ID: 1048829946

View in Genome Browser
Species Human (GRCh38)
Location 8:138466129-138466151
Sequence CTGGAGCTCTTGTTGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 223}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048829946_1048829957 19 Left 1048829946 8:138466129-138466151 CCCTCTTCCAACAAGAGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1048829957 8:138466171-138466193 GACCTGGAAGGGGCCTGCGGTGG No data
1048829946_1048829960 23 Left 1048829946 8:138466129-138466151 CCCTCTTCCAACAAGAGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1048829960 8:138466175-138466197 TGGAAGGGGCCTGCGGTGGAGGG No data
1048829946_1048829952 3 Left 1048829946 8:138466129-138466151 CCCTCTTCCAACAAGAGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1048829952 8:138466155-138466177 TTGCTCATATGCAGAGGACCTGG No data
1048829946_1048829954 8 Left 1048829946 8:138466129-138466151 CCCTCTTCCAACAAGAGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1048829954 8:138466160-138466182 CATATGCAGAGGACCTGGAAGGG No data
1048829946_1048829951 -3 Left 1048829946 8:138466129-138466151 CCCTCTTCCAACAAGAGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1048829951 8:138466149-138466171 CAGGTCTTGCTCATATGCAGAGG No data
1048829946_1048829959 22 Left 1048829946 8:138466129-138466151 CCCTCTTCCAACAAGAGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1048829959 8:138466174-138466196 CTGGAAGGGGCCTGCGGTGGAGG No data
1048829946_1048829955 9 Left 1048829946 8:138466129-138466151 CCCTCTTCCAACAAGAGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1048829955 8:138466161-138466183 ATATGCAGAGGACCTGGAAGGGG No data
1048829946_1048829953 7 Left 1048829946 8:138466129-138466151 CCCTCTTCCAACAAGAGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1048829953 8:138466159-138466181 TCATATGCAGAGGACCTGGAAGG No data
1048829946_1048829961 29 Left 1048829946 8:138466129-138466151 CCCTCTTCCAACAAGAGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1048829961 8:138466181-138466203 GGGCCTGCGGTGGAGGGTAAAGG No data
1048829946_1048829956 16 Left 1048829946 8:138466129-138466151 CCCTCTTCCAACAAGAGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1048829956 8:138466168-138466190 GAGGACCTGGAAGGGGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048829946 Original CRISPR CTGGAGCTCTTGTTGGAAGA GGG (reversed) Intronic
900297423 1:1958957-1958979 CCTGAGCTGCTGTTGGAAGAAGG + Intronic
900359148 1:2279547-2279569 CTGGAGCTGTTGTCAGAGGAGGG - Intronic
900570414 1:3355511-3355533 TTGCAGCTCTTGTTTGAAGGAGG + Intronic
900574455 1:3376145-3376167 CTGGAGCTTTTGAAGGGAGAGGG + Intronic
900894966 1:5476989-5477011 CTGCGGCTCTTTGTGGAAGATGG + Intergenic
902652255 1:17844548-17844570 CTGGAGCTCCTGCTGGGAGGAGG + Intergenic
904605867 1:31697245-31697267 CCGGAGCTCGTGCTGGAGGAGGG - Exonic
912578250 1:110695417-110695439 ATCGGGCTCTTGTTGGTAGAAGG + Intergenic
913081300 1:115389461-115389483 CTGGAGCTTCTGTTCCAAGATGG - Intergenic
914406341 1:147377494-147377516 CTGTGGCTCTTGGAGGAAGAAGG - Intergenic
914647508 1:149667205-149667227 GTGGAGCTATTCTGGGAAGAGGG - Intergenic
914906462 1:151749970-151749992 CTGGGGCTCTAGTTTGCAGATGG - Intergenic
915016297 1:152737259-152737281 TTGGAGCTCATGTAGAAAGATGG + Intergenic
915515337 1:156409413-156409435 CTGGGTCTCTGGTTGGATGATGG + Intronic
916838053 1:168569628-168569650 CTAGAGATCTGTTTGGAAGAAGG + Intergenic
917008528 1:170444347-170444369 CTGGAGCTCTTCTTGACACATGG - Intergenic
918000961 1:180495118-180495140 CTGGAGGGATTTTTGGAAGAAGG - Intronic
919090868 1:192977847-192977869 CTGGAGAGCTTCTTGGAAAAGGG + Intergenic
919786465 1:201261463-201261485 CTGGAGCTACTGGGGGAAGAGGG - Intergenic
922427105 1:225508982-225509004 CTGGATTTCTTGTTGCATGAAGG + Intronic
1063577906 10:7278519-7278541 CTGGAGCTCCTGATGGGACAGGG + Intronic
1065915710 10:30353519-30353541 TGGGAGCCCTTGTTGGAATAGGG - Intronic
1065970192 10:30799879-30799901 CGGGAGCCCTTGTGGGAAGGAGG - Intergenic
1069851549 10:71408664-71408686 CTGGAGCTCAGGCCGGAAGAAGG + Intronic
1072374868 10:94804115-94804137 CTGGAGCTCTGCTTTGAGGATGG + Intronic
1074766408 10:116703240-116703262 CTGAAGCTCTTGTCCTAAGAGGG - Intronic
1074972502 10:118550656-118550678 CTGGTGATCAGGTTGGAAGATGG + Intergenic
1076202424 10:128569178-128569200 CTGGGGGTCTTGGTGGCAGATGG - Intergenic
1076754987 10:132564758-132564780 TTGGAGCTCCTGGTGGCAGATGG + Intronic
1077847588 11:6042232-6042254 CTGAAGCTTTTGTTGGGAAAAGG + Intergenic
1079078852 11:17399990-17400012 CAGGAGCACTTGTTTGATGATGG + Intronic
1083533349 11:63445826-63445848 CTCTAGCTGCTGTTGGAAGAAGG + Intergenic
1084715293 11:70869774-70869796 ATGGTGGTGTTGTTGGAAGATGG + Intronic
1085531518 11:77194860-77194882 CTGGAGTTCTTTTAGGAAAAAGG - Intronic
1087205328 11:95388038-95388060 TTGGAGCTCTAATAGGAAGAGGG + Intergenic
1088919484 11:114250940-114250962 CTGGGGGTCTTGGTGGAGGAAGG - Intergenic
1092814568 12:12301584-12301606 CTGGGGCTCTAGCTGGCAGATGG + Intergenic
1093055523 12:14552447-14552469 ATGGAGCTATTGTTTCAAGATGG + Intronic
1094434109 12:30402263-30402285 CTGAAGCTCGTTTTGCAAGAAGG + Intergenic
1095134972 12:38589423-38589445 CAGGATCTCTAGTTGGAAAATGG + Intergenic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1102024153 12:109703979-109704001 CTGGAGCTGCAGTGGGAAGATGG - Intergenic
1102813589 12:115844356-115844378 CTTGAGGCCTTGTGGGAAGAAGG - Intergenic
1103842324 12:123875267-123875289 CTGAAGCTGCTGTTGGAAAAAGG + Exonic
1106165545 13:27242542-27242564 ATGGAGGTCTAGTAGGAAGAAGG + Intergenic
1106759868 13:32857997-32858019 CCGGGGCTCTTGTTAGAAGTGGG + Intergenic
1107311594 13:39083868-39083890 GTGGAGCCCTTGGAGGAAGAGGG - Intergenic
1107659438 13:42624044-42624066 ATGCAGCCCTTGCTGGAAGAGGG - Intergenic
1107988863 13:45799584-45799606 CTGGAGCTCAGGATGGAGGATGG + Intronic
1108123244 13:47212579-47212601 CTGTAGCTGGTGTAGGAAGATGG + Intergenic
1108615966 13:52132463-52132485 CTGCAGATCTTGTCAGAAGATGG - Intergenic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1113063283 13:106348482-106348504 CTGGAGCTTTTGATTAAAGAAGG + Intergenic
1114195895 14:20475836-20475858 CTGTACCTCTAGCTGGAAGATGG + Intronic
1114233196 14:20802126-20802148 CTGGAGTTCTTTTTCTAAGAGGG - Intronic
1116252608 14:42506111-42506133 CTGGAGTCCTTGGTGGAAAATGG - Intergenic
1117024173 14:51603141-51603163 CTGGAGTTCTGGTTGGTAGATGG - Intronic
1117691013 14:58306023-58306045 TTGGAGCTATTGTTGAAACAAGG + Exonic
1117881600 14:60318121-60318143 CTGGTGCTGTTATGGGAAGATGG - Intergenic
1119211486 14:72835566-72835588 CTGGAGCTCCTGCTGCAAGCTGG - Intronic
1119473312 14:74912427-74912449 CTGGAGGTCCAGTTGGAACAGGG - Intronic
1120748739 14:88177664-88177686 CTGGTGCTCTTGTGGAATGATGG + Intergenic
1121571472 14:94949763-94949785 CTGGTGCTCTTGTTAGGAGTTGG + Intergenic
1122141167 14:99663927-99663949 CTGGAGCTCCTGATGGCAAATGG + Intronic
1122780926 14:104143183-104143205 CTGGAGCTCTTGGGGGCATAAGG - Intronic
1127621075 15:60735357-60735379 CTGTAGCTCTTTTAAGAAGAGGG + Intronic
1127777790 15:62281493-62281515 ATGGAGTTCTTGTTGTAAGTGGG - Intergenic
1128718117 15:69925018-69925040 CTGGAGTTCTTGTTGGTGGACGG + Intergenic
1131646441 15:94350067-94350089 CTGGAGGACTTGTTCAAAGATGG - Intronic
1131914561 15:97250907-97250929 GTGGAGCCCTTGGAGGAAGAGGG + Intergenic
1132028578 15:98422255-98422277 CCGGAGCGCTTGTTGAAACAAGG + Intergenic
1133983890 16:10653261-10653283 CTGGAACTCTGGTGGGAAGAGGG + Intronic
1140425758 16:74859911-74859933 CTGGAGTTCATGGTGGATGAAGG - Intergenic
1140677804 16:77350715-77350737 CTAGAGCTTTTGTTAGAATATGG + Intronic
1141518248 16:84560589-84560611 ATGGAGCTGCTGTTGGAAAAAGG + Intergenic
1143365711 17:6407087-6407109 ATGCAGCTCTTGTTGGTGGAGGG - Intronic
1145045757 17:19614261-19614283 CTGGAGCTCTACTGGGAAGACGG + Intergenic
1146583105 17:34057512-34057534 CTGGAGCTTTAGTAGGAGGACGG + Intronic
1147391620 17:40112743-40112765 CAGGAGATCATGTTGGAGGAAGG - Intergenic
1147744571 17:42687395-42687417 CTGGAGCTCTGTTGGGAAGCTGG + Intronic
1147760451 17:42794760-42794782 CTGGAGCTCTTCTGGGAAGGAGG - Exonic
1148020162 17:44548130-44548152 CTGAAGCTGTTGTTGGGAGTTGG - Intergenic
1148190052 17:45672125-45672147 CTGGAGCTGGGGTTGGAAGAGGG - Intergenic
1148738010 17:49875704-49875726 CTGGCCCTCTTGCTGGAAGCTGG - Intergenic
1149782218 17:59407122-59407144 CTGGAGCCCTTGCTGTAGGAGGG + Intergenic
1149924239 17:60687229-60687251 CGGTTGCTCTTGTTTGAAGAAGG + Intronic
1151681979 17:75627126-75627148 GTGGAGCTGCTGCTGGAAGAAGG - Exonic
1152135571 17:78501357-78501379 CCGGAGCTCTTGTTGCCAGGTGG + Intronic
1156253433 18:35373966-35373988 CTGAAGCTCTTTTGGGAGGATGG + Exonic
1159037031 18:63287108-63287130 CTAGAGCTCTTGTGAGAAAAGGG - Intronic
1163332986 19:16653193-16653215 CTGGAACTTTTATTGGAACATGG - Intronic
1163416220 19:17188100-17188122 AAGGAGCTCTCTTTGGAAGAGGG - Intronic
1163814594 19:19456731-19456753 CTGGACCTCTTGGTGTGAGAGGG + Intronic
1164699734 19:30276121-30276143 CTGGAGCTCTTGGTGGCTGTGGG + Intronic
1164935349 19:32206090-32206112 CTGGCTCTCTTGTTGTCAGATGG - Intergenic
1165099771 19:33432117-33432139 CAGGAGCTCTGGGTGGAGGAAGG - Intronic
1165690129 19:37856425-37856447 CAGGAGATCCTGTGGGAAGAGGG + Intergenic
1167757568 19:51421971-51421993 CAGGAGGTTTTGTCGGAAGAAGG + Intergenic
925441906 2:3895319-3895341 CTGCAGCTGCTGTGGGAAGATGG + Intergenic
925719410 2:6813150-6813172 CTGTAGCTGATGTTGGAGGAAGG - Intergenic
926139145 2:10358082-10358104 CTGGAGGAGTTGCTGGAAGAAGG + Intronic
926295023 2:11562760-11562782 CTGGAGCTCCTGTTTCAGGAGGG - Intronic
926611330 2:14951304-14951326 CTGGAGCTCTAGCTTTAAGATGG - Intergenic
929436388 2:41931730-41931752 CTGCATCTTTTGTTGGAAGTTGG + Intergenic
931314503 2:61115167-61115189 CTGGAGCTTTTGTTATAGGAAGG + Intronic
932082348 2:68726532-68726554 CTGGTGCTCTACCTGGAAGAAGG - Intronic
932334457 2:70922182-70922204 CTAGAGCTCTGGCTGAAAGAAGG - Intronic
933702057 2:85262771-85262793 CTGGAGAACTTATTGGAGGATGG - Intronic
933702161 2:85263292-85263314 CTGGAGCTTTTGTTGGGGGTAGG + Intronic
935541447 2:104353691-104353713 CTGGAGATGTTGTCTGAAGATGG - Intergenic
936954229 2:118008588-118008610 CTGGAGCTCTTGGTTGCAGCTGG - Exonic
937726145 2:125168636-125168658 CTGGATCTGATGTAGGAAGAGGG + Intergenic
938115802 2:128602301-128602323 CTGGAGCTGGTGTTGGGATAGGG + Intergenic
940638983 2:156329032-156329054 CTGGAGCCGGAGTTGGAAGAGGG - Intronic
940817680 2:158313813-158313835 CTGGAGATCTCTTTGGAAGAAGG - Exonic
943138959 2:183954028-183954050 CTGGACCTCTGATTAGAAGAGGG - Intergenic
943652054 2:190467822-190467844 ATTCAGCTCTTGTTGGAACATGG + Intronic
943758867 2:191587079-191587101 GTGGAGCCCTTGGAGGAAGAGGG - Intergenic
944839748 2:203613774-203613796 TTGGAGTTCATGTTGGAACACGG + Intergenic
944901400 2:204220234-204220256 CTGGAGCCCTTATAAGAAGATGG - Intergenic
945973422 2:216252377-216252399 CTGCATTTCTTCTTGGAAGAGGG + Intergenic
947946014 2:234102858-234102880 CTGGAGCTCTGGTGGAAAAAAGG + Intergenic
948420403 2:237856573-237856595 CTGGAGCCCCTGGAGGAAGATGG - Intergenic
949010919 2:241677868-241677890 CTGGCGCTCGTGTCTGAAGAGGG + Intronic
1170874482 20:20237350-20237372 CTGGAGCTCCTGTAGGAATGAGG - Intronic
1170949606 20:20924788-20924810 CTGGACCTCTTGCTCCAAGAAGG + Intergenic
1172046319 20:32083179-32083201 CTTGAGTTCTTGTTAGAAGGAGG - Intronic
1173344433 20:42185760-42185782 CTGAAACTCTTGTTGACAGATGG - Intronic
1173367874 20:42403958-42403980 CTGGAGCTTTTGTTGGAAATGGG - Intronic
1173676258 20:44838391-44838413 CTGGACTTCTTGTTGGGTGAGGG - Intergenic
1173828482 20:46062744-46062766 CTGAAGCTCTTGCTGGGAGGTGG + Exonic
1173934534 20:46849828-46849850 CTTGATCTCTGCTTGGAAGAAGG + Intergenic
1174100616 20:48123794-48123816 CTGGAACCCTTGTGGGAAGCCGG - Intergenic
1175477925 20:59290070-59290092 AAGGAGCTCTTGTTGGGGGAAGG + Intergenic
1175954039 20:62599241-62599263 TTGGAGCTTCTGTAGGAAGATGG - Intergenic
1176520112 21:7818042-7818064 CTGGAGTCCTTATCGGAAGAGGG - Exonic
1178640862 21:34343888-34343910 CTGGAGCTCTTGCTGGCTGAGGG + Intergenic
1178654138 21:34448054-34448076 CTGGAGTCCTTATCGGAAGAGGG - Intergenic
1179027460 21:37691472-37691494 TGGCAGCTCTTGTTGGAAGGTGG + Intronic
1181109008 22:20590576-20590598 CAGGAGCTCTGCTTGGAGGAGGG + Intergenic
1181724911 22:24805038-24805060 CAGGGGCTCTTGATGGAACAAGG + Intergenic
1182624141 22:31633790-31633812 GTGGAGGTCTGGTTGGAAGGTGG - Intronic
1184170577 22:42757168-42757190 CAGGAGCTCTTTTTCGAAGTGGG - Intergenic
1185314159 22:50171548-50171570 CTGGAGCTCCTGCAGGGAGATGG + Intronic
949180262 3:1121393-1121415 ATGAAGCTCATGTTGCAAGATGG + Intronic
949543739 3:5054471-5054493 CTGGAGCTGAGGTAGGAAGAGGG - Intergenic
949624658 3:5852689-5852711 CAGGAGCTCTGGTTGAAATAAGG - Intergenic
953617808 3:44507770-44507792 CTGGGGCTCTTTTTAAAAGAAGG - Intronic
953851376 3:46467821-46467843 TTGGAACTCTTGTTGGAAGAAGG + Intronic
955147121 3:56330926-56330948 CTGAATCTCTTGCTGGAAAACGG - Intronic
956998100 3:74851200-74851222 CTGGAGGTCTTGTTAAAACACGG + Intergenic
957183670 3:76914797-76914819 CAGGAGCACATGTTGGAAGAAGG + Intronic
958919011 3:100082043-100082065 ATGTAGCACTTTTTGGAAGATGG - Intronic
960373893 3:116874793-116874815 CTGGAACTCCTGGTGGAAGCTGG - Intronic
961383389 3:126510218-126510240 CTGGAGGCCTTGTGGGAACATGG - Intronic
964072752 3:152654446-152654468 CTGGTTCTCATGTTGAAAGATGG + Intergenic
966076599 3:175942516-175942538 CTAGATCTCTTGTTAGAATAGGG - Intergenic
966432345 3:179845636-179845658 TTGGAGCTGTTGATAGAAGAAGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968181306 3:196597438-196597460 AAGGATCTCTTGTAGGAAGATGG + Intergenic
969351084 4:6598304-6598326 CTGGAGCTCATCTAGGACGATGG - Exonic
970690474 4:18613671-18613693 CAGAAGCTCTTGCTGGTAGAAGG - Intergenic
973981824 4:56314301-56314323 CAGGAGCTCTTGGAGGAGGAGGG + Exonic
974062330 4:57046654-57046676 CTGGAGCTCTTAATGGAACAAGG - Intronic
980247961 4:130271948-130271970 CTGGAGACCTTGTAGGGAGATGG - Intergenic
981737859 4:147971647-147971669 ATGCAGCTCTTGTTGGAACATGG + Intronic
982466399 4:155738433-155738455 CTGTAACTCTTGTCTGAAGAAGG - Intergenic
982522380 4:156434702-156434724 CTGGATCTCATACTGGAAGAAGG + Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984769696 4:183426725-183426747 CTGGAGCTCTGGCAGCAAGATGG - Intergenic
991002112 5:61792847-61792869 CTGCAGCTCATGAAGGAAGATGG - Intergenic
992533403 5:77673387-77673409 CTAGAGCACTTGTGGGTAGATGG - Intergenic
997607258 5:135184033-135184055 CTTGGGCTCCTGTTGGGAGAGGG - Intronic
998331359 5:141330742-141330764 CTGGAGCTGCTGTTGGAAGCTGG + Exonic
1001036775 5:168302457-168302479 CTAGAGCTCTTTTAGGAAGGTGG + Intronic
1001581728 5:172803135-172803157 CTGGAGCACTGTTGGGAAGAGGG + Intergenic
1002317397 5:178351866-178351888 CTGGCGCTCTTATAAGAAGAGGG + Intronic
1002571302 5:180140724-180140746 CTGGAGCTCCTGCTGGAGGGAGG - Intronic
1003714374 6:8630084-8630106 CTGGATCTCATGTTTGCAGATGG + Intergenic
1005224504 6:23626183-23626205 CTGGAGATCTTGCTGAAAGCTGG - Intergenic
1005341268 6:24845798-24845820 CTGGAGCTCAGTGTGGAAGATGG + Intronic
1005805262 6:29468501-29468523 CTGGGGCTCTTGTTGGGACAGGG - Intergenic
1007588331 6:43006514-43006536 CTGGGACGCTTGTTGGATGACGG - Exonic
1008443836 6:51564951-51564973 CTGGAGCTCCTGTTAGAGTAGGG + Intergenic
1016672079 6:146720930-146720952 CTGAAGCTCCTGTGGAAAGAAGG + Intronic
1017556830 6:155580892-155580914 ATTGAGCTCTTGTTGGAAAATGG + Intergenic
1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG + Intergenic
1018392962 6:163354572-163354594 ATGGAGCTCTCTTTGGAAAATGG + Intergenic
1019919869 7:4156740-4156762 ATGGAGCTCTTGTTGGCTGATGG + Intronic
1021244536 7:18245423-18245445 CTAGAGTTTTTGTTTGAAGATGG - Intronic
1022028971 7:26474694-26474716 CTGGCGCTCTTGATGAAAGCAGG - Intergenic
1024921051 7:54554780-54554802 CTGGAGCTGTGGCTGGAGGAAGG - Intronic
1025986735 7:66459759-66459781 TTGGACCACTTGATGGAAGATGG - Intergenic
1026362530 7:69615822-69615844 CAGGAGTGCTTCTTGGAAGATGG - Intronic
1027052893 7:75030901-75030923 CTGGGGCTCATTCTGGAAGAAGG + Intronic
1028074058 7:86489068-86489090 CTGGAGTTCTGTTTGGCAGAAGG + Intergenic
1028075587 7:86510395-86510417 ATGCAGCTCTTCTTGGAACAGGG - Intergenic
1030538357 7:110797006-110797028 CTGGCACTCTTCTTGGAAGTGGG - Intronic
1031115890 7:117667981-117668003 CTGGAGCTTCTGTGGAAAGAAGG - Exonic
1032207940 7:129885128-129885150 GTGGAGCTCTGGTTGGAAAGAGG - Intronic
1032646088 7:133825480-133825502 CTGGAGCTCTTACTGAAAGTTGG + Intronic
1033477291 7:141702767-141702789 CTGGAGCATTTGTGGGACGAGGG + Intergenic
1034069092 7:148165266-148165288 CTGGTGTTCTTGTAAGAAGAGGG - Intronic
1034667566 7:152831761-152831783 CTGGACCTCATGTTTGAACATGG + Intronic
1034971522 7:155422668-155422690 CCGGGGCTCCTGTTGGGAGAAGG + Intergenic
1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG + Intergenic
1036914021 8:12786820-12786842 CTGGAGGCCTTGTTGAAACAAGG - Intergenic
1038238564 8:25785834-25785856 CTGGAGCTCATGTTTGGAAATGG + Intergenic
1039308885 8:36294352-36294374 CTGGACAGCTTGTTGGCAGACGG - Intergenic
1039665918 8:39527959-39527981 CTGAAGTTCCTGTTGGAGGAAGG - Intergenic
1042663103 8:71177521-71177543 CTTGGGCTCTTTGTGGAAGAAGG + Intergenic
1047113054 8:121812224-121812246 GTGGAGCGCTTGCTGGAATAAGG + Intergenic
1047301343 8:123616121-123616143 CTGTAGCTCAGGTAGGAAGATGG - Intergenic
1048028048 8:130604837-130604859 CTGGATCTCTTTTGGGAACATGG + Intergenic
1048670262 8:136711388-136711410 CTGGAGAACATGTTGGAAGATGG - Intergenic
1048829946 8:138466129-138466151 CTGGAGCTCTTGTTGGAAGAGGG - Intronic
1048992151 8:139766765-139766787 GGGGAGCTCTTGTGGGCAGAGGG - Intronic
1049713589 8:144078738-144078760 CTGGAGCTCTTGTCGGACCAGGG + Exonic
1050636041 9:7614256-7614278 CTGGAGCCATAGTGGGAAGAGGG - Intergenic
1052853544 9:33392877-33392899 CTGGAGGACTTGTGTGAAGAAGG - Intronic
1053494573 9:38541018-38541040 CTGGTGCTCTTGTCTGATGAAGG + Exonic
1053712914 9:40840945-40840967 TTGGAGCTCTTTTTGGCATATGG + Intergenic
1053791505 9:41689459-41689481 CTGTAGCCCTTGGTGGGAGATGG + Intergenic
1054179907 9:61901473-61901495 CTGTAGCCCTTGGTGGGAGATGG + Intergenic
1054423443 9:64974193-64974215 TTGGAGCTCTTTTTGGCATATGG + Intergenic
1054657685 9:67679668-67679690 CTGTAGCCCTTGGTGGGAGATGG - Intergenic
1055241409 9:74190858-74190880 CTGGAGATCTCAATGGAAGAAGG - Intergenic
1058102029 9:100926958-100926980 TTAGATTTCTTGTTGGAAGAAGG + Intergenic
1058632210 9:107000855-107000877 TTGGAGCTCTTGGTGACAGAAGG - Intronic
1058873035 9:109218775-109218797 CTGGAAGTCTTCCTGGAAGAAGG - Intronic
1059311493 9:113391573-113391595 CTGAGGCCCTTGGTGGAAGAGGG - Exonic
1059338965 9:113586676-113586698 CTGAAGCTACTGGTGGAAGAGGG - Intronic
1060794307 9:126504026-126504048 CTGGAGCTATTGTTGGCATGTGG - Exonic
1061611668 9:131750717-131750739 CTGGGGCTGGTGGTGGAAGAAGG - Intergenic
1062056828 9:134473114-134473136 CTGAACCTCTGGTTGGAAGCTGG - Intergenic
1186507827 X:10108208-10108230 CTGGAAAACGTGTTGGAAGATGG - Intronic
1191848594 X:65569163-65569185 CTGGAGCTTTTGTGAGGAGAGGG - Intergenic
1192261455 X:69508147-69508169 CTGGGTCTTTTGTGGGAAGAAGG + Intronic
1192682304 X:73264292-73264314 ATGGAGCTCTTCAAGGAAGAAGG + Intergenic
1192704742 X:73517921-73517943 CTTGAGCTCTGCTTGCAAGATGG + Intergenic
1193047101 X:77065164-77065186 CAGGTGCTCTTTTTGGAAGGTGG - Intergenic
1193937007 X:87635732-87635754 CTGGAGCAATGGTTGGAAGCAGG - Exonic
1195608806 X:106840133-106840155 CTCGAGATCTTGTTGTAAGAGGG + Exonic
1201549136 Y:15200913-15200935 CTGCAGCTCATGGTGGATGATGG - Intergenic