ID: 1048843181

View in Genome Browser
Species Human (GRCh38)
Location 8:138582627-138582649
Sequence CCCACTATGCCCCACCCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048843179_1048843181 10 Left 1048843179 8:138582594-138582616 CCGTGTTTGCTCAGAGTGAAGGA No data
Right 1048843181 8:138582627-138582649 CCCACTATGCCCCACCCACTCGG No data
1048843176_1048843181 16 Left 1048843176 8:138582588-138582610 CCTGACCCGTGTTTGCTCAGAGT No data
Right 1048843181 8:138582627-138582649 CCCACTATGCCCCACCCACTCGG No data
1048843175_1048843181 24 Left 1048843175 8:138582580-138582602 CCTCAGCACCTGACCCGTGTTTG No data
Right 1048843181 8:138582627-138582649 CCCACTATGCCCCACCCACTCGG No data
1048843177_1048843181 11 Left 1048843177 8:138582593-138582615 CCCGTGTTTGCTCAGAGTGAAGG No data
Right 1048843181 8:138582627-138582649 CCCACTATGCCCCACCCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048843181 Original CRISPR CCCACTATGCCCCACCCACT CGG Intergenic
No off target data available for this crispr