ID: 1048840203

View in Genome Browser
Species Human (GRCh38)
Location 8:138558904-138558926
Sequence ATCACAGGAGCTGGAGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048840203_1048840207 7 Left 1048840203 8:138558904-138558926 CCTAGGGCTCCAGCTCCTGTGAT No data
Right 1048840207 8:138558934-138558956 CCATCATTGTGTTTGCAACAAGG No data
1048840203_1048840208 23 Left 1048840203 8:138558904-138558926 CCTAGGGCTCCAGCTCCTGTGAT No data
Right 1048840208 8:138558950-138558972 AACAAGGCCATGCCTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048840203 Original CRISPR ATCACAGGAGCTGGAGCCCT AGG (reversed) Intergenic
No off target data available for this crispr