ID: 1048846802

View in Genome Browser
Species Human (GRCh38)
Location 8:138609914-138609936
Sequence CCCTTGGATCTCTGCTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048846794_1048846802 4 Left 1048846794 8:138609887-138609909 CCTGTGTCCTGCTGTCCCTCGCC 0: 1
1: 0
2: 2
3: 29
4: 260
Right 1048846802 8:138609914-138609936 CCCTTGGATCTCTGCTTCCCAGG No data
1048846790_1048846802 27 Left 1048846790 8:138609864-138609886 CCCTCCTGGGCTGCAGAGCCACT 0: 1
1: 0
2: 5
3: 92
4: 1235
Right 1048846802 8:138609914-138609936 CCCTTGGATCTCTGCTTCCCAGG No data
1048846793_1048846802 9 Left 1048846793 8:138609882-138609904 CCACTCCTGTGTCCTGCTGTCCC 0: 1
1: 0
2: 6
3: 52
4: 584
Right 1048846802 8:138609914-138609936 CCCTTGGATCTCTGCTTCCCAGG No data
1048846791_1048846802 26 Left 1048846791 8:138609865-138609887 CCTCCTGGGCTGCAGAGCCACTC 0: 1
1: 0
2: 2
3: 27
4: 439
Right 1048846802 8:138609914-138609936 CCCTTGGATCTCTGCTTCCCAGG No data
1048846792_1048846802 23 Left 1048846792 8:138609868-138609890 CCTGGGCTGCAGAGCCACTCCTG 0: 1
1: 0
2: 4
3: 44
4: 568
Right 1048846802 8:138609914-138609936 CCCTTGGATCTCTGCTTCCCAGG No data
1048846795_1048846802 -3 Left 1048846795 8:138609894-138609916 CCTGCTGTCCCTCGCCAAGCCCC 0: 1
1: 0
2: 1
3: 27
4: 308
Right 1048846802 8:138609914-138609936 CCCTTGGATCTCTGCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048846802 Original CRISPR CCCTTGGATCTCTGCTTCCC AGG Intronic
No off target data available for this crispr