ID: 1048840206

View in Genome Browser
Species Human (GRCh38)
Location 8:138558934-138558956
Sequence CCTTGTTGCAAACACAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048840206_1048840213 18 Left 1048840206 8:138558934-138558956 CCATCATTGTGTTTGCAACAAGG No data
Right 1048840213 8:138558975-138558997 ACTACCCACTGGCCAGTAACTGG No data
1048840206_1048840211 7 Left 1048840206 8:138558934-138558956 CCATCATTGTGTTTGCAACAAGG No data
Right 1048840211 8:138558964-138558986 TCCAACAGGCAACTACCCACTGG No data
1048840206_1048840214 19 Left 1048840206 8:138558934-138558956 CCATCATTGTGTTTGCAACAAGG No data
Right 1048840214 8:138558976-138558998 CTACCCACTGGCCAGTAACTGGG No data
1048840206_1048840208 -7 Left 1048840206 8:138558934-138558956 CCATCATTGTGTTTGCAACAAGG No data
Right 1048840208 8:138558950-138558972 AACAAGGCCATGCCTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048840206 Original CRISPR CCTTGTTGCAAACACAATGA TGG (reversed) Intergenic
No off target data available for this crispr