ID: 1048840204

View in Genome Browser
Species Human (GRCh38)
Location 8:138558913-138558935
Sequence GGATATCAAATCACAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048840204_1048840207 -2 Left 1048840204 8:138558913-138558935 CCAGCTCCTGTGATTTGATATCC No data
Right 1048840207 8:138558934-138558956 CCATCATTGTGTTTGCAACAAGG No data
1048840204_1048840211 28 Left 1048840204 8:138558913-138558935 CCAGCTCCTGTGATTTGATATCC No data
Right 1048840211 8:138558964-138558986 TCCAACAGGCAACTACCCACTGG No data
1048840204_1048840208 14 Left 1048840204 8:138558913-138558935 CCAGCTCCTGTGATTTGATATCC No data
Right 1048840208 8:138558950-138558972 AACAAGGCCATGCCTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048840204 Original CRISPR GGATATCAAATCACAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr