ID: 1048840213

View in Genome Browser
Species Human (GRCh38)
Location 8:138558975-138558997
Sequence ACTACCCACTGGCCAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048840206_1048840213 18 Left 1048840206 8:138558934-138558956 CCATCATTGTGTTTGCAACAAGG No data
Right 1048840213 8:138558975-138558997 ACTACCCACTGGCCAGTAACTGG No data
1048840210_1048840213 -10 Left 1048840210 8:138558962-138558984 CCTCCAACAGGCAACTACCCACT No data
Right 1048840213 8:138558975-138558997 ACTACCCACTGGCCAGTAACTGG No data
1048840209_1048840213 -5 Left 1048840209 8:138558957-138558979 CCATGCCTCCAACAGGCAACTAC No data
Right 1048840213 8:138558975-138558997 ACTACCCACTGGCCAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048840213 Original CRISPR ACTACCCACTGGCCAGTAAC TGG Intergenic
No off target data available for this crispr