80182687 CAGTGGGATCATTTGGGGGATGG - Intergenic
1086886031 11:92206625-92206647 CTGAGGGCAGATTTGGGGAGGGG + Intergenic
1087147327 11:94825161-94825183 CTGTGGGCTGTTGAGTGGGTTGG + Intronic
1087180458 11:95136760-95136782 CTGGGGCCTGTTGTGGGGGTGGG - Intergenic
1087721865 11:101674820-101674842 CAGAGTGCTGTTTTGGGGGTTGG + Intronic
1088339924 11:108752396-108752418 CTGTGGGATGAATTGGGTGGAGG + Intronic
1089735577 11:120548284-120548306 CTGAATTCTGATTTGGGGGTGGG + Intronic
1090430144 11:126639109-126639131 CTTTGGGATGATTGGGGGGCTGG - Intronic
1090796786 11:130142109-130142131 CTGTGGGCTGGGTTGGGGGTGGG + Intronic
1091154256 11:133358981-133359003 ATGAGGGATGATTTGGGGGAGGG + Intronic
1091223403 11:133944151-133944173 CTGAGGGCTGTTTCCGGGGTGGG - Intronic
1092902995 12:13077087-13077109 CTGTCCACTGATTGGGGGGTGGG + Intronic
1092914730 12:13179648-13179670 TTGTGGCCTGATTTGGGTGGTGG + Intergenic
1093149758 12:15606874-15606896 CTGTGAGATGATGTGGGAGTAGG + Intergenic
1094486984 12:30933332-30933354 CAGTGTCCTGGTTTGGGGGTTGG - Intronic
1094781303 12:33795195-33795217 CTGCTGGCACATTTGGGGGTGGG - Intergenic
1096781142 12:53992791-53992813 CTGCGGGCGGAGTTGGGGGGGGG + Intronic
1096785978 12:54017633-54017655 CTGTGTGCCAAGTTGGGGGTGGG + Intronic
1097540417 12:60936069-60936091 CTGTGGAGTGTTTTGGGGGATGG + Intergenic
1097896810 12:64832710-64832732 CTGAAGGCTCAATTGGGGGTGGG + Intronic
1098735194 12:74092513-74092535 CTGGGGGCTGTTGTGGGGTTGGG + Intergenic
1102870447 12:116410002-116410024 CTGTGGGCTGCTCTGGGGGTGGG + Intergenic
1103716618 12:122948940-122948962 CTGTGGGCGGGGTTGGGGGGTGG + Intronic
1103884806 12:124192322-124192344 CTGTAGGCTGGGCTGGGGGTGGG + Intronic
1103929991 12:124445043-124445065 CTGCTGCCTCATTTGGGGGTCGG - Intronic
1104463662 12:128973706-128973728 CTCTGGTGTGCTTTGGGGGTTGG - Intronic
1104712242 12:130995135-130995157 CTGTGGGAAGAGTTGGTGGTGGG + Intronic
1104803885 12:131572586-131572608 CTATGGGCAGCTTTGGGAGTTGG + Intergenic
1106083581 13:26520885-26520907 CTGTGGGCTCATGTAGTGGTGGG + Intergenic
1106421841 13:29591782-29591804 CTGGGGGTTTATTTGGAGGTGGG - Intronic
1106819851 13:33452330-33452352 CTGGGGGCAGTTGTGGGGGTGGG + Intergenic
1108497898 13:51043209-51043231 CTGGGGCCTGTTGTGGGGGTCGG - Intergenic
1109788890 13:67221695-67221717 CTGTGTGGTTTTTTGGGGGTGGG - Intronic
1110119891 13:71867045-71867067 TCGAGGGCTGGTTTGGGGGTGGG + Intronic
1110405033 13:75141315-75141337 CTTTGTGCTGATGTGGGTGTGGG - Intergenic
1110518401 13:76444192-76444214 CTGGGGACTGTTTTGGGGTTGGG + Intergenic
1110769118 13:79316871-79316893 CTGCAGGCTGAGTTGGGAGTTGG - Intronic
1111580794 13:90220646-90220668 CTGGGGCCTGTTGTGGGGGTGGG + Intergenic
1112924004 13:104650706-104650728 CTGTGGGCTGGTTTAGAGGCAGG + Intergenic
1113380018 13:109795806-109795828 CTTGGTGATGATTTGGGGGTAGG + Intergenic
1113601962 13:111575840-111575862 CTGTGTCCTCATATGGGGGTAGG + Intergenic
1113874785 13:113587326-113587348 TTGTGATCTGAGTTGGGGGTTGG + Intronic
1114411221 14:22502246-22502268 CCGTAAGCTGATTTGGGGATTGG + Intergenic
1115374994 14:32665099-32665121 CTGTGACCATATTTGGGGGTGGG + Intronic
1115755702 14:36524632-36524654 CTGTGGGCAGGCTGGGGGGTGGG + Intergenic
1116603080 14:46952758-46952780 ATGTGTGATGATTTGGGGGAAGG + Intronic
1117178559 14:53169689-53169711 ATGGATGCTGATTTGGGGGTTGG - Intergenic
1117375143 14:55112691-55112713 TTGTGTGCTGGTTTGGGGATGGG + Intergenic
1118761074 14:68880372-68880394 AGGAGGGCAGATTTGGGGGTAGG + Intronic
1119739368 14:77004207-77004229 CTGCCTGCTGAGTTGGGGGTTGG + Intergenic
1119944274 14:78675254-78675276 CTGGGGGCTGATTTGCATGTGGG - Intronic
1121413721 14:93764432-93764454 CTGTGGACAGCTTTGGGGGCGGG - Intronic
1121552832 14:94815213-94815235 CTGTTGGCTGACTTTGGGGGTGG - Intergenic
1122224416 14:100265449-100265471 CTGTGTGCTCAGTTGGGGGCAGG + Intronic
1122237510 14:100340261-100340283 TGGAGGGCTGACTTGGGGGTGGG + Intronic
1122603690 14:102933761-102933783 CTGTGGGGGGAGTTGGGGCTCGG + Exonic
1128090008 15:64912813-64912835 CTGAGGGATGTGTTGGGGGTGGG + Intronic
1129166103 15:73778842-73778864 CTTTGGCCTGAATTGGGGCTTGG + Intergenic
1129227233 15:74177076-74177098 CTGTGGGATGGTTTGGAGGAAGG - Intergenic
1129914008 15:79252304-79252326 CCTGGGGCTGATTTGGGAGTGGG - Intergenic
1130841441 15:87704688-87704710 ATTTGAGCTGCTTTGGGGGTTGG - Intergenic
1131652369 15:94414763-94414785 GTGTGGCATGTTTTGGGGGTTGG + Intronic
1131828875 15:96341799-96341821 CGGAGGGTTGATTGGGGGGTGGG + Intergenic
1132649713 16:1014922-1014944 CTCTGAGCAGATGTGGGGGTGGG - Intergenic
1134716056 16:16358476-16358498 CAGTGGGCTGCTGTGAGGGTGGG + Intergenic
1134811003 16:17166896-17166918 CTGGGGGGTGATTTGGGGGAAGG + Intronic
1134958700 16:18393683-18393705 CAGTGGGCTGCTGTGAGGGTGGG - Intergenic
1135135303 16:19882809-19882831 CTGTAGGCAGATTTGGGGGTGGG - Intronic
1136067347 16:27768073-27768095 CAGTGGGATGAGGTGGGGGTGGG + Intronic
1136170968 16:28489230-28489252 CTGTGGGAAGATGAGGGGGTGGG - Intronic
1139842259 16:69891060-69891082 CTGTGGGCTGACTCGGGGCCTGG + Intronic
1139850780 16:69950749-69950771 CTGTGGGCTCAAAGGGGGGTGGG - Intronic
1139879764 16:70173661-70173683 CTGTGGGCTCAAAGGGGGGTGGG - Intronic
1140372760 16:74421887-74421909 CTGTGGGCTCAAAGGGGGGTGGG + Intronic
1140932872 16:79643994-79644016 CTCTGGGGTCTTTTGGGGGTGGG + Intergenic
1142244913 16:88965955-88965977 CTGTGGGCTGATGTCAGGGGAGG + Intronic
1143121380 17:4609367-4609389 CTGTGGTCTTTGTTGGGGGTGGG + Intergenic
1143477095 17:7208961-7208983 CTGTGGGCTGTTGCAGGGGTAGG - Intronic
1143579711 17:7818393-7818415 CTCTGGGCTGTAGTGGGGGTTGG - Exonic
1143975927 17:10829546-10829568 CCTTGGCCTGATGTGGGGGTTGG - Intronic
1146009099 17:29179998-29180020 GTGTGGGGGGATTTGGGGCTTGG - Intronic
1146667595 17:34715394-34715416 CTGGGGGCTGTGTTGGTGGTTGG - Intergenic
1147159181 17:38560687-38560709 CTGTGGAATGGTTTGGGGGAGGG - Intronic
1147424093 17:40337505-40337527 CAGCGGGCAGATTTGGGGGTGGG - Intronic
1147647364 17:42041771-42041793 CTATGGGCTGGGTTGGAGGTGGG - Intronic
1148495646 17:48052013-48052035 CTGTGTTCTGATGTGGGGGGAGG - Intronic
1151968663 17:77445687-77445709 CAGTTGGCTGAGTTGGAGGTGGG + Intronic
1153051368 18:905767-905789 CTGTGGGCCGGGTTGGGGGAGGG - Intronic
1153301724 18:3597619-3597641 CAATGGGCTGCTTTGGGGGAGGG - Intronic
1153597394 18:6741775-6741797 ATGTGGGCAGGGTTGGGGGTAGG - Intronic
1155986753 18:32238327-32238349 TTGTGGGCTGCTTTGTAGGTTGG - Intronic
1157499669 18:48180586-48180608 CTGTAGGGTGATGGGGGGGTGGG + Intronic
1157518289 18:48327021-48327043 TTCTGGGCTGATGTGAGGGTGGG - Intronic
1158522065 18:58179918-58179940 CTCCAGGCTGGTTTGGGGGTTGG - Intronic
1159005398 18:63005735-63005757 CTGTGGGGTGATTTGGTATTTGG - Intergenic
1159082289 18:63748916-63748938 CTGGGGCCTGTTTGGGGGGTGGG + Intergenic
1159431225 18:68356310-68356332 AGGTGGGCTGAGTGGGGGGTGGG + Intergenic
1161149982 19:2702540-2702562 CTGCGGACCGAGTTGGGGGTCGG - Intronic
1161351955 19:3798354-3798376 CTGTGGGGTGGTTGGCGGGTGGG + Intronic
1161582653 19:5089210-5089232 CTGAGAGCTGATCTGGGGGAAGG - Intronic
1162064602 19:8117347-8117369 GAGGGGGCTGGTTTGGGGGTGGG + Intronic
1162338008 19:10073486-10073508 CTGAGGGCTGGGTTGAGGGTAGG - Intergenic
1163188035 19:15653438-15653460 CTGTGCACAGATGTGGGGGTTGG - Intronic
1163492274 19:17623783-17623805 CTGTGGGCACATTAGGGAGTGGG - Intronic
1163575469 19:18108828-18108850 CTTTTGCCTGAGTTGGGGGTGGG + Intronic
1163597910 19:18231184-18231206 CTCTGTGCTGATATGAGGGTAGG - Intronic
1163625366 19:18386492-18386514 ATGGGGGCTGCTTGGGGGGTGGG - Intronic
1163860091 19:19738216-19738238 CTGTGGGCTGAGTTTGGGCGGGG + Intergenic
1165353964 19:35292345-35292367 CTTGGGGCTGCTTTGGGGATGGG + Intronic
1165901749 19:39172560-39172582 CTCGGGGCTGATTATGGGGTGGG + Intronic
1165948425 19:39458923-39458945 CTGTGGGGAGATTTGGGAGTAGG + Intronic
1166701407 19:44884012-44884034 GGGTGGGCTGAGGTGGGGGTGGG + Intronic
1166803920 19:45473740-45473762 CTGGGGGCTGATTTCGGGGTGGG - Exonic
1167477387 19:49708971-49708993 ATATGGCCTGATTTGGGGGTGGG - Intronic
1168123848 19:54271973-54271995 TTGAGCTCTGATTTGGGGGTGGG + Intronic
925769752 2:7270321-7270343 CTGTGGGTTGATTTGCGGGGAGG - Intergenic
926368372 2:12154719-12154741 CTGTGTGCTGGTTTTGGTGTGGG + Intergenic
927554262 2:24021494-24021516 CTGTGGGGTGATTGGGAGGTGGG + Intronic
927673768 2:25089939-25089961 CTCTGGGGTGATTTGGGTTTGGG - Intronic
930098028 2:47581872-47581894 CTGTGAGGTCATTTGGGGCTGGG + Intergenic
931629251 2:64284738-64284760 CTGGGGGCTGCTCTTGGGGTAGG - Intergenic
931866388 2:66416698-66416720 CTGTGGACTGAGATGAGGGTAGG + Intergenic
932579279 2:72983063-72983085 CTGTGCTCTGACCTGGGGGTAGG + Intronic
932752043 2:74377412-74377434 CTGGTGAGTGATTTGGGGGTGGG - Exonic
932824303 2:74925711-74925733 TTGTGGGCTTATTTGGTGGCTGG + Intergenic
933698324 2:85236676-85236698 CTGGGGGCTGTGTTGGGGGCAGG + Intronic
933969822 2:87461253-87461275 CTGAGGGCTGACTTGGGGCCAGG - Intergenic
934301805 2:91780920-91780942 GTGTGGGCAGGTGTGGGGGTTGG + Intergenic
935367519 2:102309958-102309980 CTGTGTGTTGAGGTGGGGGTGGG + Intergenic
935569677 2:104645924-104645946 CTGTGGCCTGTTGTGGGGTTGGG + Intergenic
936323959 2:111489244-111489266 CTGAGGGCTGACTTGGGGCCAGG + Intergenic
937858033 2:126686835-126686857 CTGCGGGCAGCCTTGGGGGTGGG - Intronic
938119637 2:128624458-128624480 CTGTGGCCTGAGGTGGGGGGGGG + Intergenic
939313835 2:140520442-140520464 CTGGGGTCTGTTTTGGGGTTGGG + Intronic
939380174 2:141425073-141425095 CTGTGGCCTGTTGTGGGGTTGGG - Intronic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
942277517 2:174334010-174334032 CTGTGGGCTGGCATGGGGGTGGG - Intergenic
942470210 2:176252108-176252130 CTGTGGCATGATTTGGAGTTGGG + Intergenic
943363374 2:186946997-186947019 CTGTGGAGTGATGTGGGTGTTGG - Intergenic
944026949 2:195181892-195181914 CTGGGGACTGTTGTGGGGGTGGG - Intergenic
944656840 2:201883929-201883951 CTGTTTAATGATTTGGGGGTGGG + Intronic
945653390 2:212592845-212592867 CTGTTGGTTGATTTGTTGGTTGG - Intergenic
946144325 2:217717668-217717690 CTGTGGGCTGATGGAGGGGGAGG - Intronic
946204012 2:218090196-218090218 CTGTGGGCAGAGTAGGGTGTGGG + Exonic
947310897 2:228800570-228800592 GTGTGGTCTGATATGGTGGTGGG - Intergenic
948043287 2:234921935-234921957 CTGTGTATTGATTTGGGGGGAGG + Intergenic
948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG + Intronic
948272847 2:236687534-236687556 CTGGGGGCTGCTGTGGGGCTGGG - Intergenic
948375860 2:237519812-237519834 CTGGGGGCTGAGTGTGGGGTTGG + Intronic
948439711 2:237978888-237978910 CTGAGGGGTGTTTGGGGGGTAGG - Intronic
1168752030 20:289522-289544 CTGGGAGCTGGTGTGGGGGTTGG - Intronic
1168813610 20:721936-721958 CTGGGGGCTATTTTAGGGGTTGG - Intergenic
1169971052 20:11270013-11270035 ATGTGGGGTGAGTGGGGGGTAGG - Intergenic
1170020616 20:11833331-11833353 CTGTTGGCTGATCTGAGTGTTGG + Intergenic
1170696558 20:18664588-18664610 ATGGGGGCTGATTTGGGGAATGG + Intronic
1171372699 20:24671892-24671914 CTGAGGGCTGAATTGGCGGAAGG + Intergenic
1172774145 20:37397520-37397542 CTGTGGGCCTGTGTGGGGGTGGG + Intronic
1172888394 20:38246888-38246910 CTGAGGGCTGATTGTGGGTTGGG - Intronic
1173256800 20:41399569-41399591 GTGGGGGCTGTTTTGGGGCTGGG - Intergenic
1174042413 20:47709259-47709281 CTGGGGGCTGGCGTGGGGGTGGG + Intronic
1174094126 20:48074390-48074412 CTGGGGCCTGTTGTGGGGGTGGG - Intergenic
1174421336 20:50400961-50400983 CTGGGGCCTGTTGTGGGGGTGGG + Intergenic
1175242794 20:57562156-57562178 CTGAGGCCTGTTTTGGGGATGGG - Exonic
1179562151 21:42222398-42222420 CTGTTGGCTTATTTGGGGATGGG + Intronic
1179632441 21:42686909-42686931 CTATGGGGTGATGTGGGGCTGGG - Intronic
1180247029 21:46555115-46555137 CTGTGGGCTGAGTGGAGCGTGGG - Intronic
1180668795 22:17536551-17536573 CTGCTGCCTGATCTGGGGGTGGG + Intronic
1181351449 22:22261465-22261487 CTGGCGGGTGATTTGGGGGCAGG - Intergenic
1181889760 22:26052198-26052220 TTGTTGGCTGTTTTGTGGGTTGG + Intergenic
1182184406 22:28386997-28387019 CTGGGGCCTGTTTTGGGGGTGGG - Intronic
1183045469 22:35216111-35216133 CTGTGGGCAGATTTGGTGTTTGG + Intergenic
1183959400 22:41402257-41402279 CTGAGGGCTGGCTGGGGGGTTGG - Intergenic
1184513340 22:44945703-44945725 CTGTTGGCAGAATTGGGGGGGGG + Intronic
1184803016 22:46774047-46774069 CTGTGGGCTGGCTTGGGTGGAGG + Intronic
1184804144 22:46781608-46781630 CTGAGGGCTGTTTTTGGGGAGGG + Intronic
1184922784 22:47617043-47617065 CTGTGGCCTGATTTGGAAGCAGG - Intergenic
1185204847 22:49531970-49531992 CTGTGGCCTGACTTGGAAGTAGG + Intronic
1185259748 22:49854589-49854611 CTGCGAGCTCATTTGGGTGTAGG - Intronic
1185392272 22:50569016-50569038 CTGTGGTCTGAGCTGGGGGAGGG + Exonic
950785551 3:15431336-15431358 CTGTGAGCAGATCTGGAGGTTGG + Intronic
951129271 3:19022732-19022754 CTGTGGGTTATTTTGAGGGTTGG + Intergenic
951537213 3:23751041-23751063 CTAAGGGCTGATTCGGGTGTGGG - Intergenic
952250477 3:31648482-31648504 CTGTGGAATGCTTTGGTGGTAGG - Intergenic
952543266 3:34390810-34390832 CTGTGTGGAGATTTGGGAGTGGG - Intergenic
953015401 3:39070836-39070858 CTGGGGACTGTTGTGGGGGTGGG - Intronic
953395032 3:42562315-42562337 CTGTGAGTTGATTTGGAGCTCGG - Intronic
953751383 3:45611249-45611271 CAGTGGGCTCACTTGGTGGTTGG - Intronic
954580894 3:51702439-51702461 CTGGGGGCTGAGTGGGTGGTGGG + Intronic
954636378 3:52073109-52073131 CTGAGGGCAGAGCTGGGGGTGGG - Intergenic
955063718 3:55516535-55516557 CTGGGGGCTGGGATGGGGGTGGG + Intronic
955136023 3:56218986-56219008 TTGTGGGGTGGTTTGGGGGGAGG + Intronic
956049437 3:65231640-65231662 CTGTGGTCTAATTTGGGGCCTGG + Intergenic
957253968 3:77812696-77812718 CTGTCCCCTGATTTGGGGTTTGG - Intergenic
957306323 3:78462927-78462949 CTGTTGGCTGGGTGGGGGGTTGG - Intergenic
959938170 3:112052147-112052169 CTATAGCCTGAGTTGGGGGTGGG + Intronic
960677869 3:120214470-120214492 ATGCTGACTGATTTGGGGGTGGG + Intronic
960966725 3:123110779-123110801 CTGGCAGCTGATTTGCGGGTGGG - Intronic
961649781 3:128411531-128411553 CTGTGGGCTGATGGGTGGGGTGG + Intergenic
961737923 3:129013953-129013975 ATGTGCTCTGAGTTGGGGGTGGG + Intronic
961826474 3:129601790-129601812 CTCTGGACAGATTTGGGGGCTGG - Intronic
962273783 3:133997177-133997199 CTGGGGGCTGCTTTTGGGGCTGG - Intronic
965042726 3:163531841-163531863 CAGGGGGCTGATTTGTAGGTTGG - Intergenic
967291301 3:187923134-187923156 ATGTGGGATGCTGTGGGGGTAGG + Intergenic
968624167 4:1619055-1619077 ATGTGGGCTGCTTTGGGGTGGGG - Intronic
969082212 4:4627532-4627554 CTTTGTGCTGTTTTGCGGGTTGG + Intergenic
969428078 4:7137635-7137657 GTGTGGGCTGCGGTGGGGGTGGG - Intergenic
969454604 4:7294241-7294263 CTGTGGGCAGATTTGGGGTGGGG + Intronic
969841770 4:9888103-9888125 CTGGGGCCTGTTTTGGGGGGTGG + Intronic
970170820 4:13288431-13288453 CTGTGGTCTGATATTGTGGTTGG + Intergenic
974229667 4:59093218-59093240 CTGTGGCCTGACATGGGGATGGG + Intergenic
974749302 4:66115772-66115794 CTGGGGCCTGTTTGGGGGGTGGG + Intergenic
976350543 4:84055388-84055410 CAGTGGGCTAATATGGGGCTAGG + Intergenic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978042390 4:104084091-104084113 TTGTGTGCAGATTTGGGGGATGG + Intergenic
979976735 4:127206271-127206293 CTCTGGGCTGATAAGGGGATAGG - Intergenic
980087217 4:128403757-128403779 CTCTGGGCTGTTGTGGGGGTGGG - Intergenic
981271105 4:142847338-142847360 CTGTGGGCTTGTTAGGGGCTAGG - Intronic
981529035 4:145734395-145734417 CTGCGGCCTAATTTGGGGATGGG + Intronic
982187815 4:152820131-152820153 CTGAGGTCTTCTTTGGGGGTGGG - Intronic
982220017 4:153116281-153116303 AGGTGGGCTGATTTGGGAGGTGG - Intergenic
983504080 4:168533642-168533664 CTGTGGTCTGAAATGGGGGCTGG + Intronic
984610822 4:181834767-181834789 TTGGGGACAGATTTGGGGGTTGG + Intergenic
984632854 4:182078720-182078742 GTGTGGCCTGAGCTGGGGGTGGG + Intergenic
985427509 4:189845019-189845041 CTGTGGGATGTTTTGGGGGTTGG - Intergenic
985699362 5:1361238-1361260 CAGTGGGCTCATTGGGGGGTGGG + Intergenic
985795019 5:1955853-1955875 CTGTGGGGTCATTTGGTGGATGG + Intergenic
985795122 5:1956335-1956357 CTGTGGGGTCATTTGGTGGATGG + Intergenic
986049697 5:4077140-4077162 CTCTGTGCTGACTTGGGGGAGGG + Intergenic
986444776 5:7811737-7811759 CTAGGGTCTGATTTGGGGGAAGG - Intronic
989720152 5:44517438-44517460 CTGTGCGCTATTTGGGGGGTGGG + Intergenic
991453245 5:66775294-66775316 CAGTGGGCTGAGTTGGGGGAAGG - Intronic
992379428 5:76222442-76222464 GTTTGGGATGATTGGGGGGTGGG + Intronic
992970282 5:82049385-82049407 CTGGGGACTGTTGTGGGGGTGGG + Intronic
994299304 5:98127365-98127387 CTGGGGCCTGTTGTGGGGGTAGG + Intergenic
994347201 5:98700844-98700866 CTGTGGGCTGTATGGGGGCTGGG + Intergenic
994702992 5:103161113-103161135 CTGGGGCCTGTTGTGGGGGTGGG - Intronic
997559552 5:134834489-134834511 CTGAGGGCTGGTTTGGGGATAGG - Intronic
998386521 5:141760241-141760263 CGGTGGGCTGAGATGGGAGTAGG + Intergenic
998945713 5:147337450-147337472 GTTTGGGTTGTTTTGGGGGTGGG + Intronic
999311522 5:150554819-150554841 CTCTGGGCTGATTTCTGGTTGGG + Exonic
999359486 5:150970953-150970975 TTGAGGGGTGAGTTGGGGGTAGG + Intergenic
1001281377 5:170388845-170388867 CTGGGGGCTGATTTGGGGCTAGG - Intronic
1001923091 5:175616193-175616215 CTGTGTGCTGATGAGGGTGTGGG - Intergenic
1002370292 5:178746894-178746916 CTGGGGCCTGTTTTGGGGGGAGG - Intergenic
1002570740 5:180137980-180138002 CTGTGGGCTCGGTGGGGGGTGGG + Exonic
1003355437 6:5365097-5365119 CTGTGGGCAGATTTGGCCCTTGG + Intronic
1003773514 6:9334737-9334759 CTGGGGTCTGGTTGGGGGGTAGG - Intergenic
1005230595 6:23697543-23697565 CTTTGGGACGATTTAGGGGTGGG - Intergenic
1005394487 6:25367384-25367406 CTTGGGGCTGATTTGGGGTTTGG + Intronic
1006360611 6:33585179-33585201 CAGGGGGCTGAGTTGTGGGTGGG - Intergenic
1007282131 6:40720520-40720542 CTGTGGGTGGAGTTGGGGGAGGG - Intergenic
1007589462 6:43012679-43012701 CTCTGGGTTGATTCGGGGATTGG - Intronic
1007772163 6:44200844-44200866 CTGTCAGCTGAGTGGGGGGTGGG + Intergenic
1008724907 6:54405975-54405997 CTGGGGGCTGTTGTGGGGTTGGG - Intergenic
1009795489 6:68461704-68461726 CTGTGGACTGTTGTGGGGTTGGG - Intergenic
1012472779 6:99589681-99589703 CTGTGGGCAAATTCAGGGGTGGG + Intergenic
1014877551 6:126679395-126679417 CTGGGGACTGCTTTGGGGTTTGG + Intergenic
1017202681 6:151773036-151773058 ATGTGGCCTTATTTGGAGGTGGG + Intronic
1018035406 6:159877281-159877303 CAGTGGGCTGGTTTGGGGTCTGG + Intergenic
1018378176 6:163232892-163232914 CTGAGGGCTGGTTTCGGGGGTGG - Intronic
1018971264 6:168531059-168531081 CTGTGGGAGGATTTGTGGTTGGG - Intronic
1019013142 6:168859074-168859096 CTCTGGGCAAATTTGTGGGTGGG + Intergenic
1019328365 7:450789-450811 CTGTGGGTGGGTTGGGGGGTGGG - Intergenic
1019417572 7:934464-934486 CTGGGGGCTGCTGTGGGGATGGG - Intronic
1021092952 7:16504422-16504444 AGGTGGGCTGATCTGGTGGTGGG + Intronic
1021952412 7:25788160-25788182 CTGTGGGCTGGTCTGGGGTCTGG - Intergenic
1022629334 7:32070731-32070753 CTGTGGCTTTGTTTGGGGGTAGG - Intronic
1024929915 7:54658952-54658974 CTGTGGCCTGATTTGGAGCAGGG + Intergenic
1026962676 7:74418395-74418417 CTGAGGCCTGAGCTGGGGGTGGG - Intergenic
1027328973 7:77071290-77071312 CTCTGGGCTGGTACGGGGGTTGG + Intergenic
1027696772 7:81421677-81421699 CTGGGGACTGTTTTTGGGGTGGG - Intergenic
1028713811 7:93941031-93941053 CTGTGAGCTGATTAGGAGGAAGG - Intergenic
1029535248 7:101154223-101154245 CTGTGGGCTGGTTGGAGGATGGG - Intergenic
1029778067 7:102699498-102699520 CTGTGGGGTGTTTTGGGTTTGGG + Intergenic
1031469960 7:122156974-122156996 TTGTGGGCGGAGTTGGGGGGTGG + Intergenic
1031796913 7:126186343-126186365 CTGTGGGCTGCATGGGAGGTGGG - Intergenic
1032567830 7:132966364-132966386 CTGTGTCCTGATTTGGCGATGGG - Intronic
1033763555 7:144463191-144463213 CTGTGGGATGGTTTTGGGGCAGG - Intronic
1033980766 7:147162601-147162623 CTGTGGTTTGATTTCTGGGTGGG - Intronic
1036184730 8:6613461-6613483 CTGTGTGCTGGTTTAGGGGCTGG + Intronic
1036736774 8:11325978-11326000 TTGAGGCCTGATTTAGGGGTGGG + Exonic
1037505861 8:19528638-19528660 TGGTTGGATGATTTGGGGGTGGG - Intronic
1037894716 8:22644231-22644253 CTGTGGGCTTAAAGGGGGGTGGG + Intronic
1038454518 8:27663953-27663975 TTGTGGGCTGATTTGGACTTTGG - Intronic
1039232850 8:35467718-35467740 CTTTGGGCAGATGTTGGGGTAGG + Intronic
1039593305 8:38768770-38768792 CTGTGGGCTTATGTGAGAGTTGG + Intronic
1040447914 8:47514804-47514826 ATGTGTGCTGTTTTGGGTGTTGG - Intronic
1040669640 8:49673914-49673936 GTGGGGGCTGTTGTGGGGGTAGG + Intergenic
1041391553 8:57351406-57351428 CTGTGGCCTGAGCTGTGGGTGGG + Intergenic
1041713684 8:60914735-60914757 CTAGGGGCTGAGGTGGGGGTGGG + Intergenic
1041755580 8:61309770-61309792 CTGTGGTGTGATTTGGCAGTGGG + Intronic
1042022803 8:64387843-64387865 CTGTGGGCATATTTTGGGATAGG - Intergenic
1042024719 8:64410908-64410930 CTGTGAGCTGAATTGGTGGTGGG + Intergenic
1042282461 8:67069049-67069071 GTGTTGGGTGATTTGGGGGAAGG - Intronic
1042837637 8:73092624-73092646 CTCTGGTCTGTCTTGGGGGTGGG + Intronic
1043435923 8:80236404-80236426 CTGAGGGCTCATTTTGGGGAGGG - Intergenic
1043991006 8:86754536-86754558 CTGGGGTCTGTTGTGGGGGTGGG - Intergenic
1044150248 8:88767564-88767586 CTGTGGGGTGAGTTGGGTTTTGG + Intergenic
1045324561 8:101108814-101108836 CCTTGGGCTGAGTTGGGGGCTGG - Intergenic
1045473585 8:102534898-102534920 CTGGGGTATGAGTTGGGGGTGGG - Intronic
1045627729 8:104075917-104075939 CTGTGGCCTGGTTTGGGGCCAGG - Intronic
1048336733 8:133508019-133508041 CTGTGGGCTGCCTAGGGTGTGGG - Intronic
1048478806 8:134769181-134769203 CTGTGGCCTTTTTTGGGGGGTGG - Intergenic
1048829128 8:138459050-138459072 CTGTGGGCTGATTTGGGGGTGGG - Intronic
1048909425 8:139120418-139120440 CTGTGGAGTGATATGAGGGTTGG + Intergenic
1049023120 8:139971105-139971127 CTGGGTGCTGATCTCGGGGTGGG - Intronic
1049518972 8:143078729-143078751 ATCAGGGCTGTTTTGGGGGTGGG - Intergenic
1049579842 8:143406344-143406366 CTGTGGGTAGAGGTGGGGGTGGG - Intergenic
1049835542 8:144733367-144733389 CTGTGGTCTGCTTTAGAGGTGGG - Intronic
1050839723 9:10133169-10133191 GTGTGGGCAGATTTTGGGGATGG + Intronic
1051746412 9:20298990-20299012 CTGAGAGATGGTTTGGGGGTCGG + Intergenic
1052938052 9:34109811-34109833 GTGTGGGCAGCTTTAGGGGTCGG + Intronic
1053122147 9:35555451-35555473 CTGTGGGCTGCTCTGGGGGAGGG - Exonic
1053279148 9:36806121-36806143 CTGTGGCCTCCTGTGGGGGTAGG - Intergenic
1053728519 9:41028318-41028340 GTGTGGGTTGGTGTGGGGGTAGG - Intergenic
1054699985 9:68403762-68403784 GTGTGGGTTGGTGTGGGGGTAGG + Intronic
1055388083 9:75786154-75786176 CTGTGGTCTGAGATGGTGGTTGG + Intergenic
1056595927 9:88007540-88007562 CTGCGGGAAGAGTTGGGGGTCGG - Intergenic
1056718707 9:89055244-89055266 CTCTGGGCTTATTTGGGGAGAGG - Intronic
1057389505 9:94630939-94630961 GTGTGGGTTGATCTGGGGATTGG + Intronic
1058628413 9:106959887-106959909 CTGTGGGGTGAGTTTGGAGTGGG + Intronic
1062248828 9:135584128-135584150 CTGGGGGCTGATTCTGGGGAAGG + Intergenic
1062310545 9:135933546-135933568 CTGTGGGCTGAGTGGGGGCGTGG - Intronic
1062405770 9:136395544-136395566 CTGTGGGGGGCTCTGGGGGTGGG + Intronic
1062448125 9:136604274-136604296 CTAAGCGCTGATTTGGGGGATGG - Intergenic
1185621548 X:1453585-1453607 TTGTGGGCAGTTGTGGGGGTGGG + Intronic
1186442464 X:9597996-9598018 ATGTGAGCTTATTTGGAGGTGGG + Intronic
1186888272 X:13936831-13936853 CTTTGGACTGATTTAGGGGTAGG - Intronic
1186947230 X:14582220-14582242 CTGGGGACTGTTGTGGGGGTGGG - Intronic
1187237549 X:17482435-17482457 CTGTGAGCTGTTTTGGAGGTTGG - Intronic
1187404025 X:18985971-18985993 ATGTGAGCTGATGTGGGGTTTGG - Intergenic
1190072105 X:47288018-47288040 GTGAGGGGGGATTTGGGGGTAGG + Intergenic
1191041517 X:56086133-56086155 CTGTGCGGTGATTTGGGGACGGG + Intergenic
1191110556 X:56800436-56800458 GTGTGGGATGGTGTGGGGGTGGG + Intergenic
1192746872 X:73948004-73948026 ATATGGGCTGATTGGGGGTTAGG + Intergenic
1193082816 X:77422603-77422625 GTGTGGGCAGAGGTGGGGGTGGG - Intergenic
1195235275 X:102890585-102890607 CTGTGTGCAGAGGTGGGGGTGGG + Intergenic
1195523525 X:105858675-105858697 AGGTGGCCTGATTTGGGGGAAGG + Intronic
1196140972 X:112263040-112263062 CTGGGGCCTGTTTTGGGGTTGGG + Intergenic
1196685120 X:118504136-118504158 CTGGGGGCTGGGGTGGGGGTCGG - Intronic
1197705647 X:129632699-129632721 TTGTGGGTTGGGTTGGGGGTGGG - Intergenic
1197734772 X:129842876-129842898 CTGATGGCTGGTTGGGGGGTGGG + Intronic
1198754085 X:139964899-139964921 CTGGGGCCTGTTGTGGGGGTTGG + Intronic
1199650010 X:149940606-149940628 CTGTGGGTGGAGTTGGGGGAGGG + Intergenic
1200106839 X:153718906-153718928 CTGTGGCCTTGCTTGGGGGTGGG - Intronic
1200756107 Y:6991492-6991514 CTGTGAGCTTATTTGGAGGTGGG + Intronic
1201570823 Y:15412097-15412119 CTGGGGACTGTTGTGGGGGTTGG + Intergenic
1201634261 Y:16104818-16104840 CTGTGGGCCCATTCGTGGGTGGG - Intergenic