ID: 1048843075

View in Genome Browser
Species Human (GRCh38)
Location 8:138581881-138581903
Sequence TTGATCCCACAGAAGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048843075_1048843079 8 Left 1048843075 8:138581881-138581903 CCTGATTCCTTCTGTGGGATCAA No data
Right 1048843079 8:138581912-138581934 AATGTATCCCTTCTGAGAGAGGG No data
1048843075_1048843078 7 Left 1048843075 8:138581881-138581903 CCTGATTCCTTCTGTGGGATCAA No data
Right 1048843078 8:138581911-138581933 AAATGTATCCCTTCTGAGAGAGG No data
1048843075_1048843082 28 Left 1048843075 8:138581881-138581903 CCTGATTCCTTCTGTGGGATCAA No data
Right 1048843082 8:138581932-138581954 GGGTGCATTTTGCCTTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048843075 Original CRISPR TTGATCCCACAGAAGGAATC AGG (reversed) Intergenic
No off target data available for this crispr