ID: 1048829232

View in Genome Browser
Species Human (GRCh38)
Location 8:138459871-138459893
Sequence GGATTTAAACTGATGCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 1, 2: 5, 3: 45, 4: 396}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048829232_1048829235 -8 Left 1048829232 8:138459871-138459893 CCAGAATGCATCAGTTTAAATCC 0: 1
1: 1
2: 5
3: 45
4: 396
Right 1048829235 8:138459886-138459908 TTAAATCCCAGGCAGCCTAAGGG No data
1048829232_1048829234 -9 Left 1048829232 8:138459871-138459893 CCAGAATGCATCAGTTTAAATCC 0: 1
1: 1
2: 5
3: 45
4: 396
Right 1048829234 8:138459885-138459907 TTTAAATCCCAGGCAGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048829232 Original CRISPR GGATTTAAACTGATGCATTC TGG (reversed) Intronic
903272671 1:22200993-22201015 GGATTTGAACTCAGGCAGTCTGG - Intergenic
904046802 1:27614063-27614085 GGATTCATACTCAGGCATTCTGG + Intronic
904346593 1:29876304-29876326 GCATTTAAAGTGAGGCAGTCTGG + Intergenic
904484909 1:30818213-30818235 GAATTAAAACTCAGGCATTCTGG + Intergenic
905238873 1:36569930-36569952 GGATTTGAACTCAGGCCTTCAGG + Intergenic
905835932 1:41121023-41121045 GGATTTAAATTCAGGCAGTCTGG - Intronic
906119314 1:43377815-43377837 GGATTTGAACTGGGGCAGTCTGG + Intergenic
906506092 1:46380753-46380775 GGATTTGAACTCAGGCAGTCTGG + Intergenic
907138350 1:52160292-52160314 GCCTTTGAACTGATGCATTCTGG - Intronic
907752585 1:57277225-57277247 GGATTTAAACCCAAGCAGTCTGG - Intronic
907781649 1:57572437-57572459 GGATTTAAACACAAGCATTCTGG - Intronic
908547924 1:65180092-65180114 GGATTTGAACTCAGGCAGTCTGG + Intronic
908869559 1:68593472-68593494 GGATTTAAACATATGAATTTTGG - Intergenic
909103366 1:71378858-71378880 GGATTTCAACAGATGAATTTTGG - Intergenic
909239420 1:73193017-73193039 GGATTTCAACAGGTGCATTTTGG + Intergenic
909779275 1:79522156-79522178 GCCTTTGAACTCATGCATTCTGG + Intergenic
910689356 1:89949949-89949971 AGATCTAGAATGATGCATTCTGG - Intergenic
910730794 1:90393674-90393696 GGATTTGAACTCAGGCAGTCTGG - Intergenic
911329388 1:96509819-96509841 GGATTTAAACTGAATCCTTTGGG + Intergenic
911386522 1:97182045-97182067 GGATTTAAACTCAGACCTTCTGG + Intronic
912239926 1:107895560-107895582 GGATTCAAACTGAGGCAGCCTGG + Intronic
912242232 1:107923336-107923358 GGATTTCAACTTATGAATTTAGG - Intronic
912737369 1:112161799-112161821 GGATCTAAACAGATTCATGCAGG + Intergenic
913285646 1:117224255-117224277 GGATTTCAACATATGCATTTTGG - Intergenic
913478021 1:119258036-119258058 GGATTCATACTGATGCAGTTTGG + Intergenic
913507235 1:119528119-119528141 GGATTTAAACTGGTTCCTTTAGG - Intergenic
914748670 1:150517466-150517488 GGATTTCAACAAATGCATTTGGG - Intergenic
915099579 1:153489651-153489673 GGATTTGAACTCAGGCAGTCTGG + Intergenic
916446627 1:164878561-164878583 GGAATTGAACTGAGGCAGTCTGG + Intronic
916676674 1:167069669-167069691 GGATTTGAATTGAAGCAGTCTGG - Intronic
917950068 1:180023002-180023024 GGATTTAAACAAAGGCAGTCTGG - Intronic
918250394 1:182698325-182698347 GGATTTAAACCAAGGCAGTCTGG - Intergenic
918496406 1:185142287-185142309 GGATTTGAACTCAGGCAGTCTGG + Intronic
918690528 1:187473634-187473656 GGATTTGAACTCAGGCAGTCTGG + Intergenic
919576243 1:199313381-199313403 AGATTTAAACTCAAGCAGTCTGG + Intergenic
919830100 1:201534868-201534890 GGATTTGAACTGAAGGAGTCTGG - Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921468277 1:215518108-215518130 GGATTTAATCTGAGGGAATCTGG - Intergenic
921647740 1:217637837-217637859 GGATTTGAACTGTTGCACTTTGG - Intronic
922541215 1:226421373-226421395 GGATTTCAACTTATGAATTTGGG + Intergenic
923143783 1:231183883-231183905 GGATTCAAACCCAGGCATTCTGG + Intronic
923470645 1:234287690-234287712 GGATTTAAACCCAGGCAATCTGG + Intronic
923903681 1:238358512-238358534 AGATTTTAAATGAGGCATTCTGG - Intergenic
924060725 1:240171241-240171263 GCCTTTGAACTGTTGCATTCTGG + Intronic
1063051056 10:2448039-2448061 GGATTTTAACTGATGCAGAAGGG - Intergenic
1063767012 10:9153995-9154017 GGATTTAGATAGATGCATTTTGG - Intergenic
1064218808 10:13421992-13422014 GGATTTCAACATATGGATTCTGG + Intergenic
1064424340 10:15216913-15216935 ACATTTAAACTGATTCATTTGGG - Intronic
1065222816 10:23513527-23513549 GGATATAAACCCAGGCATTCCGG - Intergenic
1065841762 10:29707910-29707932 TGATTTAAACTCATGTAGTCTGG + Intronic
1068660085 10:59614592-59614614 GGATTTCAACATATGCATTTGGG + Intergenic
1069292573 10:66799549-66799571 ATATTTAAACTGAAGCATTGTGG + Intronic
1069795220 10:71047534-71047556 GGATTTCAACATATGCATTTTGG - Intergenic
1069922180 10:71822466-71822488 CCATTTAAAATGATGCATTAAGG + Intronic
1070092152 10:73298116-73298138 GGATTTAAATTCAGGCAGTCTGG - Intronic
1070671341 10:78379627-78379649 GGATTTGAACTCAGGCAGTCAGG - Intergenic
1071146959 10:82586468-82586490 GCAATTAAACTCAGGCATTCTGG - Intronic
1071187856 10:83064112-83064134 GGATTTAAACTCAGGCAATATGG + Intergenic
1071529468 10:86377761-86377783 GGATTTGAACCCAGGCATTCTGG + Intergenic
1071992522 10:91113882-91113904 GGATTTGAACTTAGGCAATCTGG - Intergenic
1072348285 10:94530689-94530711 GGATTCAAATTCAGGCATTCTGG + Intronic
1073328334 10:102655417-102655439 GGATTTGAACCCATGCATGCTGG - Intronic
1074387158 10:113025831-113025853 GAATTTGAACTCAGGCATTCTGG + Intronic
1074907269 10:117875798-117875820 GGATTTGAACTCAGGCAATCTGG + Intergenic
1075312152 10:121423405-121423427 GGGCTTCAACTGATGCATTTTGG - Intergenic
1076980408 11:201145-201167 GGATTTCAACTCAGGCTTTCAGG + Intronic
1077806684 11:5597127-5597149 GGATTTGAACACATGCAGTCTGG - Intronic
1078702958 11:13706920-13706942 GGACATAAACTGAAGCACTCAGG - Intronic
1079346792 11:19659740-19659762 GGATTGAAACTCAGGAATTCTGG - Intronic
1079570506 11:21937404-21937426 GAATTTGAACTCAGGCATTCTGG - Intergenic
1080282241 11:30570369-30570391 GGATTTCAACATATGCATTCTGG + Intronic
1080997111 11:37617834-37617856 ATATTTATACTGTTGCATTCGGG - Intergenic
1082962348 11:58930903-58930925 GGATTTAAACATATGAATTGTGG - Intronic
1082980943 11:59120349-59120371 GGATTTAAACATATGAATTGTGG - Intronic
1083464151 11:62834151-62834173 GGATTTAAACCCAGGCAATCTGG + Intronic
1083568432 11:63741037-63741059 GGATACAAACTCAGGCATTCTGG + Intronic
1084078096 11:66798089-66798111 GGATTTGAACTCAGGCAGTCTGG + Intronic
1085883807 11:80498951-80498973 AGATTTCAACAGATGAATTCTGG - Intergenic
1085963793 11:81496511-81496533 GGATTTAGACCTATGCAATCTGG + Intergenic
1086256194 11:84879436-84879458 GCATTTAAGCTTATGTATTCAGG + Intronic
1086283288 11:85216097-85216119 GGATCTGAACTCCTGCATTCAGG - Intronic
1086738695 11:90340205-90340227 GGACTTAAACATATGCATTTTGG + Intergenic
1086781354 11:90910274-90910296 TGATTTAAACTTTTGCATACAGG - Intergenic
1087860766 11:103151637-103151659 GAAATTAAGCTCATGCATTCAGG - Intronic
1087960852 11:104347361-104347383 AGATTTCAACTTATGCATTTAGG - Intergenic
1090721477 11:129478468-129478490 GGATTTCAACTTATGAATTTGGG - Intergenic
1091195816 11:133729799-133729821 GGATTTCAACATATGAATTCTGG + Intergenic
1092005097 12:5062471-5062493 GGATTGAAGCTTAGGCATTCTGG + Intergenic
1092341770 12:7682757-7682779 GGAGATAATCTGATTCATTCAGG + Intergenic
1092769232 12:11881678-11881700 GGATTTCAACAGATGAATTTGGG + Intronic
1094037745 12:26088657-26088679 GGATTTCAACAGATGAATTTTGG + Intergenic
1094077103 12:26489458-26489480 GGTTTCAAACCGATGCAGTCTGG - Intronic
1094365070 12:29671685-29671707 GGATTTGAATGTATGCATTCTGG + Intronic
1094777703 12:33750415-33750437 GTTTTTTAACTGATGCACTCAGG + Intergenic
1095818040 12:46446290-46446312 GGATTTAACCTGACACAGTCTGG + Intergenic
1095997465 12:48100689-48100711 GGATTTAAACCTAGGCACTCTGG - Intronic
1096087804 12:48877835-48877857 GGATTTAAACCCAGGCATTGTGG - Intergenic
1096471837 12:51882835-51882857 GGATTTCAACATATGAATTCTGG + Intergenic
1097168784 12:57100415-57100437 GGATTTAAACCCAGGCATTCTGG + Intronic
1098090926 12:66900297-66900319 GGATTTCAACTTTTGCATTTTGG - Intergenic
1099646787 12:85367547-85367569 GGCTTTAAAATTATGCTTTCTGG + Intergenic
1100161960 12:91871151-91871173 GCCTTTGAACTCATGCATTCCGG - Intergenic
1100468042 12:94865791-94865813 GGATTTTAAATGAGGCATTCTGG - Intergenic
1100820897 12:98428625-98428647 GGATTTGAACTCAAGAATTCTGG + Intergenic
1101022413 12:100566541-100566563 GGATTTCAACATATGAATTCTGG + Intergenic
1101553308 12:105783744-105783766 GGATTTAAACATATGAATTTCGG + Intergenic
1101627551 12:106460449-106460471 GGATTTGAAGTCATGCAATCTGG + Intronic
1101838084 12:108308996-108309018 GGATTCAAACCGAGGCAGTCTGG - Intronic
1102734860 12:115150381-115150403 GGATTTCAACGTATGAATTCTGG + Intergenic
1104701561 12:130908347-130908369 GGATTTCAACAGATGAATTTTGG + Intergenic
1106693112 13:32140648-32140670 GGATTGAGAATGACGCATTCAGG + Intronic
1108254144 13:48594508-48594530 GGATTTAAACATATGAATTTTGG - Intergenic
1109379822 13:61544485-61544507 GGATTTCAACATATGCATTTTGG + Intergenic
1110186815 13:72684716-72684738 GGATTTAAACTCAAGCAATCTGG - Intergenic
1110203353 13:72880595-72880617 GAGTTTGAACTGATGCAGTCTGG + Intronic
1110255432 13:73428790-73428812 GGGTTTAAAATCATGCATTGAGG - Intergenic
1111740627 13:92200887-92200909 GTATCTAAACTGAAGAATTCAGG + Intronic
1112898200 13:104327587-104327609 GGATATAAACCCAGGCATTCTGG + Intergenic
1116053616 14:39835988-39836010 GGATTTCAACATATGAATTCTGG + Intergenic
1116160516 14:41262172-41262194 GGATTTAAACTCATGCATGCTGG - Intergenic
1118193350 14:63601323-63601345 GGATTTGAACCTAGGCATTCTGG + Intronic
1118627027 14:67669184-67669206 GAATTTAAACTCAGGCAATCTGG + Intronic
1118751934 14:68814016-68814038 GGATTTGAACCCAGGCATTCTGG - Intergenic
1118760431 14:68877697-68877719 GGATTTGAACTCAGGCAGTCTGG + Intronic
1118948230 14:70408814-70408836 GGATTTGAACTCAAGCATTCTGG + Intronic
1118974707 14:70666635-70666657 GGATTTAAGCTGAAGCTGTCTGG - Intronic
1119393769 14:74310462-74310484 GGATTTGAACCCATGCAATCCGG - Intronic
1119621875 14:76137512-76137534 GGATTCAAACTCAGGCTTTCGGG - Intergenic
1120614793 14:86690128-86690150 GGATTTTAACATATGCATTTTGG - Intergenic
1120764247 14:88314146-88314168 GGATTTCAACATATGAATTCTGG - Intronic
1120947976 14:90015816-90015838 GGATTTCAACATATGAATTCTGG + Intronic
1120947983 14:90015863-90015885 GGATTTCAACATATGAATTCTGG + Intronic
1121853195 14:97242516-97242538 GGATTTTAACATATGAATTCGGG + Intergenic
1124137923 15:27051436-27051458 GGATTTCAACAGATGCATTTTGG - Intronic
1124505724 15:30271572-30271594 GGAATTAAACTGATTCATACTGG - Intergenic
1124737829 15:32267060-32267082 GGAATTAAACTGATTCATACTGG + Intergenic
1126275901 15:46880540-46880562 GGATTTGAAATGATGCTTTGGGG + Intergenic
1126472072 15:49023468-49023490 GGATGCAAACTGATACAATCTGG + Intronic
1126905427 15:53359621-53359643 GGATTTCAACTTATGAATTTGGG + Intergenic
1127468054 15:59264320-59264342 GGATTCAAACTCAGGCAGTCTGG + Intronic
1130311684 15:82761566-82761588 GGATTCAAACTCAAGCAGTCTGG - Intronic
1130350787 15:83089932-83089954 GGTTTTTAAGTGATGCATGCAGG + Intergenic
1130708325 15:86254402-86254424 GGATTTAAACTCATGTAGTCTGG + Intronic
1131342738 15:91617919-91617941 GGATTTAAACATATGAATTTGGG - Intergenic
1131443067 15:92473348-92473370 GAATTTAAACTGAAGCCCTCAGG + Intronic
1131576768 15:93600154-93600176 AGAGATAAAATGATGCATTCTGG + Intergenic
1132271313 15:100528485-100528507 GAGTTTAAACTGATTCATTGAGG - Intronic
1133569567 16:7027494-7027516 GGATTCAAACTCAAGCAGTCTGG + Intronic
1133813503 16:9178987-9179009 GGATTTGAACATATGCAGTCTGG - Intergenic
1134293326 16:12922044-12922066 GGATTTGAACTGAGCCAGTCAGG + Intronic
1134559283 16:15194041-15194063 GGATTTTAACAGATGAATTTTGG - Intergenic
1134919820 16:18105654-18105676 GGATTTTAACAGATGAATTTTGG - Intergenic
1135245228 16:20850471-20850493 GGATTCAAAGTCAAGCATTCTGG - Intronic
1135458912 16:22624086-22624108 GGATTTAAACTCAGGTATTCTGG + Intergenic
1135922772 16:26666065-26666087 GGATTTGAACTCAAGCAGTCTGG - Intergenic
1135927991 16:26711922-26711944 GGATTTCAACATATGAATTCGGG + Intergenic
1136139032 16:28276967-28276989 GGATTGAAGCTGATGCCTGCAGG + Intergenic
1139781357 16:69354215-69354237 GGAGTGAAACTGATGCATTTAGG - Intronic
1140611412 16:76603313-76603335 CGATTTAAACTTAGGAATTCTGG + Intronic
1141185907 16:81787122-81787144 GGAGTTAAACTGTTACATTGAGG - Intronic
1143045287 17:4073739-4073761 TGTTTTAAAGTGATTCATTCAGG - Intronic
1143336676 17:6176613-6176635 GGATTTCAACGTATGAATTCGGG + Intergenic
1144081189 17:11765808-11765830 GCAATTAAACCTATGCATTCGGG - Intronic
1144552212 17:16250834-16250856 GCATTTGAGCTGATGCAATCTGG + Intronic
1146073315 17:29703938-29703960 GGATTCAAACTCAGGCATTCTGG - Intronic
1146965252 17:37022608-37022630 GGATTCAAACTCAGGCAGTCTGG - Intronic
1147019073 17:37516502-37516524 GAATTTTATCTGAGGCATTCTGG + Exonic
1149002661 17:51773379-51773401 GGATGTAAACTGAGGCTTTGTGG + Intronic
1149649303 17:58266993-58267015 GGATTTGAACTCAGGCAGTCTGG - Intronic
1149670340 17:58402760-58402782 GGATTTCAACTGATTGAGTCAGG - Intronic
1150750998 17:67862523-67862545 GGATTTGAACCTAGGCATTCTGG + Intronic
1150956025 17:69861570-69861592 GGATTTAAACCTAGGCTTTCTGG - Intergenic
1154060235 18:11053622-11053644 GGATTGAAACAGATGCAATATGG - Intronic
1155040153 18:22058409-22058431 AGATTCAAACTCAGGCATTCAGG - Intergenic
1155592488 18:27443654-27443676 GGATTGAAACTCAGGCAATCTGG + Intergenic
1155734704 18:29206443-29206465 GGTTTTAAACTTCTGTATTCTGG + Intergenic
1157342669 18:46793371-46793393 GAATTCAAACTGAGGCAGTCTGG + Intergenic
1157596342 18:48866284-48866306 GGATTTCAACATATGCATTTAGG + Intergenic
1158319451 18:56247317-56247339 GGATTTAAACCCAGGAATTCAGG + Intergenic
1158343305 18:56489325-56489347 GGATTTAAACCCAGGCATTCTGG - Intergenic
1158832920 18:61300095-61300117 GAATTTAATCTGATGGCTTCAGG + Intergenic
1159399042 18:67906639-67906661 GGATTTTAACATATGCATTCTGG - Intergenic
1159427524 18:68309404-68309426 GGATTTAAACCTATGAATTTGGG - Intergenic
1159616005 18:70580531-70580553 AGATTTGAACTGGAGCATTCTGG + Intergenic
1159736919 18:72111628-72111650 GAAGTTAAACAGTTGCATTCAGG - Intergenic
1161117387 19:2505526-2505548 AGATTTAAAATGATACATCCTGG - Intergenic
1163042462 19:14612698-14612720 GAATTTAAACATATGCATTTGGG + Intergenic
1164867176 19:31614267-31614289 AGATTTAAACTGCAGCATCCCGG + Intergenic
1165168499 19:33873472-33873494 ACATTTAAGCTGATGGATTCAGG - Intergenic
1166552919 19:43678625-43678647 GGATTTGAACCCCTGCATTCTGG + Intergenic
1166590144 19:43990569-43990591 GGATGTACAGTGATGCATTCTGG + Intronic
1166592086 19:44008536-44008558 GGATTTCAAATGGTGCATCCTGG - Intronic
1166645849 19:44531121-44531143 GGATTTGAACCCATGCACTCTGG - Intergenic
925979232 2:9163897-9163919 GGATTCAAGCTCTTGCATTCTGG + Intergenic
926911997 2:17859836-17859858 GGATTTCAACAGATGAATTTTGG - Intergenic
926934426 2:18072892-18072914 GGATTCAAACTAATGTCTTCTGG + Intronic
929715143 2:44302539-44302561 GGATTTGAACTGAAGCAGTTGGG + Intronic
930279427 2:49352620-49352642 GGATTTAAACTGAGGCATTCAGG + Intergenic
930313880 2:49773382-49773404 GGATTTAGACTGATTCATCTTGG + Intergenic
930338131 2:50076574-50076596 GGATTTGAACCCATGCAGTCTGG + Intronic
930462756 2:51704139-51704161 GGATTTCAACATATGCATTTTGG + Intergenic
931848845 2:66233122-66233144 GGATTTGAACTCACCCATTCTGG + Intergenic
932023999 2:68115514-68115536 GGATTTTAACTCAGGCATTCTGG + Intergenic
932084093 2:68742419-68742441 GGATTCAAATTCAGGCATTCTGG - Intronic
932851277 2:75189628-75189650 AGAATTAAACTGATAAATTCAGG - Intronic
933273805 2:80262624-80262646 GGATCTACACATATGCATTCCGG + Intronic
935730546 2:106061701-106061723 GGATTTAAACAGATGAAATTTGG + Intergenic
936157497 2:110057952-110057974 GGATATAAACCCAGGCATTCAGG - Intergenic
936187195 2:110313492-110313514 GGATATAAACCCAGGCATTCAGG + Intergenic
936782127 2:116046968-116046990 GAATTAAAACTGATGTAATCTGG - Intergenic
937649143 2:124300417-124300439 TGGTTTAAGCTGATGCATTTGGG + Intronic
938603354 2:132865874-132865896 GGATTTAAAGTGCTGCATGTGGG + Intronic
939316145 2:140551818-140551840 GGATGAAAACTCATGAATTCTGG - Intronic
940113857 2:150185853-150185875 GGATTTAAACTCAGGCTTTTTGG - Intergenic
941948678 2:171130051-171130073 GGATTTGAACTCAGGCAGTCTGG - Intronic
942980476 2:182074517-182074539 GGATTTCAATTGATCTATTCTGG - Intronic
943893720 2:193325226-193325248 GAATTTAACCTTTTGCATTCTGG + Intergenic
943992774 2:194718992-194719014 GTATTGAAAATGATCCATTCTGG - Intergenic
945397830 2:209342325-209342347 AGAATTAAACTCATGCATTATGG + Intergenic
945631994 2:212289572-212289594 GAATTTAAACTGTCTCATTCAGG - Intronic
945952229 2:216050271-216050293 GGATTCAAACTGTTGAATTATGG + Intronic
946007301 2:216536277-216536299 GGATTCAAACTCAGGCAGTCTGG - Intronic
946103948 2:217352906-217352928 GGATTTAAACTTTGGCAGTCTGG + Intronic
946854282 2:223937623-223937645 GGATTCAAACTGAGGCATTCTGG + Intronic
947108833 2:226696846-226696868 GGATTTAAACATATACATTTTGG - Intergenic
947772308 2:232680515-232680537 GAATGAAAACTGAGGCATTCAGG + Intronic
1172277022 20:33685529-33685551 GGATTTGAACTGAGGCCTGCTGG - Intronic
1173085844 20:39916228-39916250 TGGATTAAACTGATGCACTCAGG - Intergenic
1173214779 20:41070842-41070864 GGATTTAAACTCAGGCAGTCTGG - Intronic
1173237508 20:41260883-41260905 GGAGTTAAACTCAGGCAGTCTGG + Intronic
1173461957 20:43250022-43250044 GGATTTAAACTGAAGAGTTATGG - Intergenic
1173552465 20:43942313-43942335 GGATTCAAACCCAGGCATTCTGG + Intronic
1173577429 20:44122051-44122073 GGATTCAAACCAAAGCATTCTGG + Intronic
1174203686 20:48824719-48824741 GGATTTAACCTCAAGCAGTCTGG + Intronic
1174421735 20:50403669-50403691 GGATTCAAACTCAGGCAGTCTGG + Intergenic
1174615715 20:51833935-51833957 GGATTTAAACTCATGGATGTCGG - Intergenic
1176892645 21:14336883-14336905 GCATTTAAACTGATGCCATCTGG - Intergenic
1177186044 21:17798084-17798106 AGATTTAAACTGGTTAATTCTGG - Intronic
1177649311 21:23940066-23940088 AGACTTAAACTGATGCATATAGG + Intergenic
1178905775 21:36634698-36634720 GGATTTTAACATATGCATTTTGG + Intergenic
1179042596 21:37817001-37817023 GAATTTGAACTCATGCATTCAGG - Intronic
1179121531 21:38550379-38550401 GGATTTAAACCCATGAATTTTGG - Intronic
1179664601 21:42901824-42901846 GGATTTGAACCCAGGCATTCTGG + Intronic
1182042965 22:27252739-27252761 GGATTTTACCTGATTAATTCAGG + Intergenic
1182824686 22:33254563-33254585 GAATTTAAACTGAGTCATTCTGG - Intronic
1183985364 22:41566978-41567000 GGATTTAAACTCAGGCAGTCTGG + Intronic
1184746560 22:46459537-46459559 GGATTCAAACCCAGGCATTCTGG - Intronic
1184826492 22:46956154-46956176 GGACTTCAACAGATGAATTCTGG - Intronic
1184854488 22:47138958-47138980 GGATTTTAACCGATGGATTGGGG + Intronic
949117550 3:345782-345804 GGATTTAAAAAGGTGCATTGCGG - Intronic
949288954 3:2441064-2441086 GGATTGGAATTGATGCATTATGG + Intronic
950210554 3:11119918-11119940 GGATTCAAACACATGCAGTCTGG + Intergenic
950579894 3:13855228-13855250 GGATTTAAACTCAGGCCTTCTGG - Intronic
951223921 3:20098590-20098612 GGAGGTAAACTGATGGATTGTGG - Intronic
952992268 3:38842105-38842127 GGATTCAAACCCAAGCATTCTGG - Intergenic
953004384 3:38964584-38964606 AGATTTAAACTGAAGCATAGAGG + Intergenic
953096769 3:39784676-39784698 GGATTTAAACTTAAGCAGACTGG + Intergenic
956460041 3:69462580-69462602 GGATCTTGACTCATGCATTCTGG + Intronic
956698313 3:71937205-71937227 GGATTTAACCTGATGAATGCCGG - Intergenic
956827397 3:73011041-73011063 GGTTTTATACTCAGGCATTCTGG + Intronic
958659808 3:97052144-97052166 GGATTTGAACCCAAGCATTCTGG + Intronic
959707689 3:109354363-109354385 GGAATTAAACTCACTCATTCTGG - Intergenic
959864095 3:111246316-111246338 GGATTTTACCTGAGGCCTTCAGG - Intronic
960085600 3:113587777-113587799 GGATTTGAACTCAGGCAGTCTGG + Intronic
960719492 3:120611816-120611838 GGATAAAGACTGATGCATTGGGG + Intergenic
961442890 3:126963149-126963171 GGATTTAAACTGAGGCCCCCAGG - Intergenic
961931490 3:130538682-130538704 GTAGTTAAACTCATGGATTCTGG - Intergenic
963014986 3:140814677-140814699 GGATTTCAACATATGAATTCTGG + Intergenic
963024550 3:140906039-140906061 GGATTTGAACTCAGGCACTCAGG - Intergenic
963776018 3:149441424-149441446 GGATTCAAACCCAGGCATTCTGG - Intergenic
964489107 3:157215928-157215950 GGATTTAAAATGAACCAGTCTGG + Intergenic
965282701 3:166774254-166774276 GCATTTAAAATGATGACTTCCGG - Intergenic
965296924 3:166958777-166958799 GGAATTTAAACGATGCATTCAGG + Intergenic
965765237 3:172123667-172123689 GGTTCTAAACAGATCCATTCTGG - Intronic
965818266 3:172659081-172659103 GGATTTGAACCCAAGCATTCTGG + Intronic
966656777 3:182367349-182367371 GGAAATAAACTGCTGCATTTTGG - Intergenic
966716625 3:183019321-183019343 GGATTTTAACAAATGAATTCTGG - Intronic
966819273 3:183912128-183912150 GGATTTAAACTCCAGCAGTCTGG - Intergenic
968046501 3:195626725-195626747 GGATTTCAACAGATGAATTTCGG - Intergenic
968308152 3:197663316-197663338 GGATTTCAACAGATGAATTTCGG + Intergenic
972211986 4:36849581-36849603 AGATTCAAACTGAAGAATTCAGG + Intergenic
972501482 4:39681986-39682008 AGATTCAAACTGAGGCAATCTGG + Intergenic
972590382 4:40480359-40480381 GGATTCAAACCCAGGCATTCTGG + Intronic
972780858 4:42285902-42285924 GGATATAAACCCAGGCATTCGGG - Intergenic
972943810 4:44228980-44229002 GGATTTAAACTGAGGAAGTCTGG - Intronic
973163656 4:47050675-47050697 GGATTTTCCCTGTTGCATTCAGG + Intronic
973716907 4:53685890-53685912 GGATTTCAACATATGAATTCAGG + Intronic
975597069 4:76057735-76057757 GGATTTGAACTGAGGCACTTTGG + Intronic
975635089 4:76440333-76440355 GGATTTGAACTCATGCATTCTGG + Intronic
975923807 4:79424581-79424603 GGATTTCAACATATGAATTCTGG + Intergenic
976579286 4:86716314-86716336 TGATTCAAACTGAGGCAGTCTGG + Intronic
977143391 4:93404440-93404462 GGATTTAAACATAGGCAGTCTGG - Intronic
977614461 4:99072579-99072601 GCCTTTGAACTGATGCATTCTGG - Exonic
978416547 4:108482713-108482735 GGATTTAAACCTAGGCAGTCTGG + Intergenic
979312886 4:119224808-119224830 GGATTTAAACTAAGGCAGTGTGG + Intronic
979770674 4:124521364-124521386 GTATTTTAACTGTTGCCTTCTGG + Intergenic
980310374 4:131121343-131121365 GGATTTAAACTGTTGCATTTTGG - Intergenic
982226001 4:153167056-153167078 GGATTTAAACTCAAACATTCTGG - Intronic
982503299 4:156186423-156186445 GGATTCAAACTCAAGCAGTCTGG - Intergenic
983536861 4:168867046-168867068 GGATTTAAACTGAGGAGCTCTGG - Intronic
983860462 4:172699230-172699252 GGATTTCAACATATGAATTCAGG + Intronic
984639707 4:182148223-182148245 GGATGCAAACTGATCCATTGTGG - Intronic
986225942 5:5812819-5812841 GGATTTCAACAGATGAATTTTGG - Intergenic
986496778 5:8350375-8350397 GGATTTCAACGTATGCATCCTGG - Intergenic
987481017 5:18458042-18458064 GTATTTAAACTGTTGCTATCTGG - Intergenic
987835081 5:23150063-23150085 GGATTTCAACAGATGAATTTTGG + Intergenic
987868312 5:23575098-23575120 GGATTTAAACATATGGATTTTGG + Intergenic
988047033 5:25969643-25969665 TGATTTAATCTGATGCATCAGGG - Intergenic
988345300 5:30029936-30029958 GGATTTAAACTCATAAATTTTGG - Intergenic
988422746 5:31026229-31026251 GGATTTCAACATATGAATTCTGG - Intergenic
989628186 5:43453056-43453078 GGAATTTCACTGAGGCATTCAGG - Intronic
990011045 5:50998431-50998453 GAATAGAAACTGATGCATTCAGG + Intergenic
990176735 5:53116199-53116221 GGATTTTAACCTATGCATTTTGG - Intergenic
990542042 5:56782645-56782667 GGATTTAAACCTAGGCAGTCTGG + Intergenic
990950663 5:61295130-61295152 GGATTTGAACACAAGCATTCTGG - Intergenic
991385015 5:66077541-66077563 GAATTTAAACTCAGGCAGTCTGG - Intronic
992774309 5:80076489-80076511 GGATTTACACTGAGGCTGTCTGG + Intronic
992848601 5:80780529-80780551 GTATTTAGACTGATGCCTGCAGG - Intronic
992870310 5:80999111-80999133 GGATTTTGACTGATGCAATGGGG + Intronic
993038533 5:82785203-82785225 GGATATTAACTGATGACTTCAGG + Intergenic
993705209 5:91161900-91161922 GGAATTAACATGGTGCATTCAGG + Intronic
993764748 5:91842406-91842428 GGGTTTAAATTTATGCTTTCTGG + Intergenic
994022695 5:95045862-95045884 GGATTCAAACTCAAGCAGTCTGG - Intronic
994223699 5:97227522-97227544 GGATTTAAACCCAGGCAGTCTGG - Intergenic
994679747 5:102871087-102871109 GGGGTTAAACAGATGCATTGGGG + Intronic
996436539 5:123439351-123439373 GGACTTCAACAGATGAATTCTGG - Intergenic
996669935 5:126105891-126105913 GGATTTGTACATATGCATTCTGG - Intergenic
997756871 5:136407791-136407813 GGATTCAAACCCAGGCATTCTGG + Intergenic
999083469 5:148866100-148866122 GGTTCTCCACTGATGCATTCTGG - Intergenic
999306592 5:150523552-150523574 GGATTTGAACTCAAGCAGTCCGG + Intronic
1000854684 5:166383370-166383392 GAATTGAAACTGAGGCATTATGG + Intergenic
1002152738 5:177248935-177248957 GGATTTAAACTTCGGCAGTCTGG + Intronic
1003104686 6:3206320-3206342 GGATTTAAACATATGTATTTCGG - Intergenic
1003621430 6:7704510-7704532 GGATTTCAACAGATGAATTAGGG - Intergenic
1003697386 6:8423839-8423861 GCATTTACACTGATGCATATGGG - Intronic
1004007289 6:11648886-11648908 GGATATAAACCCAGGCATTCGGG + Intergenic
1005247914 6:23909906-23909928 GGATTTCAGCATATGCATTCTGG - Intergenic
1006971407 6:38049478-38049500 GGATTTGAACTCAGGCAGTCTGG + Intronic
1007404868 6:41629337-41629359 GGATTTGAATTCAGGCATTCTGG + Intergenic
1007716782 6:43860930-43860952 GGATTTGAACTCATGCAGTCTGG + Intergenic
1008377881 6:50811801-50811823 GGATTTCAACATATGAATTCTGG - Intergenic
1008793222 6:55265738-55265760 GGATTTAAATTCATGCAGTCTGG - Intronic
1009029130 6:58035732-58035754 GGAACTAAACTTATGCATTTAGG + Intergenic
1009204669 6:60787130-60787152 GGAACTAAACTTATGCATTTAGG + Intergenic
1009603600 6:65836961-65836983 GCCTTTCAACTGATGCATTCTGG - Intergenic
1009921998 6:70073287-70073309 GGATTTAAATTCAGGCAATCTGG - Intronic
1011735792 6:90309570-90309592 GGATTTGAACTCACGAATTCTGG + Intergenic
1011930925 6:92711630-92711652 GGACTGCAACTGAGGCATTCTGG - Intergenic
1012900067 6:104994830-104994852 GGCTTTAAACTGATTCACACGGG + Intronic
1014645520 6:123967980-123968002 GGATGTAAAATGATGAGTTCTGG + Intronic
1015518856 6:134112091-134112113 GGATTTAAACATGTGAATTCTGG + Intergenic
1015897789 6:138034075-138034097 GGATTCAAACCCAAGCATTCTGG + Intergenic
1017080773 6:150666248-150666270 TGAAGTCAACTGATGCATTCAGG + Intronic
1017751714 6:157494800-157494822 GGATTTGGAATTATGCATTCAGG - Intronic
1017816356 6:158019275-158019297 GGTTTTAAACTCATGCCTTGCGG + Intronic
1017995763 6:159530579-159530601 AGATTTAAACCCAGGCATTCTGG + Intergenic
1018486127 6:164242787-164242809 GGATTTAAATTGTTAAATTCAGG + Intergenic
1019100853 6:169628040-169628062 GGGTTTCAACTGATGAATTCTGG - Intronic
1019790644 7:3010739-3010761 GGACTTCAACTTATGCCTTCGGG - Intronic
1020615483 7:10454249-10454271 GGTTTTAATCAGATGCATGCAGG - Intergenic
1021093762 7:16511979-16512001 GGATTTCAACATATGCATTTTGG - Intronic
1021687014 7:23196335-23196357 GCATTTAAACTGCTTCCTTCAGG - Intronic
1021856674 7:24863794-24863816 GGATTCAAACTGAAGCAGCCTGG - Intronic
1022952765 7:35354346-35354368 GGATTTGAACTCAGGCAGTCTGG - Intergenic
1023473994 7:40556612-40556634 GGATTTAAACCCAGGCAGTCTGG - Intronic
1023559058 7:41453348-41453370 GGATTTCAACATATGCATTTTGG - Intergenic
1023627337 7:42129305-42129327 GGATTTGAACTGAGGCAGTCTGG + Intronic
1023780330 7:43649304-43649326 GGATTCAAATTCATGCAGTCTGG + Exonic
1025249085 7:57339783-57339805 GGATTCAAACTCAGGCAGTCTGG - Intergenic
1026416538 7:70187016-70187038 GGATTCAAACTGAGGTATTCTGG + Intronic
1028363349 7:89995736-89995758 GGAGTTAAAATGAAGCATTTTGG - Intergenic
1028967687 7:96820895-96820917 GGATTTAAACCCAGGCATTCTGG + Intergenic
1029871445 7:103697251-103697273 GGATTTCAACATATGAATTCTGG + Intronic
1029886813 7:103881537-103881559 GGATACAACATGATGCATTCAGG - Intronic
1029969919 7:104778744-104778766 GGATTTTAACTGAGGCAGCCTGG - Intronic
1030059582 7:105612173-105612195 GGATTTAAACCCAGGCATTTTGG - Intronic
1030926392 7:115460414-115460436 GGATTGAAACTGAGGTGTTCTGG + Intergenic
1031517017 7:122713285-122713307 GGATTTAAACTCAGGCAGTCTGG - Intronic
1032357854 7:131226740-131226762 GGATTTGAGCTCATGCATTCTGG + Intronic
1034398369 7:150845230-150845252 GGATTCAAACTCAGGCCTTCTGG + Intronic
1034697283 7:153064902-153064924 AGATTTAAACCCAGGCATTCTGG - Intergenic
1036916001 8:12804525-12804547 GGATTTGAACTGAGTCATACCGG - Intergenic
1038964214 8:32553077-32553099 GGATTTAAACCCAGGCAATCTGG - Intronic
1039180042 8:34856809-34856831 GGATTAAAACTCAGGCTTTCTGG + Intergenic
1039969130 8:42306716-42306738 GGTTTTAAACAGATCCATGCTGG + Intronic
1040799797 8:51328018-51328040 ACATTTAAACTGGTGAATTCTGG + Intronic
1041214824 8:55590168-55590190 GGATTTGAACTCAGGCAATCTGG - Intergenic
1041536718 8:58934556-58934578 GGATTTGAACTGACGCACTCTGG + Intronic
1044327159 8:90871825-90871847 GGATTTGAACTCAGGCATTCTGG + Intronic
1045761767 8:105617091-105617113 GGATTTAAACTCAAGCAATGTGG + Intronic
1045943522 8:107767808-107767830 GGATTTAAACCCAGGCATTCTGG + Intergenic
1045956441 8:107913172-107913194 GGATTTGAACTTATGTAGTCTGG + Intronic
1046575645 8:116025542-116025564 GGATTTCAACATATGCATTCTGG - Intergenic
1046771868 8:118124600-118124622 GGATTTGAACTTAGGCAGTCTGG + Intergenic
1047020746 8:120772726-120772748 GGTTTTAAATTGATGGACTCTGG + Intronic
1047162045 8:122391435-122391457 GGATTTAAAATGGTGGATTTAGG + Intergenic
1047192803 8:122693588-122693610 GGATTTATCCTTTTGCATTCTGG - Intergenic
1047290433 8:123524898-123524920 GGCTTTAAACTGGTGCTATCTGG - Intronic
1047314677 8:123721905-123721927 GGATTCAAACCCATGCAGTCTGG + Intronic
1047819283 8:128500900-128500922 GGATTTGAACTTAGGCAGTCTGG + Intergenic
1048396406 8:134018395-134018417 GGATTTGAACTGAGGCATTCTGG - Intergenic
1048829232 8:138459871-138459893 GGATTTAAACTGATGCATTCTGG - Intronic
1050017155 9:1246179-1246201 GGATTTAAACATATGAATTTTGG - Intergenic
1050417260 9:5430673-5430695 GGATTCAAACTCAGGCAGTCTGG + Intronic
1050593482 9:7183391-7183413 GGATATAAACCCAGGCATTCCGG + Intergenic
1051071752 9:13177677-13177699 GGATTTGAACTCAGGCATCCTGG - Intronic
1051119164 9:13732902-13732924 GGATTTGAACTTAAGCAGTCTGG - Intergenic
1051283550 9:15469037-15469059 GGATGTGAACAGATGCATTGAGG - Exonic
1051478376 9:17533197-17533219 GGATTTGAACTCAGGCAATCTGG + Intergenic
1052201527 9:25787388-25787410 GAACTTAAACTGCTGCAATCTGG - Intergenic
1052483989 9:29072045-29072067 GGCTTTAAACTGATACACTATGG - Intergenic
1052583095 9:30387049-30387071 GGGTTTAAACTTATGAATTTGGG + Intergenic
1054969362 9:71067497-71067519 GGATTTAAACTCCAGCATTCTGG - Intronic
1056423507 9:86453352-86453374 GGATTTCAACAGATGAATTTGGG + Intergenic
1056572811 9:87830579-87830601 GGATTCAAACCCAAGCATTCTGG - Intergenic
1056693043 9:88824136-88824158 GGATTTCAACAGATGAATTTGGG - Intergenic
1056730723 9:89164049-89164071 GGATTTCAACAGATTAATTCTGG + Intronic
1056789949 9:89618804-89618826 GGATTTCAACAGATGTATTAGGG - Intergenic
1057852547 9:98576535-98576557 GGATTTTAACTCAAGCAGTCTGG - Intronic
1057866984 9:98689256-98689278 GGATTCAAACTGAGGCAGTCTGG - Intronic
1058113849 9:101062568-101062590 TGATTTAAACTGCTACATTTAGG + Intronic
1058206988 9:102120267-102120289 GAATTTAAACTCATTCATTATGG - Intergenic
1059266035 9:113031592-113031614 GGAAATAAACAAATGCATTCTGG + Intergenic
1061518752 9:131104932-131104954 GGATTCAAACTCAGGCATTCTGG + Intronic
1062175207 9:135158156-135158178 GAATTGAGACTGATGCATGCAGG + Intergenic
1186312242 X:8333531-8333553 GGATATGAACCAATGCATTCAGG - Intergenic
1186483992 X:9918894-9918916 GGATTTCAACTTATGGATTTGGG + Intronic
1186659411 X:11653762-11653784 GGATTTAAACCTAGGCAGTCTGG + Intronic
1187424667 X:19166321-19166343 GGGTTTAAACCGAAGCTTTCTGG + Intergenic
1188549932 X:31351986-31352008 GGATTCAAACTCATTCAGTCTGG + Intronic
1188573321 X:31616097-31616119 CGATTTAAACTCAGGCAGTCGGG + Intronic
1189119583 X:38380056-38380078 GGATACAAACTGATGTATTTTGG - Intronic
1189367151 X:40397614-40397636 GGATTTCAACAGATGAATTTTGG + Intergenic
1192110596 X:68359907-68359929 TGATTTGAACTTAGGCATTCTGG - Intronic
1192185392 X:68943527-68943549 GAATTCAAACGGAGGCATTCAGG + Intergenic
1193307190 X:79962985-79963007 GGATATAAACCCAGGCATTCTGG + Intergenic
1194642040 X:96413710-96413732 GGATTTTAACATATGCATTGGGG + Intergenic
1195385144 X:104306921-104306943 GGGTTCAATCTCATGCATTCTGG - Intergenic
1195918220 X:109956706-109956728 GGATTTAAACATATGAATTTGGG - Intergenic
1196388446 X:115185368-115185390 GGATTCAAACTCAGGCAATCTGG + Intronic
1196707934 X:118731818-118731840 GGATATAAACTCAGGCAGTCAGG + Intronic
1196786399 X:119424970-119424992 GGATTTCAACAGATGAATTTTGG + Intronic
1197317801 X:124990132-124990154 TGAGTTAAACTGAGGCCTTCTGG + Intergenic
1197541046 X:127761374-127761396 GGATATAAGATGATGTATTCTGG + Intergenic
1197700393 X:129595263-129595285 GGATTTGAACTCAGGCAGTCTGG - Intergenic
1197793241 X:130276152-130276174 GGATTTTAACCCAGGCATTCTGG + Intergenic
1199432052 X:147773006-147773028 GGATATAAACCCAGGCATTCGGG + Intergenic
1199551365 X:149064996-149065018 GGATTTGAACTCAAGCAGTCTGG - Intergenic