ID: 1048850667

View in Genome Browser
Species Human (GRCh38)
Location 8:138642390-138642412
Sequence CTCTGCCCAACGCAACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048850665_1048850667 0 Left 1048850665 8:138642367-138642389 CCTGCTCCTTGGAACACTGAGCA 0: 1
1: 0
2: 1
3: 77
4: 1255
Right 1048850667 8:138642390-138642412 CTCTGCCCAACGCAACTGCCTGG No data
1048850666_1048850667 -6 Left 1048850666 8:138642373-138642395 CCTTGGAACACTGAGCACTCTGC 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1048850667 8:138642390-138642412 CTCTGCCCAACGCAACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048850667 Original CRISPR CTCTGCCCAACGCAACTGCC TGG Intronic
No off target data available for this crispr