ID: 1048835651

View in Genome Browser
Species Human (GRCh38)
Location 8:138516419-138516441
Sequence ACTAGCCACATGCTCTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048835648_1048835651 9 Left 1048835648 8:138516387-138516409 CCCTTGCAGTAAATCACCAGGTG No data
Right 1048835651 8:138516419-138516441 ACTAGCCACATGCTCTTAAGTGG No data
1048835644_1048835651 23 Left 1048835644 8:138516373-138516395 CCAGCTAGCCCAGTCCCTTGCAG No data
Right 1048835651 8:138516419-138516441 ACTAGCCACATGCTCTTAAGTGG No data
1048835646_1048835651 14 Left 1048835646 8:138516382-138516404 CCAGTCCCTTGCAGTAAATCACC No data
Right 1048835651 8:138516419-138516441 ACTAGCCACATGCTCTTAAGTGG No data
1048835649_1048835651 8 Left 1048835649 8:138516388-138516410 CCTTGCAGTAAATCACCAGGTGA No data
Right 1048835651 8:138516419-138516441 ACTAGCCACATGCTCTTAAGTGG No data
1048835645_1048835651 15 Left 1048835645 8:138516381-138516403 CCCAGTCCCTTGCAGTAAATCAC No data
Right 1048835651 8:138516419-138516441 ACTAGCCACATGCTCTTAAGTGG No data
1048835650_1048835651 -7 Left 1048835650 8:138516403-138516425 CCAGGTGAAGTCATTTACTAGCC No data
Right 1048835651 8:138516419-138516441 ACTAGCCACATGCTCTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048835651 Original CRISPR ACTAGCCACATGCTCTTAAG TGG Intergenic
No off target data available for this crispr