ID: 1048835646

View in Genome Browser
Species Human (GRCh38)
Location 8:138516382-138516404
Sequence GGTGATTTACTGCAAGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048835646_1048835651 14 Left 1048835646 8:138516382-138516404 CCAGTCCCTTGCAGTAAATCACC No data
Right 1048835651 8:138516419-138516441 ACTAGCCACATGCTCTTAAGTGG No data
1048835646_1048835652 15 Left 1048835646 8:138516382-138516404 CCAGTCCCTTGCAGTAAATCACC No data
Right 1048835652 8:138516420-138516442 CTAGCCACATGCTCTTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048835646 Original CRISPR GGTGATTTACTGCAAGGGAC TGG (reversed) Intergenic
No off target data available for this crispr