ID: 1048829858

View in Genome Browser
Species Human (GRCh38)
Location 8:138465471-138465493
Sequence AGGCAGCTCCATCAGTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048829858 Original CRISPR AGGCAGCTCCATCAGTGAAA AGG (reversed) Intronic
900325368 1:2106123-2106145 AGGCTGCTCCATCAGCCACAGGG - Intronic
900910986 1:5596874-5596896 GGGCAGCCCCCTCAGTGGAAAGG + Intergenic
901457801 1:9373366-9373388 TGGCGTCTCCATCTGTGAAATGG + Intergenic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
902044521 1:13514516-13514538 TGGTAGCTCCATTTGTGAAATGG + Intergenic
902865176 1:19273305-19273327 TGGCAGCTCCCTCAGTGAGATGG - Intergenic
903366304 1:22807366-22807388 TGGCAGCTCCATCTATAAAATGG - Intronic
905126090 1:35717199-35717221 AGGCAGAGAGATCAGTGAAAAGG - Intronic
905616883 1:39407914-39407936 AGGCAGCTGCATCTCTGAACGGG - Intronic
906745908 1:48222078-48222100 AGGCAGGGCCATCTCTGAAAAGG - Intergenic
906776976 1:48538764-48538786 AGGAAGGTGCATCAGTGCAAAGG + Intronic
906782249 1:48583082-48583104 AAGAAACTCCATCAGTGGAACGG + Intronic
906852786 1:49269812-49269834 AGGCAGATTAATCAGAGAAAAGG - Intronic
908118124 1:60961045-60961067 AGGCAGCTCCCTGGGTTAAAGGG + Intronic
912128909 1:106576819-106576841 AGGCAGCTGCATGAGTGCAGCGG + Intergenic
915776331 1:158491782-158491804 TGACAGCTACATCAGTGAACTGG + Intergenic
915802887 1:158813451-158813473 AGGCACCTTCTTCAGTGATATGG + Intergenic
916482188 1:165224398-165224420 AGGCAGCCCCATCTATAAAATGG + Intronic
918706878 1:187674470-187674492 AGAGAGCTCCATCCCTGAAAGGG + Intergenic
919173469 1:193988406-193988428 AGAGAGCACCATCTGTGAAAAGG + Intergenic
919617224 1:199822780-199822802 AGGCAGCTGAAGCATTGAAATGG - Intergenic
921302327 1:213763186-213763208 AGGCAGCTTCGTCACTGAGATGG - Intergenic
923405910 1:233659909-233659931 AGGAAGCTACATCAGGGCAAGGG + Intronic
1063207623 10:3849489-3849511 AGGCATCCCAATCAGTAAAAGGG - Intergenic
1065919587 10:30380601-30380623 CGTCATATCCATCAGTGAAACGG + Intergenic
1065941732 10:30570890-30570912 AGACAGCTCCATCAGGAACAAGG - Intergenic
1071970163 10:90897091-90897113 AGGAAACTCAGTCAGTGAAAAGG - Intronic
1073105289 10:101029431-101029453 AGGGAGCTCCATCAGGGAAGGGG - Intronic
1073257244 10:102160771-102160793 AGACAGCTCCAGCAGTGAGGAGG + Exonic
1074350975 10:112736830-112736852 GGGCAGCTCTTTCAGTGAGAAGG - Intronic
1076745150 10:132509248-132509270 ATGCAGCTCCCGCTGTGAAAAGG + Intergenic
1077947608 11:6918698-6918720 ATGTAGCTGCAACAGTGAAAGGG - Intergenic
1080726499 11:34903665-34903687 AGGCAGCTAAATCAGTGGCAAGG + Intronic
1081398507 11:42615245-42615267 CTGCAGCTCCATCAGAGCAATGG + Intergenic
1082916131 11:58439566-58439588 AGACAACTACATCAGTGAGATGG - Exonic
1083381055 11:62268935-62268957 AGTCAGCTCCATGAGAGCAAGGG + Intergenic
1083877717 11:65533055-65533077 AGGAAGCTCCATGAGTGCAGGGG - Intronic
1084769926 11:71335927-71335949 AGGCAGCTCCATCATTCTAATGG - Intergenic
1085726440 11:78958989-78959011 TGGTTGCTCCATCTGTGAAATGG - Intronic
1088359793 11:108978241-108978263 AGGAAGCTGCTTCAGTGAATTGG + Intergenic
1088882886 11:113985599-113985621 AGGCAGTTCCATCAAGGCAAAGG + Intronic
1088991076 11:114954109-114954131 AGGCTGGTGCACCAGTGAAATGG - Intergenic
1090958259 11:131533439-131533461 AGACGTCTCCATCACTGAAATGG + Intronic
1092276676 12:7066782-7066804 AGGCAGCTCCATGACTCACAAGG - Intronic
1093644947 12:21574532-21574554 AATCTGCTCCATCACTGAAAGGG - Intronic
1093969952 12:25367042-25367064 AGGCATCTGCATCAAGGAAACGG + Intergenic
1096499712 12:52057287-52057309 AGGCAGGTGTATCAGGGAAAGGG - Intronic
1097451949 12:59747585-59747607 AGGAGGCACCATAAGTGAAAGGG + Intronic
1103740627 12:123088870-123088892 AGGCAGCAACATGAGTGCAAAGG - Intronic
1104270961 12:127281921-127281943 AGGCACATCCAGCTGTGAAAAGG + Intergenic
1105717989 13:23085852-23085874 AGGCAGATCAATAGGTGAAAAGG - Intergenic
1106434535 13:29712201-29712223 AGGCAGCAGCACCAATGAAATGG + Intergenic
1108599619 13:51981074-51981096 AGTCAGTTTCAACAGTGAAATGG - Intronic
1111820340 13:93206455-93206477 GTGCAGCAGCATCAGTGAAACGG - Intergenic
1111841005 13:93450939-93450961 AGGCATCTAGACCAGTGAAAAGG + Intronic
1112432762 13:99366641-99366663 TGGCAGCACCCTCAGCGAAAGGG - Intronic
1113286186 13:108851770-108851792 TGGCAGCTACAGCAGAGAAAAGG - Intronic
1113698389 13:112364911-112364933 AGGCAGATTGATCAGAGAAAAGG - Intergenic
1113776952 13:112953332-112953354 TGGGAGCTCCTTCAGTGAGAAGG - Intronic
1118109859 14:62706214-62706236 AGGCAGGTCCATTTGTGAAAGGG - Exonic
1118753878 14:68824371-68824393 GGGCAACTCCATGAGTTAAAGGG + Intergenic
1118902654 14:69999607-69999629 AGGCACCTGCATCAGAGAGATGG - Intronic
1120116054 14:80618940-80618962 AGGCTGCATCATTAGTGAAAAGG + Intronic
1122151935 14:99730336-99730358 CGGGAGCCCCATCTGTGAAATGG - Intergenic
1122397262 14:101442174-101442196 AGGCAGGTCCTTCCGTAAAATGG + Intergenic
1124154147 15:27210192-27210214 AGGCAGCCACCTCAGAGAAAAGG + Intronic
1127327840 15:57912769-57912791 AGGCAGCACTATCAGTGGACAGG + Intergenic
1127770998 15:62230707-62230729 AAGCAGCTCCAGCAGCAAAAAGG + Intergenic
1129424667 15:75454821-75454843 AGGCAGCTCCATGTTTGCAAGGG + Intronic
1135175633 16:20226000-20226022 TGGCTGCTCCATCAGTTACAAGG + Intergenic
1137621210 16:49877567-49877589 AGGGAGCACCATCTGTCAAATGG + Intergenic
1138419221 16:56888391-56888413 AGGTAGCACCATGAGTGAAGTGG + Intronic
1138787399 16:59863799-59863821 AGGCAGATCCATAGGAGAAAAGG + Intergenic
1140534814 16:75700062-75700084 TGGCAGCTTTATCAGGGAAAGGG + Intronic
1142740026 17:1926460-1926482 TGGCAGCTCCCTCAGTGACCGGG + Intergenic
1143019476 17:3909454-3909476 AGGCAGCTCACTCAGGGAATGGG - Intronic
1144653584 17:17021649-17021671 GGGCCCCTCCTTCAGTGAAAAGG - Intergenic
1146810934 17:35902545-35902567 AGGAAGCTCCAGAAGGGAAATGG + Intergenic
1147167498 17:38601329-38601351 AGGCAGGCCCATCAGAGACATGG + Intronic
1147657629 17:42099584-42099606 AGGTTGCTTCATCAGGGAAAGGG - Intergenic
1149199013 17:54160845-54160867 AGGCAGATTCATTAGAGAAAAGG - Intergenic
1151916355 17:77121038-77121060 TGGCAGCTCCATCGGTGAGATGG + Intronic
1152782003 17:82230822-82230844 AGTCAGGCCCATCTGTGAAATGG + Intronic
1153470460 18:5438812-5438834 AGGCCTCTCCAGCACTGAAAAGG + Intronic
1153960698 18:10137561-10137583 GGGCAGCTACATCAGGGGAAGGG + Intergenic
1156393402 18:36674514-36674536 AAGCAGCTTCACCAGTGAACAGG - Intronic
1163514437 19:17754578-17754600 AGGCAGCTCCTGCAGGAAAAGGG - Exonic
1165118767 19:33545718-33545740 TGGCATCTGCATCTGTGAAATGG - Intergenic
1168156158 19:54473903-54473925 AGGCAGCTCAGTGAGAGAAAGGG + Intergenic
926271442 2:11369675-11369697 AGGCATTTCCATCAGGGAAATGG + Intergenic
926326217 2:11786559-11786581 AGGCAGCCCCATTTTTGAAAGGG + Intronic
926761287 2:16281071-16281093 TGACATCTCCATCAGTAAAATGG - Intergenic
927936856 2:27080921-27080943 AGGCAGCCCCCTCAGTGGACTGG + Exonic
928774384 2:34741037-34741059 AAGCAGCTTCATAAGTGAAATGG - Intergenic
929609004 2:43255913-43255935 AGGCAGCTCCATGAGTTTGAGGG - Intronic
930189320 2:48441249-48441271 AGCCCGCTACTTCAGTGAAAAGG - Intronic
930759420 2:55016862-55016884 ATACAGCTAAATCAGTGAAAGGG + Intronic
930944020 2:57049444-57049466 AGGCTCTTGCATCAGTGAAAGGG + Intergenic
931528344 2:63184583-63184605 AGGAAGCTCCATCAGACTAACGG - Intronic
931580871 2:63772178-63772200 AGGCAGATGCTTCAGAGAAAAGG - Intronic
931636775 2:64347894-64347916 AGGCAGCACTAAGAGTGAAAGGG + Intergenic
931849019 2:66234588-66234610 AGGCAAATCTCTCAGTGAAATGG - Intergenic
932832455 2:75004206-75004228 AGGCTGCTGCATCAGTGCTATGG - Intergenic
933430418 2:82170071-82170093 AGGCAGTTCTCTCAGTGCAAGGG + Intergenic
934907387 2:98217098-98217120 AGGGAGCTCCATCCCTGCAATGG + Intronic
934912324 2:98270759-98270781 CGACAGCTCTTTCAGTGAAATGG - Exonic
935078276 2:99767645-99767667 GGCCATCACCATCAGTGAAATGG + Intronic
935199315 2:100842537-100842559 AGGCAGCTGGGTCAGGGAAAAGG - Intronic
935601790 2:104929514-104929536 AGGCAACTACATCAGTTACAGGG - Intergenic
936490342 2:112964908-112964930 AGTCACATCCATAAGTGAAATGG - Intergenic
937691173 2:124757134-124757156 GGGCAGATCCATCAGTTACATGG - Intronic
938838038 2:135128026-135128048 TGGTAACTCCATCAGTTAAATGG - Intronic
942694956 2:178631194-178631216 AAGCAGATGCACCAGTGAAATGG - Exonic
945699175 2:213150055-213150077 AGGCTGCCCCATCAATGAAATGG + Intronic
946172346 2:217902835-217902857 AGGAAGCCCCGTCAGTGAGAGGG - Intronic
948705391 2:239789180-239789202 AGGAAGCTACATCAGGAAAAAGG + Intronic
1168822215 20:782484-782506 TGTCAGCTCCAGCAGTGAAGAGG - Intergenic
1169066241 20:2695620-2695642 AGGCAGCTCCCTCTGGGACAGGG - Intronic
1169145879 20:3252066-3252088 GGCCAGCTCCTTCAGGGAAACGG + Exonic
1172844978 20:37924780-37924802 AGGCAGCTCAATCAGCAACAGGG - Intronic
1177576643 21:22965329-22965351 AGGAAACTCCATCGGGGAAAAGG + Intergenic
1178146772 21:29749422-29749444 CAGCATCTCCATCTGTGAAATGG + Intronic
1178842000 21:36145213-36145235 ACACACCTCCATCAGTGACAGGG - Intronic
1179115731 21:38490449-38490471 AGGCTTTTCCATCGGTGAAATGG - Intronic
1182793351 22:32971821-32971843 TGGGAGCTCCATCACTGGAAGGG + Intronic
1184187893 22:42876907-42876929 GGGCAGCACCGTCAGTGAGAAGG - Exonic
950610410 3:14123484-14123506 AGACAGCGCCACCAGGGAAAAGG + Intronic
951975355 3:28501200-28501222 AGGCAGCTCCAGCAGGAAGAAGG + Intronic
955419704 3:58724155-58724177 AGCCAGCCCCAGCAGGGAAAAGG - Intronic
956319466 3:67980490-67980512 AGACAGCTGCATCACTGAACTGG - Intergenic
957339339 3:78873254-78873276 AGGTAGTTCCGTCAGTCAAAAGG + Intronic
958974817 3:100655688-100655710 ATGTAGAGCCATCAGTGAAAGGG + Intronic
960385865 3:117020967-117020989 AGGCAGCTCAACCAGTAAACTGG + Intronic
960506017 3:118494891-118494913 AGGCACATACAACAGTGAAAAGG + Intergenic
961001054 3:123374284-123374306 ATGAAGCTGCATCAGTCAAATGG + Intronic
970207764 4:13672715-13672737 AAGCAGCGCCATCAGGGAAAGGG + Intergenic
970906443 4:21221842-21221864 AGGCAGCCCCATGAATAAAATGG + Intronic
972418450 4:38865349-38865371 AAGCAGCTACATGAGTAAAAGGG + Intergenic
976204898 4:82615618-82615640 AGGCAGATGCAACAGTGCAATGG - Intergenic
976303868 4:83540348-83540370 AGGCAGCTCTGTCAGCGAAATGG - Intronic
978210332 4:106127894-106127916 AGGCAGCTTCATAAATAAAATGG - Intronic
980213859 4:129825522-129825544 AGTCTGCTCCATATGTGAAAAGG + Intergenic
981214144 4:142143424-142143446 AGGCAGATTCATAAGAGAAAAGG - Intronic
982430610 4:155317968-155317990 AGGCAGGACAAGCAGTGAAAAGG - Intergenic
983176456 4:164594052-164594074 AGTCAACTCCATCACTCAAATGG + Intergenic
986243647 5:5984745-5984767 AGGCAGCCCCATGGGTGAGAAGG + Intergenic
987128076 5:14833898-14833920 AGGCAGTTGCATTACTGAAAAGG - Intronic
987263116 5:16223196-16223218 GTGCAGCACCTTCAGTGAAAAGG - Intergenic
995762977 5:115583752-115583774 AGTTAACTCCATCAGTAAAAAGG + Intronic
996231757 5:121072436-121072458 AGGCAACTCCCTTTGTGAAAAGG + Intergenic
998570823 5:143255138-143255160 AGGCAGCAACAGCAGAGAAATGG - Intergenic
999512491 5:152267276-152267298 AGGCTGAACCATCGGTGAAAAGG + Intergenic
999798136 5:155007184-155007206 AGGCAAATCCATAAGTGAAGGGG - Intergenic
999859150 5:155626731-155626753 TGTTAGCTCCATCAGTGAAATGG + Intergenic
1001200504 5:169711825-169711847 AGGCAGCTCTCTCAGTTAAATGG + Intronic
1001866849 5:175113661-175113683 ACACAGCATCATCAGTGAAAAGG + Intergenic
1002618733 5:180471279-180471301 CGGCTTCTCCATCAGTGAAACGG - Intergenic
1004560174 6:16742349-16742371 AGGCAGCTCCAGAGGTGAACTGG + Intronic
1007560645 6:42805652-42805674 AGTCAGCTCCATCAGGGCAGAGG - Intronic
1011941823 6:92851953-92851975 AGGCAGATTAATCAGAGAAAAGG + Intergenic
1013873082 6:114791987-114792009 AGACAGCACCATCAGGGATAAGG - Intergenic
1014851105 6:126340517-126340539 AGGCAGTTCCAACAATGACAGGG + Intronic
1017931851 6:158962660-158962682 AAGCAACTACATCAGTGAATTGG - Intergenic
1023909625 7:44544185-44544207 CGGCTGCTCCCTCAGTGAACTGG - Intergenic
1024094506 7:45973226-45973248 AGGCAGCTCCTTCAGAAAACAGG - Intergenic
1024968340 7:55045575-55045597 AGTCAGCTCCATCACTTAAGTGG + Intronic
1025709225 7:63891720-63891742 ATGCAGCTGCTTCAGTGACAAGG + Intergenic
1026936050 7:74256175-74256197 AGACCGCTCCATCAGTTTAAAGG - Intergenic
1031560673 7:123234281-123234303 ACACAGGTCCATCAGAGAAATGG + Intergenic
1032189012 7:129752202-129752224 AGGCTGCTCCAGCATTGATAAGG + Intronic
1034629062 7:152516469-152516491 AGGCAGCTCCTTCAGTGGATCGG - Intergenic
1034834469 7:154338917-154338939 AGGCTGCTCCGTAAGAGAAACGG - Intronic
1034946839 7:155267693-155267715 AGGCAGCTGCAGCTGGGAAAGGG - Intergenic
1035138150 7:156728556-156728578 TGGCAGCTCCCTCAGCTAAATGG - Intronic
1035341464 7:158165239-158165261 AGGCAGGACCATCAAGGAAAGGG + Intronic
1035420108 7:158722538-158722560 AGGCAGCCCCATCAGTGGATGGG - Intergenic
1035811079 8:2491686-2491708 AGGAAGGTCCATCAGTCAATTGG + Intergenic
1036428206 8:8666014-8666036 AGGCATCTCCATCAGTGAGGCGG + Intergenic
1037835656 8:22213480-22213502 AGGCAGCTCCACCAGTGTAGAGG - Intergenic
1039448168 8:37648935-37648957 AGGCAGCACAGTCAGGGAAAAGG + Intergenic
1046244977 8:111547592-111547614 ATGCTTCTCCATCTGTGAAACGG + Intergenic
1048829858 8:138465471-138465493 AGGCAGCTCCATCAGTGAAAAGG - Intronic
1049300993 8:141870117-141870139 AGGCAGCCTCAGCAGAGAAATGG - Intergenic
1051855110 9:21556305-21556327 AGGCAGCACAATCACAGAAATGG + Intergenic
1051870859 9:21736006-21736028 AGGCAGATTAATCGGTGAAAAGG + Intergenic
1052430757 9:28363545-28363567 AGGCAGCATCATCAGCAAAAAGG + Intronic
1053370704 9:37559350-37559372 AGACAGCTGCTTCACTGAAAGGG - Intronic
1053460900 9:38270699-38270721 AAGCAGTTCCCACAGTGAAAAGG - Intergenic
1059806082 9:117802152-117802174 AAGCAGTTCAATCGGTGAAATGG + Intergenic
1061924561 9:133799581-133799603 AGGCATCACCATCATTGCAAAGG + Intronic
1062478447 9:136740936-136740958 GGGCATCTCTTTCAGTGAAAGGG - Exonic
1203363445 Un_KI270442v1:237673-237695 TGGCAGCCCCATCATTGTAAAGG - Intergenic
1185920290 X:4083923-4083945 AGGCAGATTAATCAGAGAAAAGG + Intergenic
1186031262 X:5371810-5371832 AGGAAGCTCCAGAAATGAAATGG - Intergenic
1186374220 X:8981078-8981100 AGACAGCTCCAACAGTGAGGAGG - Intergenic
1186952601 X:14643756-14643778 TGACAGCTCCATCAATGCAATGG + Intronic
1188510607 X:30932139-30932161 AGGAAGCTACAACAGAGAAAGGG + Intronic
1189238874 X:39510094-39510116 GGTCAGCTCCATCAGGGAAAAGG - Intergenic
1192225280 X:69223166-69223188 AGGCAGATTAATCAGAGAAAAGG + Intergenic
1198415388 X:136414692-136414714 AGGAACCTCAATCAGAGAAAAGG + Intronic
1199704879 X:150415336-150415358 AGGCATCTTCATCATTTAAAAGG + Intronic