ID: 1048843020

View in Genome Browser
Species Human (GRCh38)
Location 8:138581544-138581566
Sequence GCTTGAAGACCTCTCGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048843008_1048843020 27 Left 1048843008 8:138581494-138581516 CCCCATTTAAGGGTGCGTCCTGA No data
Right 1048843020 8:138581544-138581566 GCTTGAAGACCTCTCGTGGCGGG No data
1048843016_1048843020 -3 Left 1048843016 8:138581524-138581546 CCGTGCCTGGAACATTCTCTGCT No data
Right 1048843020 8:138581544-138581566 GCTTGAAGACCTCTCGTGGCGGG No data
1048843012_1048843020 9 Left 1048843012 8:138581512-138581534 CCTGAGCCCCTGCCGTGCCTGGA No data
Right 1048843020 8:138581544-138581566 GCTTGAAGACCTCTCGTGGCGGG No data
1048843010_1048843020 25 Left 1048843010 8:138581496-138581518 CCATTTAAGGGTGCGTCCTGAGC No data
Right 1048843020 8:138581544-138581566 GCTTGAAGACCTCTCGTGGCGGG No data
1048843009_1048843020 26 Left 1048843009 8:138581495-138581517 CCCATTTAAGGGTGCGTCCTGAG No data
Right 1048843020 8:138581544-138581566 GCTTGAAGACCTCTCGTGGCGGG No data
1048843015_1048843020 1 Left 1048843015 8:138581520-138581542 CCTGCCGTGCCTGGAACATTCTC No data
Right 1048843020 8:138581544-138581566 GCTTGAAGACCTCTCGTGGCGGG No data
1048843017_1048843020 -8 Left 1048843017 8:138581529-138581551 CCTGGAACATTCTCTGCTTGAAG No data
Right 1048843020 8:138581544-138581566 GCTTGAAGACCTCTCGTGGCGGG No data
1048843014_1048843020 2 Left 1048843014 8:138581519-138581541 CCCTGCCGTGCCTGGAACATTCT No data
Right 1048843020 8:138581544-138581566 GCTTGAAGACCTCTCGTGGCGGG No data
1048843013_1048843020 3 Left 1048843013 8:138581518-138581540 CCCCTGCCGTGCCTGGAACATTC No data
Right 1048843020 8:138581544-138581566 GCTTGAAGACCTCTCGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048843020 Original CRISPR GCTTGAAGACCTCTCGTGGC GGG Intergenic
No off target data available for this crispr