ID: 1048840214

View in Genome Browser
Species Human (GRCh38)
Location 8:138558976-138558998
Sequence CTACCCACTGGCCAGTAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048840206_1048840214 19 Left 1048840206 8:138558934-138558956 CCATCATTGTGTTTGCAACAAGG No data
Right 1048840214 8:138558976-138558998 CTACCCACTGGCCAGTAACTGGG No data
1048840210_1048840214 -9 Left 1048840210 8:138558962-138558984 CCTCCAACAGGCAACTACCCACT No data
Right 1048840214 8:138558976-138558998 CTACCCACTGGCCAGTAACTGGG No data
1048840209_1048840214 -4 Left 1048840209 8:138558957-138558979 CCATGCCTCCAACAGGCAACTAC No data
Right 1048840214 8:138558976-138558998 CTACCCACTGGCCAGTAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048840214 Original CRISPR CTACCCACTGGCCAGTAACT GGG Intergenic
No off target data available for this crispr