ID: 1048857183

View in Genome Browser
Species Human (GRCh38)
Location 8:138695239-138695261
Sequence CTGATGATCTACCATGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1405
Summary {0: 1, 1: 5, 2: 29, 3: 205, 4: 1165}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048857183_1048857189 20 Left 1048857183 8:138695239-138695261 CCTGGCACATGGTAGATCATCAG 0: 1
1: 5
2: 29
3: 205
4: 1165
Right 1048857189 8:138695282-138695304 GAGAGGAGGAAGGGTCTTTAAGG No data
1048857183_1048857185 3 Left 1048857183 8:138695239-138695261 CCTGGCACATGGTAGATCATCAG 0: 1
1: 5
2: 29
3: 205
4: 1165
Right 1048857185 8:138695265-138695287 ATGATGGAAAGAGTTTTGAGAGG No data
1048857183_1048857186 6 Left 1048857183 8:138695239-138695261 CCTGGCACATGGTAGATCATCAG 0: 1
1: 5
2: 29
3: 205
4: 1165
Right 1048857186 8:138695268-138695290 ATGGAAAGAGTTTTGAGAGGAGG No data
1048857183_1048857187 10 Left 1048857183 8:138695239-138695261 CCTGGCACATGGTAGATCATCAG 0: 1
1: 5
2: 29
3: 205
4: 1165
Right 1048857187 8:138695272-138695294 AAAGAGTTTTGAGAGGAGGAAGG No data
1048857183_1048857188 11 Left 1048857183 8:138695239-138695261 CCTGGCACATGGTAGATCATCAG 0: 1
1: 5
2: 29
3: 205
4: 1165
Right 1048857188 8:138695273-138695295 AAGAGTTTTGAGAGGAGGAAGGG No data
1048857183_1048857191 28 Left 1048857183 8:138695239-138695261 CCTGGCACATGGTAGATCATCAG 0: 1
1: 5
2: 29
3: 205
4: 1165
Right 1048857191 8:138695290-138695312 GAAGGGTCTTTAAGGGCCCCTGG No data
1048857183_1048857190 21 Left 1048857183 8:138695239-138695261 CCTGGCACATGGTAGATCATCAG 0: 1
1: 5
2: 29
3: 205
4: 1165
Right 1048857190 8:138695283-138695305 AGAGGAGGAAGGGTCTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048857183 Original CRISPR CTGATGATCTACCATGTGCC AGG (reversed) Intronic
900009029 1:89128-89150 CTGAGCACCTACTATGTGCCAGG - Intergenic
900034345 1:394505-394527 TTGAGTGTCTACCATGTGCCAGG - Intergenic
900055179 1:624397-624419 TTGAGTGTCTACCATGTGCCAGG - Intergenic
901119369 1:6877937-6877959 CTGAGTATCTACTATGTGCAAGG - Intronic
901885581 1:12220631-12220653 CTGAGCACCTACTATGTGCCTGG - Intergenic
901902406 1:12376458-12376480 TTGAGGCTCTACCCTGTGCCAGG + Intronic
902108451 1:14057846-14057868 TTGAAGACCTACTATGTGCCAGG - Intergenic
902178746 1:14671334-14671356 CTGAGCACCTACTATGTGCCAGG - Intronic
902232209 1:15035271-15035293 ATGATGCTATACTATGTGCCAGG - Intronic
902526670 1:17063274-17063296 CTGAGCATCAACTATGTGCCAGG + Intergenic
902733700 1:18386210-18386232 CTGAACACTTACCATGTGCCAGG - Intergenic
902977324 1:20098396-20098418 CTGATTGTCTACCAGGTGCCAGG + Intergenic
903139164 1:21328374-21328396 CTGAGGACCCACTATGTGCCAGG - Intronic
903141078 1:21339573-21339595 ATGAGCATCTACTATGTGCCTGG - Intronic
903144898 1:21365045-21365067 CTGAGCACCTACTATGTGCCAGG - Intergenic
903183363 1:21616390-21616412 CTGAGTATTTACCATGTGCCAGG + Intronic
903239514 1:21973706-21973728 TTGAAAACCTACCATGTGCCAGG + Intergenic
903243316 1:21998632-21998654 TTGAAAACCTACCATGTGCCAGG + Intronic
903268962 1:22176035-22176057 CTGAGCACCTACTATGTGCCGGG - Intergenic
903354579 1:22738732-22738754 CTGAGGACCAACTATGTGCCTGG + Intronic
903481088 1:23653832-23653854 TTGAGCACCTACCATGTGCCAGG - Intergenic
903496406 1:23770742-23770764 TTTATGATTTACGATGTGCCAGG - Intergenic
903653425 1:24934556-24934578 CTGAGGCTTTACCTTGTGCCAGG + Intronic
903749690 1:25613433-25613455 TTGAACATCTACTATGTGCCAGG - Intergenic
904313672 1:29646081-29646103 ATGAGCATCTACTATGTGCCAGG - Intergenic
904325533 1:29725306-29725328 CTGAGCACCTACTATGTGCCAGG + Intergenic
904338347 1:29812370-29812392 CTGAGCACCTACTATGTGCCAGG - Intergenic
904342587 1:29846463-29846485 CTGAGCACCTACTATGTGCCAGG + Intergenic
904373957 1:30068051-30068073 CTGAGTGTCCACCATGTGCCAGG - Intergenic
904380086 1:30104750-30104772 CTGAGCACCTACTATGTGCCAGG + Intergenic
904407636 1:30303572-30303594 CTGAGCACCTACTATGTGCCAGG + Intergenic
904456843 1:30652907-30652929 CTGAGCATCTACTATGTGCTAGG + Intergenic
904461470 1:30683075-30683097 CTGAGCACCTACTATGTGCCAGG + Intergenic
905043704 1:34979812-34979834 CTGAACATTTACTATGTGCCAGG + Intergenic
905113289 1:35614048-35614070 CTGCTTTTCTACCATGTGTCAGG - Intronic
905364210 1:37440035-37440057 CTGAGGACCTACTATGTGCCAGG - Intergenic
905370636 1:37480930-37480952 CTGAGCATCTACCATGTGCCAGG - Intronic
905520968 1:38599362-38599384 CTGAGGGTCTACCACATGCCAGG - Intergenic
905606285 1:39303233-39303255 TTGAAGATCTACTATGTGGCTGG - Intronic
905937003 1:41832671-41832693 CTAAATATCTACTATGTGCCAGG - Intronic
906276341 1:44518969-44518991 TTGAGCATCTACCCTGTGCCAGG - Intronic
906526543 1:46496530-46496552 TTGAGGATCTGGCATGTGCCAGG + Intergenic
906696375 1:47826024-47826046 CTGAGCATCTATCATCTGCCAGG - Intronic
906816818 1:48887892-48887914 CTGATCATCTACCCTGTGCCAGG - Intronic
906825676 1:48977049-48977071 TTGAGCATCTACTATGTGCCAGG - Intronic
906899001 1:49812784-49812806 CTGCAGAACTACTATGTGCCAGG + Intronic
906924826 1:50104027-50104049 TTGACGGTCTACCATCTGCCAGG - Intronic
906933137 1:50189013-50189035 CTAAACATCTACTATGTGCCAGG - Intronic
906933438 1:50191228-50191250 CTGAGGATCTACTATGAGCCAGG - Intronic
907366106 1:53961481-53961503 TTGAGCATCTACAATGTGCCAGG + Intronic
907396302 1:54192557-54192579 CTGAGCATCTACCATGTGCCAGG + Intronic
907470886 1:54672805-54672827 CTGAGAATCTACCATGGACCAGG - Intronic
907944873 1:59126455-59126477 CTCAATATCTACCATATGCCAGG + Intergenic
908113150 1:60916749-60916771 CTGAGCACCTACCATGTGCCAGG - Intronic
908137142 1:61144756-61144778 CTGAGCATGTACCCTGTGCCAGG - Intronic
908186320 1:61656175-61656197 CTGAATATCTATTATGTGCCAGG + Intergenic
908263388 1:62355887-62355909 CTGATGACTTACTATGTGCCTGG + Intergenic
908329979 1:63062006-63062028 TTGAGGATCTACTATGTTCCAGG - Intergenic
908407391 1:63828730-63828752 CTGAACACCTACTATGTGCCAGG - Intronic
908440931 1:64153588-64153610 ATGATGCTGTACCATGTGACAGG - Intronic
908536411 1:65082166-65082188 TTGAACACCTACCATGTGCCAGG - Intergenic
908855594 1:68423399-68423421 CTGATTATCTACTGTGTGCCAGG - Intergenic
909339218 1:74512702-74512724 ATGAGTAACTACCATGTGCCAGG - Intronic
909470589 1:76023472-76023494 CTGAACATCTACTATGTGCCAGG - Intergenic
909546637 1:76855527-76855549 CTGAGGGCCTACTATGTGCCAGG + Intergenic
909554621 1:76939739-76939761 CTGATCACCTGCCGTGTGCCAGG + Intronic
909777680 1:79503081-79503103 CTGATAATTTAGTATGTGCCAGG - Intergenic
910557375 1:88550669-88550691 CTGAGTATCTACCATGTGTCAGG + Intergenic
910890659 1:92016325-92016347 TTGATTATCTGCAATGTGCCAGG - Intergenic
910976691 1:92914177-92914199 CTGATAATCTAGTATGTGTCAGG - Intronic
911052753 1:93685102-93685124 TTGAGCATCTACCATGTGCCAGG - Intronic
911178235 1:94838911-94838933 CTGAGCACTTACCATGTGCCAGG + Intronic
911226684 1:95314891-95314913 TTAAACATCTACCATGTGCCAGG + Intergenic
911692630 1:100851655-100851677 TTGATTATCCACTATGTGCCAGG + Intergenic
911705214 1:101003352-101003374 CAGATCATCTACTATGTACCAGG + Intronic
911715343 1:101126249-101126271 CTGAGCACCTACTATGTGCCAGG - Intergenic
912409572 1:109471007-109471029 TTGAGCATCTACCTTGTGCCAGG - Intronic
912498533 1:110106760-110106782 CTGAGCACCTACTATGTGCCAGG + Intergenic
912698150 1:111856573-111856595 CTCAGGATCCACCATGTGCAAGG - Intronic
912702936 1:111891857-111891879 CTGACCATCTACTATGTTCCAGG + Intronic
912874120 1:113339296-113339318 CTTGTCATCTATCATGTGCCAGG - Intergenic
912975803 1:114329210-114329232 CTGAGCATCTACTATATGCCAGG + Intergenic
913015606 1:114731169-114731191 ATGAGTATCTACCATGTTCCAGG - Intronic
913432859 1:118814353-118814375 CTGAGTCTCTACTATGTGCCAGG + Intergenic
913520773 1:119644027-119644049 CTGAAAGTCTACCATATGCCAGG + Intronic
915510473 1:156384363-156384385 TTGAGCATCTACTATGTGCCAGG - Intronic
915833852 1:159157361-159157383 TTGAACAACTACCATGTGCCAGG - Intergenic
915842132 1:159222504-159222526 CTGAGGATTCACTATGTGCCAGG - Intergenic
916192933 1:162196812-162196834 CTGACCATCTGCCAAGTGCCAGG - Intronic
916309568 1:163380965-163380987 CTGATCATCTATCATGTTCTGGG + Intergenic
916509643 1:165460704-165460726 TTAATGAACTACCATTTGCCAGG + Intergenic
916790755 1:168122951-168122973 TTGAACATCTACAATGTGCCAGG - Intronic
916874979 1:168959550-168959572 CTGAGGTCCTACTATGTGCCAGG + Intergenic
917300805 1:173571955-173571977 CTGAGCATTTACTATGTGCCAGG + Intronic
917633666 1:176915234-176915256 CTGAGGACCTACCATGGGCCAGG + Intronic
917681035 1:177367742-177367764 CTGATCAACTACTATGTGCTAGG - Intergenic
917807585 1:178627698-178627720 CTGATTGCCTACCATGTGTCAGG + Intergenic
917828649 1:178852368-178852390 CTGAACACCTACCACGTGCCAGG - Intronic
917916104 1:179703656-179703678 CCGAGCATCTACCACGTGCCAGG - Intergenic
918057577 1:181035376-181035398 TTGATGGCCTACTATGTGCCAGG + Intronic
918495318 1:185128843-185128865 CTGAGGATCTACTATGTGCCAGG + Intronic
919754368 1:201057545-201057567 CTGAGTACCTCCCATGTGCCAGG - Intronic
919898042 1:202021864-202021886 CTGAGTATCTACTAGGTGCCAGG + Intergenic
920217024 1:204368160-204368182 CTGAGCATCTACGATGCGCCAGG + Intronic
920347530 1:205316279-205316301 CTGAGTGCCTACCATGTGCCTGG + Intronic
920439488 1:205969785-205969807 TTGAGTATCTACCATGTGCCGGG + Intergenic
920850689 1:209626201-209626223 CTTAGCACCTACCATGTGCCAGG + Intronic
921064138 1:211610821-211610843 CTGAGCATTTACCATGTACCAGG + Intergenic
921096087 1:211888394-211888416 CTGAGGACCTGCCATGCGCCAGG + Intergenic
921117908 1:212112026-212112048 CTGAACATCTACTATGTGTCAGG + Intergenic
921214169 1:212923250-212923272 TTGAGCATCTACTATGTGCCTGG - Intergenic
921891402 1:220357641-220357663 CTGGATGTCTACCATGTGCCAGG - Intergenic
922035293 1:221841784-221841806 TTGAGGATCTACAATGTGCTGGG + Intergenic
922150299 1:222996592-222996614 GTGAGTATTTACCATGTGCCAGG + Intronic
922256698 1:223898702-223898724 TTGAGTGTCTACCATGTGCCAGG - Intergenic
922342382 1:224668469-224668491 CTAAGCATCTACCATTTGCCAGG - Intronic
922422774 1:225470825-225470847 CTGAGCACCTACCATGTGCCAGG - Intergenic
922945480 1:229510241-229510263 GTGAGTACCTACCATGTGCCAGG + Intergenic
922980455 1:229821782-229821804 CTGAACATCTATCATGTGCCAGG - Intergenic
923137977 1:231134968-231134990 CCGAGCACCTACCATGTGCCAGG + Intergenic
923457162 1:234174430-234174452 TTGAGGACCTACTATGTGCCAGG + Intronic
923519986 1:234727932-234727954 CCGCTGATCTACCTTGTACCAGG - Intergenic
923805885 1:237257575-237257597 CTGAATATCTACTATGTGCTGGG + Intronic
923833559 1:237584521-237584543 ATGAACACCTACCATGTGCCAGG - Intronic
923855031 1:237837408-237837430 CTGCTGTTCTACCACGAGCCAGG + Intergenic
924128263 1:240878385-240878407 TTGAGCATCTACTATGTGCCAGG - Intronic
924337906 1:243001555-243001577 TTGAGTGTCTACCATGTGCCAGG - Intergenic
924619155 1:245645572-245645594 CTGAGTATCTGCCAAGTGCCAGG - Intronic
1062838919 10:654515-654537 CGGAGGCTCTGCCATGTGCCAGG + Intronic
1062908552 10:1196337-1196359 TTGATGATTTACAAAGTGCCGGG - Intronic
1063874939 10:10465216-10465238 CTGAGGATCAACTATGTGACAGG + Intergenic
1063940602 10:11124653-11124675 TTGAGTACCTACCATGTGCCAGG + Intronic
1064216935 10:13408389-13408411 CTGAGTACCTACCAAGTGCCAGG - Intergenic
1064476953 10:15701034-15701056 CTGATGATCTACTATGTTTTTGG - Intronic
1064716742 10:18184156-18184178 CTGATCATCTACCATAGGTCTGG - Intronic
1064904894 10:20335153-20335175 CTGAGCATCTACTATGTGCTGGG - Intergenic
1065293264 10:24251961-24251983 CTGAACATCTACTATATGCCAGG - Intronic
1065688987 10:28314187-28314209 CTGAGCACCTACTATGTGCCAGG + Intronic
1066183122 10:32982422-32982444 CTGAATATCTATTATGTGCCAGG - Intronic
1066462206 10:35621916-35621938 ATGAGGACCTACCATGTACCAGG + Intergenic
1066544738 10:36487553-36487575 CTGAACATCCACCTTGTGCCAGG + Intergenic
1066758289 10:38731353-38731375 ATGATCATCTACCGTGTGCCAGG - Intergenic
1066963368 10:42241336-42241358 CTGATCATCTACCGTGTGCCAGG + Intergenic
1067073840 10:43161103-43161125 CTGAGCATCTACTATGTGCCAGG - Intronic
1067482131 10:46608854-46608876 CTGAATGTCTACCATGTGCTAGG - Intergenic
1067612618 10:47732813-47732835 CTGAATGTCTACCATGTGCTAGG + Intergenic
1067799476 10:49349245-49349267 CTGAGCATCTACTATGTTCCAGG - Intergenic
1068056837 10:52021390-52021412 CTGAGAATCCAGCATGTGCCTGG - Intronic
1068910064 10:62369702-62369724 TTGAACATCTACTATGTGCCAGG + Intergenic
1069271179 10:66529661-66529683 CTGAGGACCTGCAATGTGCCGGG + Intronic
1069407375 10:68116131-68116153 TTGAGCATCTACTATGTGCCAGG - Intronic
1069409601 10:68139813-68139835 CTGAGTACCTACCATGTGCCAGG + Intronic
1069622663 10:69847443-69847465 CTGAGGGCCTACTATGTGCCTGG - Intronic
1070401573 10:76057346-76057368 TTGATCACCTACTATGTGCCAGG - Intronic
1070546230 10:77455146-77455168 CTGAGTACCTACCATGTGCTTGG + Intronic
1070708257 10:78657321-78657343 CTGAGCACCTACTATGTGCCGGG - Intergenic
1070758836 10:79010524-79010546 CTGAGCATTTACCATGTGCCAGG - Intergenic
1071293362 10:84202645-84202667 CTGAGGATCTACTCTGTGCTTGG - Intronic
1071295844 10:84218921-84218943 CTGAGGGTTTACTATGTGCCAGG + Intronic
1071628042 10:87193056-87193078 CTGAATGTCTACCATGTGCTAGG + Intergenic
1071717037 10:88107483-88107505 CTGAACATCTACTATGGGCCAGG - Intergenic
1071822660 10:89294020-89294042 CTGAGAATCTACTATGTGCCAGG - Intronic
1071850697 10:89566890-89566912 CTGAGTACCTACTATGTGCCAGG + Intergenic
1072019446 10:91383655-91383677 CTGAGGATCTCCAGTGTGCCTGG + Intergenic
1072094522 10:92164107-92164129 CTGATAATTTATCATGTTCCAGG + Intronic
1072350041 10:94548164-94548186 CTGATTGCCTACTATGTGCCAGG - Intronic
1073067690 10:100773241-100773263 CTGAGTATCTACTATGTGCTAGG - Intronic
1073650778 10:105355583-105355605 TTGAGGCTCTACCATGTGTCAGG - Intergenic
1074249239 10:111727490-111727512 ATGAACATCTACAATGTGCCAGG + Intergenic
1074395177 10:113092024-113092046 TTAATGAGTTACCATGTGCCAGG - Intronic
1074528948 10:114283735-114283757 CTGAGCATCTATTATGTGCCAGG - Intronic
1074547242 10:114410435-114410457 CTGAGTACCTACTATGTGCCAGG - Intergenic
1075135129 10:119777762-119777784 CTGAAGACCTACCATGTGCTAGG - Intronic
1075209317 10:120477760-120477782 CTGAGTATCTACTATGTGCCAGG - Intronic
1075279126 10:121123678-121123700 TTGATCATCTACTATGTGCCAGG + Intergenic
1075822533 10:125327136-125327158 CTGAGTATCTACTCTGTGCCAGG - Intergenic
1076014467 10:127016211-127016233 CTGAGCACCTACTATGTGCCAGG - Intronic
1076503112 10:130952426-130952448 CTGAGGACCTACCAGGGGCCTGG - Intergenic
1077331325 11:1984952-1984974 AGGATGAACTGCCATGTGCCCGG - Intergenic
1077521887 11:3041310-3041332 CTGAGTACCTACCATGTGCCAGG + Intronic
1077700462 11:4436684-4436706 CTGATGATTTACCAGGTTCTAGG - Intergenic
1078281426 11:9905475-9905497 TTGAGTATCTACTATGTGCCAGG + Intronic
1078425819 11:11250454-11250476 TTGAGCATCTACCATGTGCCAGG - Intergenic
1078728331 11:13953157-13953179 CTGAGCATCTACTATGTGCCAGG + Intergenic
1078825464 11:14925823-14925845 CTGAATATCTACTATATGCCAGG + Intronic
1078839152 11:15061895-15061917 TTGAGGACCTACTATGTGCCAGG - Intronic
1079243353 11:18736302-18736324 CAGAATGTCTACCATGTGCCAGG + Intronic
1079350081 11:19684915-19684937 CTGAGCACCTACAATGTGCCAGG - Intronic
1079561439 11:21825931-21825953 CTGACCACCTACCATGTGCCTGG + Intergenic
1079901646 11:26194165-26194187 GTGATGATTAACCATGTGCTGGG + Intergenic
1079984727 11:27188461-27188483 CTGAGTATCTATCATGTGCTAGG - Intergenic
1080270828 11:30449149-30449171 CTGAGCAACTACCATGTTCCAGG - Intronic
1080360840 11:31511454-31511476 CTGAGAATCTACTAAGTGCCAGG - Intronic
1080465497 11:32492778-32492800 CTGAATATCTACCATGTACCAGG - Intergenic
1080558082 11:33435644-33435666 TTGAAGATTTACCATGTGCCAGG + Intergenic
1080759933 11:35238616-35238638 CTGAATATCTACTATATGCCAGG + Intergenic
1080769267 11:35325461-35325483 TTGAGCATCTACTATGTGCCAGG - Intronic
1080834031 11:35923188-35923210 CTGAAGACCTACTATGTACCAGG - Intergenic
1080901726 11:36500034-36500056 CTGATCATCTACTATGGGTCAGG + Intronic
1081027394 11:38032742-38032764 ATGATTAACTACTATGTGCCAGG + Intergenic
1081395989 11:42587014-42587036 CTGAACAGCTACCATGTGCAAGG + Intergenic
1081533849 11:43983380-43983402 CTGAGCACCTACTATGTGCCTGG + Intergenic
1081581526 11:44355547-44355569 CTGAAGGCCTACTATGTGCCAGG - Intergenic
1081586692 11:44389840-44389862 CTGAGCCTCTACCATGTGCTTGG + Intergenic
1081601365 11:44497125-44497147 CTGAGCACCTACCATATGCCTGG - Intergenic
1081730578 11:45369245-45369267 CTGAATACCTACTATGTGCCAGG - Intergenic
1081736067 11:45405170-45405192 CTGATGCTGTACCCTCTGCCTGG - Intergenic
1081759596 11:45568005-45568027 CTGAGCACCTACTATGTGCCAGG - Intergenic
1081768101 11:45626594-45626616 CTGAGGACCTACTATGTGCTAGG + Intergenic
1081955654 11:47090637-47090659 ATGAGCATTTACCATGTGCCAGG + Intronic
1082086576 11:48055224-48055246 TTGAGGGCCTACCATGTGCCAGG - Intronic
1082735703 11:56853357-56853379 CTGAATACCTACCATGTGCCAGG - Intergenic
1082809654 11:57471730-57471752 CTGAGTATCTACCACATGCCAGG + Intronic
1082812605 11:57487541-57487563 CTGAGAACCTACTATGTGCCAGG + Intronic
1083237968 11:61364173-61364195 CTGAGGACCTACTGTGTGCCAGG - Intronic
1083719403 11:64596957-64596979 CTGAGCACCTACCATGTGCCAGG + Intronic
1084268208 11:68015650-68015672 CTGAGCACCTACTATGTGCCAGG + Intronic
1084551808 11:69848192-69848214 CTGAGCATCTATTATGTGCCAGG + Intergenic
1084561293 11:69906805-69906827 CTGAGCATCTACTATGTGCCAGG + Intergenic
1084730395 11:71069548-71069570 CTGAGCATCTACTATGTTCCAGG + Intronic
1084760827 11:71269615-71269637 CTGAGGATCTATTATGTGGCAGG - Intergenic
1084863283 11:72036469-72036491 TTGACAACCTACCATGTGCCAGG - Intronic
1084943807 11:72628207-72628229 CCAAGGATCTGCCATGTGCCAGG + Intronic
1085063752 11:73473076-73473098 CTGAACACCTACCATGTGACAGG + Intronic
1085191250 11:74625323-74625345 TTGACAGTCTACCATGTGCCAGG - Intronic
1085198457 11:74686527-74686549 CTGAGCATCTCCCATGAGCCAGG - Intergenic
1085218558 11:74853041-74853063 CTGAATACCTACCATGTCCCAGG + Intronic
1085341674 11:75735459-75735481 CTGAGGACCTACTATGTGCTAGG + Intergenic
1085493867 11:76948875-76948897 AGGATTATCTACCATGTGTCTGG - Intronic
1085732626 11:79012417-79012439 CTGAGTACCTACCATGTGCCAGG + Intronic
1085768773 11:79307071-79307093 CTGATGACTTACCATGTGCAAGG + Intronic
1085782610 11:79423201-79423223 CTAAGCACCTACCATGTGCCAGG + Intronic
1086060358 11:82693866-82693888 CTGAGCACCTACCATGTGCCAGG + Intergenic
1086110955 11:83197351-83197373 CTGAACATCTACCATGAGTCAGG - Intronic
1086168831 11:83812393-83812415 TTGAACATCTACAATGTGCCAGG + Intronic
1086196224 11:84143113-84143135 TTGAGCATCTACCTTGTGCCAGG + Intronic
1086425646 11:86680009-86680031 CTAAAGATCTACTATGTGCTAGG - Intergenic
1086434456 11:86767599-86767621 CTGATTATCTACTATGTGCCAGG - Intergenic
1086513297 11:87584310-87584332 TTGAGTACCTACCATGTGCCAGG + Intergenic
1086866504 11:91986125-91986147 CTGAGGATCTGCTAGGTGCCAGG + Intergenic
1086998626 11:93389890-93389912 CTGAGCACCTAACATGTGCCAGG + Intronic
1087150798 11:94857822-94857844 CTGAGCATGTACCATGTACCAGG - Intronic
1087612463 11:100451348-100451370 TTGAGCATCTACCATGTGTCAGG + Intergenic
1088562388 11:111128499-111128521 CTGAGCTTCTACTATGTGCCAGG - Intergenic
1088568507 11:111198072-111198094 CTGAGTATCTGCCATGTGCCAGG - Intergenic
1088889618 11:114034380-114034402 ATGATCATCTACCATGGGGCAGG + Intergenic
1089160244 11:116431869-116431891 CTGAGTATCTCCTATGTGCCAGG + Intergenic
1089297529 11:117479096-117479118 CTGAGCATCTACCATGTGGCTGG + Intronic
1089382525 11:118046024-118046046 TTGAATATCTACCATGTGTCAGG - Intergenic
1089388229 11:118081785-118081807 CTGAGCATCTACTATGTGCTAGG + Intronic
1089390156 11:118096212-118096234 CTGATAAGCTACTTTGTGCCAGG + Intronic
1089397754 11:118146745-118146767 CTGAGCATCTACTATGTGCCAGG + Intronic
1089683366 11:120131868-120131890 CTGAGCATCTAGTATGTGCCAGG + Intronic
1089794587 11:120970043-120970065 CTGAGTAACTACTATGTGCCTGG - Intronic
1089881715 11:121780388-121780410 TTGAGTATCTACTATGTGCCAGG - Intergenic
1090149555 11:124368018-124368040 CTGATTATTTGTCATGTGCCAGG - Intergenic
1090200106 11:124847910-124847932 CTGAATATCTTCTATGTGCCAGG + Intergenic
1090424294 11:126596271-126596293 CTCAACATCTACCATATGCCAGG - Intronic
1090425502 11:126604410-126604432 TTGAACATGTACCATGTGCCAGG + Intronic
1090805744 11:130201086-130201108 CTGAGCACCTACTATGTGCCAGG - Intronic
1090811308 11:130246659-130246681 CTGAGTATTTACCATGTGCCAGG + Intronic
1090821036 11:130341859-130341881 CTGAGTATATGCCATGTGCCAGG - Intergenic
1090823690 11:130368000-130368022 TTGAGCATCTACCATGTGGCAGG + Intergenic
1091207542 11:133832017-133832039 CTGAGGGTCTACCAAGTGGCGGG + Intergenic
1202814306 11_KI270721v1_random:40128-40150 AGGATGAACTGCCATGTGCCCGG - Intergenic
1091677560 12:2502280-2502302 CTGAGGACCTACTATGTGCGAGG + Intronic
1091806164 12:3357621-3357643 CTGAAGGCCTACCACGTGCCAGG - Intergenic
1091928804 12:4377893-4377915 AATAGGATCTACCATGTGCCTGG - Intronic
1092390882 12:8077705-8077727 TTGAACACCTACCATGTGCCAGG + Intergenic
1092501590 12:9052867-9052889 CTGAGTATCTACCATCTGCCTGG - Intergenic
1092905496 12:13097196-13097218 CTGATGCTCTTCCTTCTGCCTGG + Intronic
1092953583 12:13529666-13529688 CTGAGCATCTACTATATGCCAGG - Intergenic
1093067852 12:14677486-14677508 CTGAGAGTCTACAATGTGCCAGG - Intronic
1093140869 12:15509012-15509034 CTGAGCATCTATGATGTGCCAGG + Intronic
1093470845 12:19500759-19500781 CTGAGTGCCTACCATGTGCCAGG - Intronic
1094202089 12:27804811-27804833 CAGAGGATCAAACATGTGCCTGG - Intergenic
1094318504 12:29158974-29158996 CTGAGTACCTACTATGTGCCAGG + Intronic
1094426020 12:30317933-30317955 TTGAACATCTACCATGTGTCAGG - Intergenic
1095380943 12:41591207-41591229 CTGAGCATCTCCCAAGTGCCAGG - Intergenic
1095473052 12:42556866-42556888 CTGAGCACCTACAATGTGCCAGG + Intronic
1095702479 12:45204613-45204635 TTGAGTATCTACTATGTGCCAGG + Intergenic
1095948860 12:47770507-47770529 TTGAGTATCTACCATGTGCTAGG + Intronic
1096006525 12:48177738-48177760 TTGAGCATCTGCCATGTGCCAGG + Intronic
1096526921 12:52215579-52215601 CTGAGCACCTACCATGTGCCAGG - Intergenic
1096678222 12:53237187-53237209 CTGAGTATCTGCTATGTGCCAGG + Intergenic
1096968145 12:55645029-55645051 CTGAATACCTACTATGTGCCAGG + Intergenic
1097094534 12:56535878-56535900 ATGATCATTTACTATGTGCCAGG - Intronic
1097115749 12:56695596-56695618 TTGAGCATCTACTATGTGCCAGG - Intergenic
1097353432 12:58574447-58574469 TTGAACATCTACCATGTGCTAGG - Intronic
1097381853 12:58904764-58904786 CTGAGCATCCACCATGGGCCAGG + Intronic
1097880281 12:64680464-64680486 CTGAGCTTCTGCCATGTGCCAGG - Intronic
1098220151 12:68261280-68261302 CTGAGGGTCTATGATGTGCCAGG - Intergenic
1098269983 12:68760727-68760749 CTGAACATCTACTGTGTGCCAGG + Intronic
1098299689 12:69041836-69041858 CTCAGGACCTACTATGTGCCAGG + Intergenic
1098370133 12:69749893-69749915 CTAATGACCTACTCTGTGCCAGG - Intronic
1099012730 12:77311032-77311054 TTGTTGATCTACCACGTGCAAGG - Intergenic
1099237218 12:80095834-80095856 ATGATCACCTACCATGTTCCAGG + Intergenic
1099985387 12:89656936-89656958 CTGAGTGTCTACCATGTGTCTGG - Intronic
1100353518 12:93807510-93807532 TTTATTATCTACCATGTGCTAGG + Intronic
1100389433 12:94135261-94135283 CTGAGAATCTACCATGTGCTAGG - Intergenic
1100476091 12:94936692-94936714 CTGAGTACCTACCATGTGTCAGG + Intronic
1100682259 12:96939032-96939054 CTGAGTGCCTACCATGTGCCAGG - Intronic
1101037873 12:100722718-100722740 CTGGTCACCTACTATGTGCCAGG - Intronic
1101262835 12:103050093-103050115 CTGATGGGCTACTCTGTGCCAGG - Intergenic
1101283665 12:103286541-103286563 CTGATTATTTACTATGTGCTAGG - Intronic
1101353155 12:103951954-103951976 CTGACTCTCTACCATGTGCCTGG + Intronic
1101354518 12:103964774-103964796 TTGAATATTTACCATGTGCCAGG + Intronic
1101359261 12:104010623-104010645 TTGAAAATCTACTATGTGCCAGG - Intronic
1101520050 12:105474327-105474349 CTGAGCACCTACAATGTGCCAGG + Intergenic
1101531375 12:105576445-105576467 CTGAGCTTCTACCCTGTGCCAGG + Intergenic
1101715275 12:107306067-107306089 CTGATTATCTACGATGTTGCAGG + Intergenic
1101830377 12:108252160-108252182 CTGAGCATCTACCATGTGCCAGG + Intergenic
1101878419 12:108610287-108610309 CTGATTCTCTACCATGTGCCAGG + Intergenic
1101927169 12:108981755-108981777 CTGAGGATTTATTATGTGCCAGG - Intronic
1102046018 12:109830858-109830880 CTGAGCACCTACTATGTGCCAGG + Intronic
1102053260 12:109878758-109878780 CTGAGCATCTGCTATGTGCCAGG + Intronic
1102100037 12:110271190-110271212 CTGAGCATCTGCTATGTGCCTGG + Intergenic
1102139410 12:110602264-110602286 CTGAGCACCTACTATGTGCCCGG - Intergenic
1102184029 12:110933899-110933921 ATGATCACCTACTATGTGCCAGG - Intergenic
1102205114 12:111084983-111085005 TTGAGCATCTACTATGTGCCAGG + Intronic
1102288055 12:111675483-111675505 CTGAGCATCTAGTATGTGCCAGG + Intronic
1102415133 12:112755064-112755086 CTGAGGACCTACTAAGTGCCAGG - Intronic
1102417334 12:112775362-112775384 CTGTGCATGTACCATGTGCCAGG + Intronic
1102497971 12:113332636-113332658 TTGAGCATCTACTATGTGCCAGG - Intronic
1102524024 12:113498442-113498464 CTGAGCATCTACCATGCACCAGG + Intergenic
1102570899 12:113826368-113826390 TTGAGCATCTACTATGTGCCAGG - Intronic
1102884387 12:116510564-116510586 CTGAGCACCTACTATGTGCCAGG - Intergenic
1103150614 12:118635497-118635519 TTTATTAACTACCATGTGCCAGG + Intergenic
1103155541 12:118681602-118681624 CTGAGCATCTACAATGTGACTGG - Intergenic
1103155547 12:118681675-118681697 CTGAGCATCTACCATGTGACTGG - Intergenic
1103465897 12:121141702-121141724 CTGAGGACTTAGCATGTGCCGGG + Intronic
1103784001 12:123418566-123418588 CTGAGGGTCTGCCATGTGCCAGG - Intronic
1103922774 12:124407783-124407805 CTGAGCATCTACCATGTGCCAGG + Intronic
1103929271 12:124440589-124440611 CTGAGCATCTACTATGTGCCAGG + Intronic
1104066228 12:125309487-125309509 CTGAGCACCTACTATGTGCCAGG + Intronic
1104093622 12:125536605-125536627 CTGAATATCTACCATGTGCCAGG - Intronic
1104390844 12:128389568-128389590 CTGAGCACCTACTATGTGCCAGG - Intronic
1104391690 12:128396601-128396623 TTGAGGACCTATCATGTGCCAGG + Intronic
1104640560 12:130464372-130464394 CTGAATACCTACTATGTGCCAGG + Intronic
1104640572 12:130464468-130464490 CTGAATACCTACTATGTGCCAGG + Intronic
1104701574 12:130908420-130908442 CTGATGATCTGGCATCTTCCTGG + Intergenic
1104988470 12:132610944-132610966 TTTGTGATCGACCATGTGCCAGG + Intergenic
1106201153 13:27538439-27538461 CTTAGCATCTACTATGTGCCAGG - Intergenic
1106482783 13:30149314-30149336 TTGAGCATCTACTATGTGCCAGG + Intergenic
1106510576 13:30409033-30409055 CTGATCATCTCCCGGGTGCCAGG + Intergenic
1106587627 13:31071222-31071244 TTGAGTATTTACCATGTGCCAGG + Intergenic
1106700286 13:32221866-32221888 TTGATGCTTTACCATGTGCCAGG + Intronic
1106718540 13:32416715-32416737 CTGAGCATCTCCCATGTGCCTGG - Intronic
1106884196 13:34165753-34165775 CTGAGAACCTACCATGTGCTAGG + Intergenic
1107310377 13:39071178-39071200 CTGACCACCTACTATGTGCCAGG - Intergenic
1107409307 13:40143699-40143721 ATCCTGCTCTACCATGTGCCAGG - Intergenic
1107436765 13:40387393-40387415 CTGAGGATCTACCACATACCCGG + Intergenic
1107930161 13:45300469-45300491 CTGAACATCTACTATGTGGCAGG - Intergenic
1108042878 13:46355723-46355745 TTGAAGACCTACTATGTGCCAGG + Intronic
1108327757 13:49351048-49351070 CTGAAGATCTACTATGTGCCTGG + Intronic
1108401666 13:50051295-50051317 TTGAATATCTACTATGTGCCAGG + Intergenic
1108441143 13:50453959-50453981 TTGAGCATCTACCATGTGCCAGG - Intronic
1108520672 13:51244386-51244408 CTGAACACCCACCATGTGCCAGG - Intronic
1108719927 13:53120690-53120712 CTTATTATTTACTATGTGCCAGG + Intergenic
1109227610 13:59715273-59715295 TTGATCGTCTACCATGTGCTGGG - Intronic
1109236835 13:59831841-59831863 TTGAGCAACTACCATGTGCCAGG + Intronic
1110170731 13:72497362-72497384 CTGAGCACCTACTATGTGCCAGG + Intergenic
1110184715 13:72658895-72658917 CTGATACCTTACCATGTGCCAGG - Intergenic
1110212343 13:72988270-72988292 CTGAGTATCTACAATGTACCAGG - Intronic
1111871438 13:93838119-93838141 CTGAGCACCTACTATGTGCCAGG + Intronic
1112377722 13:98859270-98859292 CTGAGCATTTACCGTGTGCCAGG + Intronic
1113161856 13:107390981-107391003 CTGAGCATCTACCATGTGCCAGG + Intronic
1113245167 13:108387391-108387413 CTGATGTTCTCCCAAGTCCCAGG + Intergenic
1113466560 13:110517573-110517595 CTGAGCATCAACCATGTGCCAGG + Intergenic
1114260988 14:21036082-21036104 CTGAGGACTCACCATGTGCCGGG - Intronic
1114556414 14:23564911-23564933 CTGAGGCTCTACTATGTGCCAGG + Intronic
1114830745 14:26138449-26138471 TTGAACATCTAACATGTGCCAGG - Intergenic
1114875888 14:26717100-26717122 TTAATGATCTACCACGTACCAGG - Intergenic
1115270902 14:31551315-31551337 CTGATCCCCTACAATGTGCCTGG + Intronic
1115424370 14:33239304-33239326 CTGAGGATTTAATATGTGCCAGG + Intronic
1115614255 14:35078269-35078291 CTGAGTGCCTACCATGTGCCAGG - Intronic
1116638693 14:47432945-47432967 TTGAATACCTACCATGTGCCAGG + Intronic
1116772059 14:49138217-49138239 CTGAGCATCTACCATGTCTCAGG + Intergenic
1117203031 14:53411974-53411996 TTGAAAATCTACCATGTGCCAGG - Intergenic
1117453913 14:55878881-55878903 CTGGATATCTACCATGTGTCAGG - Intergenic
1117593747 14:57305197-57305219 TTGAACATCTACTATGTGCCAGG + Intergenic
1117623386 14:57610794-57610816 CTGAGTATCTCCTATGTGCCAGG + Intronic
1118135185 14:63016566-63016588 TTGATGACCTACCATGAGCCAGG - Intronic
1118320859 14:64752624-64752646 CTGAGCATCTACTATGTGCCAGG - Intronic
1118439667 14:65801107-65801129 CTGAGCACCTACCATGTGCCAGG + Intergenic
1118477859 14:66135118-66135140 CTGGGGATCTTCCATCTGCCTGG + Intergenic
1118810339 14:69268584-69268606 CTGAGCATGTACTATGTGCCAGG + Intronic
1118975874 14:70676209-70676231 CTGAGTACCTACAATGTGCCAGG - Intergenic
1118976519 14:70682333-70682355 CTGAGAATCTGCTATGTGCCAGG - Intergenic
1119124856 14:72116281-72116303 ATGAGCATCTACCATGTGGCAGG + Intronic
1119497609 14:75093897-75093919 CTGAGCATTTACCATTTGCCAGG + Intronic
1119722888 14:76903127-76903149 CTGAAGGTCTAACATGTGCCAGG - Intergenic
1119827090 14:77666173-77666195 CTGAGTAACTACTATGTGCCAGG + Intergenic
1119959339 14:78836853-78836875 CTGATGTTCTACAGTGTTCCAGG + Intronic
1120180413 14:81337344-81337366 TTGAGCATCTACTATGTGCCAGG + Intronic
1120208440 14:81611145-81611167 CTGAGCACCTACCATGTGCCAGG - Intergenic
1120396346 14:83971639-83971661 CTGAGTATCTAAAATGTGCCAGG - Intergenic
1120761537 14:88289850-88289872 CTGAGTATTTACTATGTGCCAGG - Intronic
1120902224 14:89585523-89585545 CTGAGCATCTACTATGGGCCAGG + Intronic
1120941593 14:89955239-89955261 TTGAAGATCTACTTTGTGCCAGG - Intronic
1120969718 14:90197245-90197267 CTGAGCATTTACTATGTGCCAGG - Intergenic
1121035793 14:90702677-90702699 CTGAAAGTCTACCATGTCCCAGG + Intronic
1121224053 14:92308358-92308380 CTGAGGAGCTACCATGGGCTGGG + Intergenic
1121237708 14:92404886-92404908 CTGAGGACCTATTATGTGCCAGG - Intronic
1121270945 14:92638033-92638055 CTGAGCATCTACTATGTGTCAGG - Intronic
1121296014 14:92824449-92824471 CTGATTGTCTACCATGTGCCAGG + Intronic
1121306308 14:92909849-92909871 CTGAGCATTTACTATGTGCCAGG - Intergenic
1121540094 14:94719116-94719138 CTGATCATCTACTTTGTGCCAGG - Intergenic
1121553069 14:94816839-94816861 CTGAGCATCTACTATGTGCCAGG + Intergenic
1121666437 14:95676075-95676097 TTGATGATCTACCGTGTGCCAGG + Intergenic
1121742111 14:96261343-96261365 CTGAGAATGTACTATGTGCCAGG - Intronic
1121803271 14:96793358-96793380 TTGAGGATCTACCATGTGTCAGG - Intergenic
1121951143 14:98172028-98172050 CTGAGGACCTACTGTGTGCCAGG - Intergenic
1122116188 14:99528466-99528488 CTGAAGACCTGCCATGTGCCCGG + Intronic
1122156580 14:99753699-99753721 CTGAGCACCTACTATGTGCCAGG - Intronic
1122714925 14:103690450-103690472 CTGAGTATCTGCCATGTGCCAGG + Intergenic
1123428427 15:20192420-20192442 TTGAGAATCTACCATGTACCAGG - Intergenic
1123441693 15:20296071-20296093 CTGATCATCTACCGTGTGCCAGG - Intergenic
1124888937 15:33713553-33713575 TTGAGCATTTACCATGTGCCAGG + Intronic
1125294904 15:38191938-38191960 CTGAGCATCTACCACGTGTCAGG - Intergenic
1125334016 15:38609937-38609959 GTGAAGATTTACTATGTGCCAGG - Intergenic
1125339223 15:38658179-38658201 TTGAATATCTACCATGTGCCAGG - Intergenic
1125421045 15:39504326-39504348 CTGGGGGTTTACCATGTGCCTGG + Intergenic
1126351390 15:47748364-47748386 CTGAGGACCTGCCAGGTGCCAGG + Intronic
1126456367 15:48866417-48866439 CTGAGGATCTACTACGTGCCAGG + Intronic
1126652705 15:50941166-50941188 CTGAACACCTCCCATGTGCCAGG - Intronic
1127060389 15:55176883-55176905 TTGAGGACCAACCATGTGCCAGG + Intergenic
1127618347 15:60709248-60709270 CTGAGTTTCTACTATGTGCCTGG + Intronic
1127651637 15:61014314-61014336 CTAAGGACCTACTATGTGCCAGG - Intronic
1127699636 15:61485768-61485790 CTGAGTATTTACCATGTGTCAGG + Intergenic
1128133635 15:65246958-65246980 TTGAACATCTACTATGTGCCTGG + Intronic
1128346388 15:66854976-66854998 CTGATCATTTATCAAGTGCCAGG + Intergenic
1128560728 15:68666240-68666262 CTGTTGACTTGCCATGTGCCAGG - Intronic
1129243462 15:74265635-74265657 GTGAGTATCTACTATGTGCCAGG - Intronic
1129321207 15:74776086-74776108 CTGAACACCTACTATGTGCCAGG - Intergenic
1129697949 15:77751302-77751324 CTGAGGACTTACCATGTGCCAGG - Intronic
1129826223 15:78636817-78636839 CTGAGGGTCTATCTTGTGCCAGG + Intronic
1129850104 15:78788857-78788879 CTGAGCATCTACTATGTGCCAGG + Intronic
1129952364 15:79603188-79603210 TTGAAGACCTACTATGTGCCAGG + Intergenic
1129994477 15:79992683-79992705 CTGAACATCTAGCATGTGCCAGG + Intergenic
1130041573 15:80409550-80409572 CTGAGTAACTACTATGTGCCGGG + Intronic
1130252161 15:82306718-82306740 CTGAGCATCTACTATGTGCCGGG - Intergenic
1130533028 15:84762118-84762140 GTGATGGTCTGCTATGTGCCAGG + Intronic
1130676700 15:85959155-85959177 CTGAGCATCTACAATGTGCCAGG + Intergenic
1131090185 15:89618631-89618653 CTGATCACCTGCTATGTGCCAGG - Intronic
1131090754 15:89623187-89623209 CTGATCACCTGCTATGTGCCAGG - Intronic
1131197216 15:90365194-90365216 TTGAGCACCTACCATGTGCCAGG - Intronic
1131439365 15:92447473-92447495 CTGGTGATCTGCCATGTGGTTGG - Intronic
1131522082 15:93124264-93124286 CTGAGCATCTGCCATGTGCCAGG - Intergenic
1131592599 15:93766321-93766343 CTCAACACCTACCATGTGCCAGG + Intergenic
1133053641 16:3133902-3133924 CTAAGCATCTACCATGTGCCAGG + Intronic
1133459066 16:5971131-5971153 TTGAGGATCTACTATGTGCTAGG + Intergenic
1133688583 16:8190536-8190558 CTGAGCATCTACTTTGTGCCAGG + Intergenic
1133732157 16:8587307-8587329 CTCATGGGCTACTATGTGCCAGG + Intronic
1133826065 16:9279298-9279320 CTGAGTATCTACTATGTGCCGGG - Intergenic
1133838887 16:9390689-9390711 TTGATGACCTACTGTGTGCCAGG + Intergenic
1133843386 16:9430357-9430379 CTGAGGTTCTACTATGTACCAGG - Intergenic
1133885755 16:9826064-9826086 AGGATCATCTACCATGTGCCAGG + Intronic
1134204919 16:12229272-12229294 CTGAACACCTACTATGTGCCAGG - Intronic
1134248776 16:12559655-12559677 CTGCTTCTCTACCATGGGCCTGG + Intronic
1134402545 16:13922821-13922843 CTGAGCATCTACAATGTGTCAGG - Intronic
1134639417 16:15817982-15818004 CTGAGCAGCTACTATGTGCCAGG + Intronic
1134863150 16:17578865-17578887 TTGAAGACTTACCATGTGCCAGG + Intergenic
1135040370 16:19113606-19113628 CCGAGCACCTACCATGTGCCAGG - Intergenic
1135137527 16:19895954-19895976 TTGAGCATCTACCATGTGCCTGG + Intergenic
1135239849 16:20794690-20794712 TTGATGACTTACTATGTGCCAGG + Intronic
1135286824 16:21200777-21200799 CTGAACACCTACCATATGCCAGG - Intronic
1135294284 16:21265638-21265660 CTGAATCTCTACCGTGTGCCAGG - Intronic
1135550909 16:23397640-23397662 GTGATCACCTACTATGTGCCAGG - Intronic
1136177441 16:28527345-28527367 CTGAGTACCTACCATATGCCAGG - Intergenic
1136349968 16:29700467-29700489 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1136555324 16:31004249-31004271 ATGATGTTTTACAATGTGCCAGG + Intronic
1136557221 16:31014513-31014535 CTGAGCGCCTACCATGTGCCAGG - Intergenic
1136719507 16:32309439-32309461 CTGATCATCTACCGTGTGTCAGG + Intergenic
1136724535 16:32347839-32347861 CTGATCATCTACCATGTGCCAGG + Intergenic
1136837880 16:33515719-33515741 CTGATCATCTACCGTGTGTCAGG + Intergenic
1136842862 16:33553879-33553901 CTGATCATCTACCGTGTGCCAGG + Intergenic
1136855891 16:33657326-33657348 TTGAGAATCTACCATGTACCAGG + Intergenic
1136930999 16:34417839-34417861 CTGAGTACCTACCACGTGCCAGG + Intergenic
1136973574 16:34993969-34993991 CTGAGTACCTACCACGTGCCAGG - Intergenic
1137251100 16:46741534-46741556 CTGCTGCTGTAACATGTGCCAGG - Intronic
1137372853 16:47924785-47924807 TTGAACATCTACAATGTGCCAGG - Intergenic
1137404007 16:48176011-48176033 CTGAGCACCTACTATGTGCCTGG - Intronic
1137627286 16:49917271-49917293 CTGAGGAGCTACTATGAGCCGGG + Intergenic
1137713535 16:50583704-50583726 GCAATGCTCTACCATGTGCCAGG - Intronic
1138158729 16:54732123-54732145 CTGAGTAACTACTATGTGCCAGG - Intergenic
1138184833 16:54968496-54968518 GTGAGTGTCTACCATGTGCCAGG - Intergenic
1138269761 16:55686852-55686874 CTGAAGACCTACTAGGTGCCAGG - Intronic
1138451536 16:57096032-57096054 CTGAGCACCTACAATGTGCCAGG - Intronic
1138460770 16:57146451-57146473 CTGAGGGCCTGCCATGTGCCAGG + Intronic
1138463668 16:57170613-57170635 CTGAGAATCTACTATATGCCAGG + Intronic
1138742409 16:59326168-59326190 CTGAGTATCTACCATGGGACAGG + Intergenic
1139086624 16:63594738-63594760 TTGAGCATCTACTATGTGCCAGG + Intergenic
1139356963 16:66372296-66372318 TTGAGCATCTACTATGTGCCAGG - Intronic
1139397143 16:66649338-66649360 CTGAGGATCTACTACATGCCAGG + Intronic
1139405921 16:66717630-66717652 CTGAAGACCTACCATATGCCAGG + Intergenic
1139507762 16:67407766-67407788 CTGAGGATCTACTATGTACAAGG - Exonic
1140066199 16:71613444-71613466 TTGAGCATCTACCAGGTGCCAGG + Intergenic
1140237162 16:73170079-73170101 CTGAGTGCCTACCATGTGCCAGG - Intergenic
1140668011 16:77245399-77245421 ATGATGATCTACTATGAGCCAGG + Intergenic
1140697814 16:77552253-77552275 TTGATCACCTACTATGTGCCAGG + Intergenic
1140894767 16:79315122-79315144 TTGAGCATCTACTATGTGCCAGG + Intergenic
1141146402 16:81533273-81533295 CTGAGCATCTAGCAGGTGCCAGG - Intronic
1141604568 16:85145487-85145509 TTGAGCACCTACCATGTGCCGGG - Intergenic
1141618632 16:85224566-85224588 TTGAGCATCTACTATGTGCCGGG + Intergenic
1141643329 16:85354401-85354423 CTGAGCACCTACTATGTGCCAGG - Intergenic
1203001895 16_KI270728v1_random:169916-169938 CTGATCATCTACCATGTGCCAGG - Intergenic
1203006924 16_KI270728v1_random:208330-208352 CTGATCATCTACCGTGTGTCAGG - Intergenic
1203117476 16_KI270728v1_random:1505805-1505827 TTGAGAATCTACCATGTACCAGG + Intergenic
1203133499 16_KI270728v1_random:1706322-1706344 CTGATCATCTACCATGTGCCAGG - Intergenic
1203148063 16_KI270728v1_random:1816003-1816025 CTGATCATCTACCGTGTGCCAGG + Intergenic
1203153027 16_KI270728v1_random:1854177-1854199 CTGATCATCTACCGTGTGCCAGG + Intergenic
1142489555 17:269468-269490 CTGAGGATTTGCTATGTGCCGGG - Intronic
1142960474 17:3549260-3549282 TTGAGCATCTACAATGTGCCAGG + Intronic
1143101594 17:4507442-4507464 TTGAGGACCTACTATGTGCCAGG + Intronic
1143423912 17:6817841-6817863 CTGAGCATGTACTATGTGCCAGG - Intronic
1143736087 17:8912975-8912997 CTGACTGTCTGCCATGTGCCAGG + Intronic
1143808080 17:9446246-9446268 GTGAGGATCTACTATGTGCCAGG - Intronic
1144181174 17:12753883-12753905 CTGAGCACCTACTATGTGCCAGG + Intronic
1144286513 17:13780063-13780085 CTGCTGACTTACCATGTGCTAGG + Intergenic
1144816113 17:18036653-18036675 TTGACTACCTACCATGTGCCAGG + Intronic
1144995256 17:19263696-19263718 CTGAATGCCTACCATGTGCCAGG - Intronic
1145304489 17:21665876-21665898 ATTATCACCTACCATGTGCCAGG + Intergenic
1145770981 17:27492879-27492901 ATGAGCACCTACCATGTGCCAGG - Intronic
1145772413 17:27502981-27503003 CTTACCATTTACCATGTGCCTGG + Intronic
1145813555 17:27779909-27779931 CTGAGCACCTACTATGTGCCAGG + Intronic
1145836753 17:27960178-27960200 ATGAGGACCTACCATGTGCCAGG - Intergenic
1145868173 17:28253906-28253928 TTAATCATCTAGCATGTGCCAGG - Intergenic
1146024704 17:29309511-29309533 TTGAGCATCTACCATGTGCCAGG - Intergenic
1146152146 17:30483360-30483382 ATGAGCATCTACTATGTGCCAGG + Intronic
1146327648 17:31901026-31901048 CTGAATGTCTACCATGTGCCAGG + Intronic
1146458806 17:33027430-33027452 CTAAAGACCTACTATGTGCCGGG - Intronic
1146464918 17:33078850-33078872 TTGATCACCTACTATGTGCCAGG - Intronic
1146481530 17:33208783-33208805 CTGAGCATCTGCTATGTGCCAGG - Intronic
1146551434 17:33783570-33783592 GTGTTCATCTACCATGTGGCAGG - Intronic
1146617342 17:34367493-34367515 TTGAGCATCTACCATGTGTCCGG - Intergenic
1146826755 17:36029722-36029744 CTGAGCATCTACCACGTGCTGGG + Intergenic
1146921886 17:36718811-36718833 CTGTGGATCTACTATGTGTCAGG - Intergenic
1147040376 17:37713751-37713773 CTGATGAGCAGCCTTGTGCCTGG - Intronic
1147040453 17:37714297-37714319 TTGAGCACCTACCATGTGCCAGG + Intronic
1147445097 17:40470300-40470322 CTACAGACCTACCATGTGCCAGG + Intergenic
1147610631 17:41799920-41799942 TTGAGCACCTACCATGTGCCAGG - Intergenic
1147628161 17:41913317-41913339 CTGAGCATCTACCATGTGCCAGG + Intronic
1148071796 17:44912812-44912834 CTGAGCCTCTACCATATGCCAGG - Intronic
1148141217 17:45330239-45330261 CTGAGGACCTACCATGTACCAGG + Intergenic
1148339911 17:46867224-46867246 GTGAGCATCTACCATGTGCCAGG - Intronic
1148383051 17:47213958-47213980 TTGAGCATCTACCATGTGTCAGG + Intronic
1148546275 17:48521590-48521612 CTGAGCATCTACTATGTTCCAGG + Intergenic
1148740961 17:49892187-49892209 TTGAGCATCTACTATGTGCCAGG + Intergenic
1148812159 17:50300290-50300312 CTGAGCATCTGCTATGTGCCAGG - Intergenic
1148955331 17:51349134-51349156 CTGGGGACCTAGCATGTGCCTGG - Intergenic
1149018495 17:51936177-51936199 CTGAGGACCTACTATGTGTCAGG + Intronic
1149437470 17:56645199-56645221 CTGAACACCTACTATGTGCCAGG + Intergenic
1149446639 17:56718280-56718302 TTGAGCATCTACCATGAGCCAGG + Intergenic
1149578100 17:57728134-57728156 CTGAATATCTCCCATGCGCCAGG + Intergenic
1150351718 17:64450325-64450347 CGGATGGTTTACCATATGCCTGG - Intronic
1150378602 17:64702783-64702805 ATGAACATCTACCATGTGCCAGG + Intergenic
1150541227 17:66102200-66102222 CTAAACATCTACCATGTGCCAGG + Intronic
1150552108 17:66220415-66220437 TTGAGCATCTACCATGTGCCAGG - Intronic
1150559640 17:66283422-66283444 TTGAGCATCTACTATGTGCCAGG + Intergenic
1150805609 17:68316456-68316478 TTGAGCACCTACCATGTGCCAGG - Intronic
1150840558 17:68601729-68601751 CTGAGCACCTACTATGTGCCAGG - Intergenic
1151086392 17:71385977-71385999 TTGAGTATCTACCATGTGCCAGG - Intergenic
1151147605 17:72055723-72055745 CTGATTCTCTACTATGTTCCTGG + Intergenic
1151434959 17:74089413-74089435 CGGAGTATCTACCATGTGCCAGG + Intergenic
1151773457 17:76180502-76180524 CTGAGTATCTACTATGTGCCAGG + Intronic
1151844892 17:76645817-76645839 CTGCTGCTGTAGCATGTGCCTGG + Intergenic
1152332297 17:79680261-79680283 CTGAGCATCTACTATGTGACAGG - Intergenic
1152979593 18:263756-263778 TTGAGCATCTACTATGTGCCTGG - Intronic
1153445712 18:5170522-5170544 ATGAGGATGTACAATGTGCCAGG - Intronic
1153528431 18:6019569-6019591 CTGAGCATCTACTAGGTGCCAGG + Intronic
1153705813 18:7744604-7744626 TTTATTACCTACCATGTGCCAGG - Intronic
1153757807 18:8301574-8301596 ATATTGATCTGCCATGTGCCAGG + Intronic
1154074828 18:11189507-11189529 CTGATCACCTGCTATGTGCCAGG + Intergenic
1154307425 18:13240772-13240794 CTGAAGACCTACTATGTGCTAGG - Intronic
1155150331 18:23117883-23117905 CTGAGTACCTACTATGTGCCAGG + Intergenic
1155275572 18:24184379-24184401 CTGAACACCTACTATGTGCCAGG + Intronic
1155359179 18:24983024-24983046 CTGTTGAGTCACCATGTGCCTGG + Intergenic
1155421021 18:25655904-25655926 TTGATTATTTACCATGTGCCAGG - Intergenic
1155565760 18:27132527-27132549 CTGAGCATCTACTATGTGCCAGG + Intronic
1156013852 18:32525950-32525972 CTGAGTATCTACCATGTGCTAGG - Intergenic
1156046007 18:32878164-32878186 TTGAGCACCTACCATGTGCCAGG - Intergenic
1156270026 18:35522141-35522163 TTGAACACCTACCATGTGCCTGG + Intergenic
1156373044 18:36488626-36488648 CTGAGTATCTAGCTTGTGCCAGG + Intronic
1156672246 18:39484939-39484961 CTGATGGTTTACTATGTGCCAGG + Intergenic
1156888276 18:42160630-42160652 TTTCTGATCTATCATGTGCCAGG + Intergenic
1156970380 18:43147062-43147084 CTGAGGATCTACTATGTTACAGG + Intergenic
1157243342 18:46032143-46032165 CTGAACATCCACCATGTGCCAGG + Intronic
1157247056 18:46063998-46064020 CTGAGAATCTGTCATGTGCCAGG + Intronic
1157364796 18:47054877-47054899 CTGAAGATCAACAATGAGCCAGG + Intronic
1157511702 18:48280002-48280024 TTGAGCATCTACTATGTGCCAGG + Intronic
1157703423 18:49780150-49780172 TTGTGCATCTACCATGTGCCAGG + Intergenic
1157743204 18:50111910-50111932 CTGAGTACCTACTATGTGCCAGG + Intronic
1158254816 18:55533889-55533911 CTGAGCATCCACCCTGTGCCAGG + Intronic
1158257927 18:55573878-55573900 TTGAGCATCTACCATGTGTCAGG - Intronic
1158289912 18:55928801-55928823 CTGAGCACCTACAATGTGCCAGG - Intergenic
1158360656 18:56668925-56668947 CTGAGCATCTGCCATGTGCTAGG + Intronic
1158837999 18:61351847-61351869 TTGAGAATCTACCATGTGACAGG - Intronic
1159081541 18:63740990-63741012 TTGAAGATCTACCATGCTCCCGG - Intergenic
1159608994 18:70505661-70505683 TTGATCATCTACTAAGTGCCAGG - Intergenic
1160290305 18:77586945-77586967 CTGCTGCTCTACCACGTTCCTGG - Intergenic
1160348038 18:78151139-78151161 TTGAGTATCTACCCTGTGCCAGG + Intergenic
1160435515 18:78849361-78849383 CTGATGATCTGTTAGGTGCCTGG - Intergenic
1161609304 19:5232082-5232104 TTGAACATCTACTATGTGCCAGG + Intronic
1161609318 19:5232205-5232227 CTGAACACCTACTATGTGCCAGG + Intronic
1161864754 19:6825693-6825715 TTGAGCATCTACTATGTGCCAGG - Intronic
1161924579 19:7291547-7291569 CTGAACACCTACTATGTGCCAGG + Intronic
1161968850 19:7564512-7564534 CTGAGCACCTACCATGAGCCAGG - Intergenic
1162126353 19:8501611-8501633 CTGAGCACCTACCATGTTCCAGG - Intronic
1162182692 19:8881255-8881277 CTGTCGATCTACCATGTACAAGG + Intronic
1162312498 19:9915151-9915173 CTGAGCATCTACTATGTCCCAGG + Intronic
1162571295 19:11475158-11475180 CTGAGCATCTACTGTGTGCCAGG + Intronic
1162850595 19:13428419-13428441 CTGAGGTTCTACTATGTGCTAGG - Intronic
1163171426 19:15534182-15534204 ATGAGCATCTACCATGTGCCAGG + Intronic
1163172076 19:15538423-15538445 CTGAGCATCAACTATGTGCCAGG - Intronic
1163201613 19:15773843-15773865 CTGAGTATCTACTATGTGCTAGG + Intergenic
1163205691 19:15800999-15801021 CTCATGATATGCCATGTGCAAGG - Intergenic
1163342745 19:16720176-16720198 CTGAGCACCTACTATGTGCCAGG + Exonic
1163497761 19:17656487-17656509 CTGAGCACCTACGATGTGCCAGG + Intronic
1163681088 19:18683169-18683191 CTGAGCACCTACTATGTGCCAGG - Intergenic
1164400821 19:27901046-27901068 CTGAGCATCTACTATGTGCCAGG + Intergenic
1164690537 19:30207704-30207726 CTGAGCATGTACTATGTGCCAGG - Intergenic
1164708279 19:30336318-30336340 CTGAGCACCTACTATGTGCCAGG - Intronic
1164821818 19:31256632-31256654 TTGGTTATCTACCATGTGCCAGG + Intergenic
1164822457 19:31260637-31260659 TTGAGCATCTACTATGTGCCAGG + Intergenic
1165140140 19:33694549-33694571 CTGAACATTTACCATGGGCCAGG + Intronic
1165315474 19:35052788-35052810 CTGAGAACCTACTATGTGCCAGG - Intronic
1165393221 19:35550059-35550081 TTGAGGACCTACTATGTGCCAGG + Exonic
1165890749 19:39110829-39110851 TTGAGCATCTACCATGTGCCAGG + Exonic
1166170352 19:41024030-41024052 CTACAGAACTACCATGTGCCAGG - Intergenic
1166652026 19:44581977-44581999 TTGAACACCTACCATGTGCCAGG - Intergenic
1166842382 19:45705902-45705924 TTGAGCATCTACTATGTGCCAGG + Intergenic
1166950854 19:46427178-46427200 CTGAGGACCTACAGTGTGCCAGG - Intergenic
1167254051 19:48416602-48416624 CTGAGCATCTACTATGTGCCAGG + Intronic
1167573868 19:50308416-50308438 CTGCTGATGTGCCAAGTGCCAGG + Intronic
1167680863 19:50919825-50919847 CTGATCAACTACTATGTGCCAGG - Intergenic
1168140834 19:54385759-54385781 CTGAGCATCTATTATGTGCCAGG - Intergenic
1168157508 19:54484299-54484321 CTGAGCATCTATTATGTGCCAGG + Intergenic
1168331054 19:55568988-55569010 CTGAGCCTCTACTATGTGCCAGG - Intergenic
925120799 2:1416263-1416285 CTGAACATCTAGCATGTTCCAGG - Intronic
925153415 2:1632890-1632912 CTGAGTATCCACCATGTGCCAGG - Exonic
925238745 2:2303001-2303023 CTCATCATCTACTATTTGCCAGG + Intronic
925291089 2:2749181-2749203 CTGAGTATTTACCACGTGCCAGG - Intergenic
925425008 2:3742255-3742277 TTGAGCATCTACCATGTGCTAGG + Intronic
925427845 2:3765651-3765673 CTGAGCATCTGCTATGTGCCAGG + Intronic
925632193 2:5905896-5905918 TTGAGTATCTACCATGTGCCAGG - Intergenic
925653077 2:6113084-6113106 CTGATGATTCACCCTGCGCCAGG - Intergenic
926271818 2:11372376-11372398 CTGAGGGTCTTCTATGTGCCAGG - Intergenic
926380460 2:12282183-12282205 CTGATCATTTGCCATGTGCAAGG + Intergenic
926608492 2:14921976-14921998 CTGACTATCTACCACATGCCAGG + Intergenic
926785039 2:16510124-16510146 CTGATGACATACTATGTGCCAGG + Intergenic
926790845 2:16569879-16569901 TTGAGCATCTACTATGTGCCAGG - Intronic
927329612 2:21846587-21846609 TTGAGCATCTACCATGAGCCAGG + Intergenic
927450820 2:23207805-23207827 CTGAGCACCTACTATGTGCCAGG - Intergenic
927483100 2:23469741-23469763 CTGAGCATCTACTACGTGCCAGG + Intronic
927655500 2:24942069-24942091 CTGAGCATCTACCATGTGCCAGG - Intergenic
927695123 2:25234618-25234640 CAGATCACCAACCATGTGCCAGG + Intronic
927714716 2:25343897-25343919 CTGAGTGTCTACTATGTGCCAGG + Intergenic
927830336 2:26344843-26344865 CTTATTATCTACCATATACCAGG + Intronic
927894013 2:26769835-26769857 CTGAATACCTGCCATGTGCCAGG + Intronic
927934395 2:27067840-27067862 CTGAACATTTACTATGTGCCAGG + Intronic
928068365 2:28189470-28189492 CTGTGCAACTACCATGTGCCAGG - Intronic
928639437 2:33282720-33282742 CTGAGTGTCTACCTTGTGCCAGG + Intronic
928810798 2:35222831-35222853 TTGAACATCTACCATGTGTCAGG - Intergenic
928871103 2:35981007-35981029 CTGAGTATCTACTATGTGTCAGG - Intergenic
929467976 2:42163025-42163047 TTGAACACCTACCATGTGCCAGG + Intergenic
929800180 2:45093075-45093097 CTGAGCATCTACTATGTGTCAGG - Intergenic
929820284 2:45267820-45267842 CTGATTACCTACCACGTGCCAGG - Intergenic
929822738 2:45286441-45286463 CGGAAGACCTACTATGTGCCAGG + Intergenic
929841224 2:45466007-45466029 CTGAATATCTACCATGTGCCAGG + Intronic
930564892 2:53006410-53006432 TAGATTATCTACTATGTGCCAGG + Intergenic
930884769 2:56313366-56313388 CTGAAGGCCTACAATGTGCCAGG - Intronic
931667865 2:64623178-64623200 CTGAGGGTCTGCCCTGTGCCAGG + Intergenic
931873058 2:66482188-66482210 CTGAAAATCTACTATGTGCCAGG + Intronic
932118398 2:69075473-69075495 ATGAGCACCTACCATGTGCCTGG - Intronic
932257238 2:70298441-70298463 TTGAGCATCTACTATGTGCCAGG + Intronic
932455742 2:71848869-71848891 CTGAGCATGTACTATGTGCCAGG + Intergenic
932461284 2:71883487-71883509 GTGAGGATCCACCATGTGCCAGG + Intergenic
932471822 2:71964192-71964214 CTGAGCACCTACCATGGGCCAGG + Intergenic
932681216 2:73827475-73827497 CTGAGTGTCTACTATGTGCCAGG - Intergenic
932856001 2:75234643-75234665 TTGACTTTCTACCATGTGCCAGG + Intergenic
932950465 2:76287228-76287250 CTGAGCATTTACCATGTGCCAGG - Intergenic
932968453 2:76507116-76507138 CTGATGATATACCATCTAACAGG + Intergenic
933212119 2:79582246-79582268 CTGAGTATTTACCTTGTGCCTGG - Intronic
934040510 2:88124321-88124343 CTGAGGATCCATCATGTCCCAGG - Intronic
934321607 2:91975793-91975815 CTGATCATCTACCATGTGCCAGG - Intergenic
934972617 2:98775187-98775209 CTGAACATCCACCATGAGCCAGG - Intergenic
935043375 2:99456245-99456267 TTGAGTATCTACAATGTGCCAGG + Intronic
935350005 2:102144567-102144589 TTGACTATCTACTATGTGCCAGG + Intronic
937250707 2:120522122-120522144 TTACTGATCTAACATGTGCCAGG - Intergenic
937345625 2:121123657-121123679 CTGAGGACCTACCACGTGCCAGG + Intergenic
937703462 2:124890926-124890948 CTGTGTATTTACCATGTGCCAGG + Intronic
939154194 2:138504574-138504596 ATGAGCATCTACCATGTGCCAGG + Intronic
939182336 2:138818126-138818148 TTGAACATCTACCATGAGCCAGG - Intergenic
939308834 2:140445641-140445663 CTGAGGATCTACTATGTATCAGG + Intronic
940251044 2:151676903-151676925 TTGAACATTTACCATGTGCCAGG - Intronic
940653758 2:156463367-156463389 CTGATCATCCATCATGTGTCAGG - Intronic
940655509 2:156483413-156483435 CTGAAGACCTGCTATGTGCCAGG - Intronic
940745042 2:157557616-157557638 CTGATCATCTACTATGTGTCAGG - Intronic
940771352 2:157842241-157842263 CTGATGTTCTAACATGTGGATGG + Intronic
940878603 2:158923118-158923140 CTGATTATCTACCATGGGGGTGG + Intergenic
941039033 2:160599648-160599670 ATGACTATTTACCATGTGCCAGG - Intergenic
941083705 2:161091966-161091988 TTGAACATCTACTATGTGCCAGG - Intergenic
941102068 2:161307774-161307796 CTCATGATCTACTTTGTGCTAGG - Intergenic
941137050 2:161731126-161731148 CAGAATACCTACCATGTGCCAGG - Intronic
941220829 2:162778568-162778590 ATGCTTATCTACCGTGTGCCAGG - Intronic
941299530 2:163784170-163784192 TTGATCACCTACCATGTGCCAGG - Intergenic
941686406 2:168453328-168453350 TTGAGTATCTACAATGTGCCGGG + Intergenic
941865978 2:170335174-170335196 CTGAAGACCTACTATGTCCCTGG - Intronic
942057880 2:172201808-172201830 CTGAGCAGCTACCATGTTCCAGG - Intergenic
942115703 2:172726994-172727016 CTGAGCACCTACAATGTGCCAGG - Intergenic
942166160 2:173243044-173243066 CTGAGGACCTACTTTGTGCCTGG + Intronic
942226960 2:173825012-173825034 CTGAGCATCTCCCATCTGCCAGG + Intergenic
942723091 2:178974726-178974748 TTTAGGATCTACCATGTGGCAGG + Intronic
942895298 2:181046088-181046110 CTGATTATCTACCATGTGCCAGG - Intronic
944834794 2:203568504-203568526 CTGAGCACCTACCATGTTCCAGG + Intergenic
945007052 2:205419757-205419779 CTGAGAGTCTACTATGTGCCTGG - Intronic
945112225 2:206370873-206370895 CTGAGAACCTACCATGTGCTAGG + Intergenic
945270059 2:207929082-207929104 CTGAACACCTACCTTGTGCCAGG + Intronic
946033501 2:216723767-216723789 CTGAGTACCTACTATGTGCCAGG + Intergenic
946106654 2:217376277-217376299 CTGAGAACCTACCATGTGCCAGG + Intronic
946132544 2:217618064-217618086 CTGAGTACCTACTATGTGCCAGG + Intronic
946342708 2:219081528-219081550 CTGAGAGTCTACTATGTGCCAGG + Intronic
946352055 2:219161604-219161626 CTGAGCATCTCCCATGTGCAAGG - Intronic
946541649 2:220690410-220690432 TTTAGCATCTACCATGTGCCTGG - Intergenic
946774615 2:223124581-223124603 CTGAACACCTACAATGTGCCAGG + Intronic
946984303 2:225254969-225254991 CTGAATATCTACTATGTGCAGGG - Intergenic
947929728 2:233953614-233953636 CTGAGCATCTGCCATGTGCCAGG + Intronic
948234214 2:236375336-236375358 ATGAGAATCTACCACGTGCCAGG + Intronic
948278486 2:236728342-236728364 CTGAGCATCTACTATGTGCAAGG + Intergenic
948417836 2:237828000-237828022 CTGAGCACCTACTATGTGCCAGG - Intronic
949077892 2:242072905-242072927 CTTCTGATCTACCATGGGCAGGG - Intergenic
1168751149 20:282401-282423 TTGAGCACCTACCATGTGCCAGG - Intronic
1168861816 20:1051112-1051134 CTGACCACTTACCATGTGCCTGG - Intergenic
1168887222 20:1267966-1267988 CTGAGAACCTACTATGTGCCAGG - Intronic
1168942144 20:1721749-1721771 CTGAAAACCTACTATGTGCCAGG - Intergenic
1169111145 20:3034928-3034950 CTGAGAGCCTACCATGTGCCAGG + Intronic
1169460198 20:5787666-5787688 CTGAGCACCTACCATGTGCCAGG - Intronic
1169510267 20:6256257-6256279 CTGAGCACCTACTATGTGCCAGG - Intergenic
1169815945 20:9656230-9656252 CTGCTCATCTACTATGTGCCAGG - Intronic
1169817406 20:9672327-9672349 CTGAGTATCTAGTATGTGCCAGG - Intronic
1170206346 20:13802739-13802761 CTGAGCATCTACCATGGTCCTGG - Intronic
1170301145 20:14885902-14885924 TTGAGTATCTACAATGTGCCAGG + Intronic
1170409651 20:16075014-16075036 TAGAGGGTCTACCATGTGCCAGG - Intergenic
1170530872 20:17290225-17290247 CTGAAGACCTACTGTGTGCCAGG - Intronic
1170587281 20:17744402-17744424 CTGAGCACCTACTATGTGCCTGG + Intergenic
1170663171 20:18362673-18362695 CTGATAATCTACTTTGTGCCAGG + Intergenic
1170868658 20:20184320-20184342 TTGAGCATCTACCATGTGCCAGG + Intronic
1171056193 20:21909223-21909245 CTGGGGATCTACCATGTGTCAGG - Intergenic
1171522006 20:25783315-25783337 ATTATCACCTACCATGTGCCAGG + Intronic
1171529759 20:25845260-25845282 TTTATCACCTACCATGTGCCAGG + Intronic
1171554819 20:26072568-26072590 ATTATCACCTACCATGTGCCAGG - Intergenic
1171934313 20:31259072-31259094 TTGAGCATCTACTATGTGCCAGG - Intronic
1171961646 20:31498902-31498924 CTCAAGATCTTCCCTGTGCCTGG - Intergenic
1171990784 20:31694636-31694658 CTGAAGGTTTACCATATGCCAGG + Intronic
1172020481 20:31910309-31910331 CTGAGCATGTACCATGTGCCAGG + Intronic
1172135422 20:32683437-32683459 CTGAGGATCTACTTTGTACCAGG - Intergenic
1172226740 20:33310360-33310382 CTGAGTATCTACCATGTATCTGG - Intergenic
1172484147 20:35288343-35288365 CTGAGTACCTGCCATGTGCCAGG - Intronic
1172556152 20:35843172-35843194 CAGAAGATCTACAATGTGCCAGG - Intronic
1172599361 20:36173370-36173392 CTGAGGGTCTACCAAGCGCCAGG + Intronic
1172801297 20:37578119-37578141 CTGAGCACCTACTATGTGCCAGG + Intergenic
1172836617 20:37877408-37877430 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1172844473 20:37921492-37921514 CTGAGCATCTACTATGTGCATGG + Intronic
1172942390 20:38663499-38663521 CTGGTTATCTGCCATGTGCCAGG + Intergenic
1173114204 20:40224599-40224621 TTGATGACCTACTATGTGTCAGG + Intergenic
1173170992 20:40723747-40723769 CTGACCACCTACTATGTGCCAGG + Intergenic
1173186665 20:40845441-40845463 CTGATCCTCTGCCATGTGCTAGG + Intergenic
1173202926 20:40967221-40967243 CTGAGCATCTACTGTGTGCCAGG - Intergenic
1173234438 20:41231662-41231684 CTGATTGCCTACCATGTGTCAGG - Intronic
1173338245 20:42130666-42130688 CTGAGTATCTGCCATGTGGCAGG + Intronic
1173416589 20:42862319-42862341 CTGAACACCTACCATGTGCCAGG - Intronic
1173459233 20:43229540-43229562 TTGAGCATCTACCATGTACCAGG + Intergenic
1173498714 20:43536927-43536949 CTGAGCATCTACTATGGGCCAGG + Intronic
1173538512 20:43833700-43833722 CTGAGGACCTGCTATGTGCCAGG + Intergenic
1173553861 20:43951655-43951677 CTGATCATCTACCATGAGTCAGG - Intronic
1173560437 20:44001382-44001404 CTGAGTACCTACTATGTGCCAGG - Intronic
1173659924 20:44726167-44726189 CTGATATAGTACCATGTGCCAGG - Intronic
1173862443 20:46293040-46293062 CTGAGCATCTACTCTGTGCCAGG - Intronic
1173870434 20:46338313-46338335 TTGTTGATCAACTATGTGCCTGG + Intergenic
1173951103 20:46994016-46994038 TTAAGGATCTACCATGAGCCAGG - Intronic
1173965041 20:47106291-47106313 CTGAGCTCCTACCATGTGCCAGG - Intronic
1174228627 20:49025642-49025664 CTGAGAATCTACCATGTACTGGG - Intronic
1174505015 20:51011762-51011784 CTGAATACCTACTATGTGCCAGG - Intronic
1174572565 20:51512475-51512497 CTGGGGACCTGCCATGTGCCAGG - Intronic
1174622495 20:51886665-51886687 TTGAGCATCTACTATGTGCCTGG - Intergenic
1174693305 20:52531403-52531425 TTGAAGACCTACTATGTGCCAGG + Intergenic
1174775676 20:53341113-53341135 TTGAGCATCTACTATGTGCCAGG - Intronic
1174830614 20:53808814-53808836 CTGAGCACCTACTATGTGCCAGG - Intergenic
1174866408 20:54140550-54140572 TTGAGCATCTACTATGTGCCGGG + Intergenic
1174870854 20:54180648-54180670 TTGAGCATCTACTATGTGCCAGG + Intergenic
1175102267 20:56587819-56587841 CTGAGCACCTACTATGTGCCAGG + Intergenic
1175192503 20:57221057-57221079 CTGAGCACCTACTATGTGCCAGG + Intronic
1175264531 20:57694756-57694778 CTGAATGCCTACCATGTGCCAGG - Intronic
1175364452 20:58442646-58442668 CTGAGGGTCTAATATGTGCCCGG + Intronic
1175365866 20:58455722-58455744 CTGAGCATCCATCATGTGCCAGG - Intergenic
1175373476 20:58508701-58508723 CTGAGTACCTACTATGTGCCAGG + Intronic
1175740020 20:61413661-61413683 CTGAGCATCTACTATGTGCAAGG - Intronic
1176655813 21:9588303-9588325 ATTATCACCTACCATGTGCCAGG + Intergenic
1177749564 21:25263286-25263308 CTCATGATCTTCCATGTCCATGG - Intergenic
1178137583 21:29645097-29645119 CTGATAATTTACTATGTGCCAGG + Intronic
1178829630 21:36045062-36045084 CTGAACACCTACTATGTGCCAGG + Intronic
1178967041 21:37130520-37130542 CTGAAGATTTACTATGTTCCAGG - Intronic
1179144436 21:38754859-38754881 TTGAGCACCTACCATGTGCCAGG - Intergenic
1179645324 21:42771776-42771798 CTGAGCGCCTACCATGTGCCTGG - Intronic
1179839505 21:44062258-44062280 CTGAGGGACCACCATGTGCCAGG + Intronic
1180309865 22:11159752-11159774 CTGATCATCTACGGTGTGCCAGG - Intergenic
1180539484 22:16429805-16429827 CTGAATATCTACTCTGTGCCAGG - Intergenic
1180548342 22:16521562-16521584 CTGATCATCTACGGTGTGCCAGG - Intergenic
1180661246 22:17469218-17469240 CTGAAGGCATACCATGTGCCAGG + Intronic
1180798273 22:18618505-18618527 CTGAGCACCTATCATGTGCCAGG - Intergenic
1181223446 22:21376760-21376782 CTGAGCACCTATCATGTGCCAGG + Intergenic
1181255295 22:21558862-21558884 CTGAGCACCTATCATGTGCCAGG - Intronic
1181362460 22:22348530-22348552 CTGAACAACTACTATGTGCCAGG + Intergenic
1181365249 22:22371516-22371538 CTGAATACCTACTATGTGCCAGG + Intergenic
1181726834 22:24817223-24817245 CTGGGGATGTACTATGTGCCAGG + Intronic
1181813217 22:25417995-25418017 TTGAGGATCTACCAGGTGCCAGG + Intergenic
1181822349 22:25485942-25485964 CTGAGAACCTACCATGTGCCAGG - Intergenic
1181841627 22:25667912-25667934 CTGACCATGTACGATGTGCCAGG + Intronic
1181906803 22:26204175-26204197 TTGAGTATCTACAATGTGCCAGG + Intronic
1181920116 22:26313996-26314018 CTAAGCATCTACTATGTGCCGGG + Intronic
1181947329 22:26528381-26528403 CTGTACATCTACTATGTGCCAGG + Intronic
1181968806 22:26674836-26674858 CTAAGGATCTACTATGTGCCAGG + Intergenic
1182060577 22:27394285-27394307 CTGAACATTTACTATGTGCCTGG - Intergenic
1182070879 22:27462899-27462921 CTGATGAGCTTCCATGTGCAGGG + Intergenic
1182104568 22:27680276-27680298 TTGAGCATCTACTATGTGCCAGG - Intergenic
1182125963 22:27816027-27816049 CTGAGCACCTACTATGTGCCAGG + Intergenic
1182128558 22:27834268-27834290 GTGAGGGTTTACCATGTGCCCGG + Intergenic
1182211108 22:28678737-28678759 CTGATCATCTACAGTGTGTCAGG + Intronic
1182512207 22:30827490-30827512 ATGAGCAGCTACCATGTGCCAGG - Intronic
1182671265 22:31997868-31997890 ATGAGCATCTACTATGTGCCAGG + Intergenic
1182982839 22:34687893-34687915 TTGAGCATCTATCATGTGCCAGG + Intergenic
1183099404 22:35574707-35574729 CTGAGTACCTACTATGTGCCAGG - Intergenic
1183104115 22:35603912-35603934 TTGAGCATCTACCATGTACCAGG - Intergenic
1183242113 22:36665426-36665448 CTGAGCATTTACTATGTGCCAGG - Intronic
1183329824 22:37213380-37213402 CTGAGCACCTACTATGTGCCAGG + Intergenic
1183391294 22:37546828-37546850 CTGAGCACCTACTATGTGCCAGG - Intergenic
1183411947 22:37659877-37659899 CTGAACACCTACTATGTGCCAGG - Intronic
1183516742 22:38271274-38271296 CTGAGCATCTACTATGTGCCAGG - Intronic
1183556391 22:38530604-38530626 TTGATTACTTACCATGTGCCAGG - Intronic
1183675442 22:39296732-39296754 CTGAGCATCTACTATATGCCAGG - Intergenic
1184180474 22:42820500-42820522 CTGAGCACCTACTATGTGCCAGG + Intronic
1184190966 22:42894070-42894092 CTGAGCACCTACCATGTGCCAGG + Intronic
1184195161 22:42922722-42922744 GTGAACATCTACCATGTGCCAGG + Intronic
1184318549 22:43719784-43719806 TTGAGTATCTACCAAGTGCCAGG - Intronic
1184341794 22:43890180-43890202 CTGAGCACCTACTATGTGCCAGG - Intronic
1184381878 22:44149811-44149833 CTGAGCAGCTACTATGTGCCAGG - Intronic
1184402893 22:44284259-44284281 CTGAGGACCTACTATGTGCCAGG + Intronic
1184406396 22:44303170-44303192 CTGAGCATCTACTATGTGCCCGG + Intronic
949385980 3:3502786-3502808 TTGAAGAATTACCATGTGCCAGG - Intergenic
949639464 3:6019030-6019052 ATGATGCTCACCCATGTGCCTGG + Intergenic
949656740 3:6229510-6229532 CTGAGGACCTACCCTGTGCCAGG + Intergenic
949674148 3:6433539-6433561 CTGATTATTTACCACATGCCAGG - Intergenic
949676985 3:6466884-6466906 CTGAGGACTTCCCATGTGCCAGG + Intergenic
949868075 3:8563104-8563126 TTGTTCATCTACTATGTGCCTGG + Intronic
949904075 3:8843821-8843843 CTGAGCATCTACTAAGTGCCAGG - Intronic
949937720 3:9129710-9129732 CTGATGACCTATTATGTGCTGGG - Intronic
949948186 3:9206958-9206980 CTGAGCATCTACTATGTGCCAGG - Intronic
950142918 3:10627723-10627745 TTGAGCACCTACCATGTGCCAGG + Intronic
950229365 3:11262903-11262925 CTGAGCACATACCATGTGCCAGG + Exonic
950274566 3:11647767-11647789 TTGATGGCCTACCATGCGCCAGG - Intronic
950276487 3:11665709-11665731 CTGATCACCTCCCAGGTGCCAGG + Intronic
950452689 3:13074023-13074045 CCGAGGACCTTCCATGTGCCGGG + Intergenic
950580890 3:13861389-13861411 TTGAGCATCTACTATGTGCCAGG + Intronic
950585201 3:13887327-13887349 CTGAGGACCTAGTATGTGCCAGG + Intergenic
950668824 3:14513171-14513193 CTGAGCACCTACTATGTGCCAGG + Intronic
950680648 3:14582927-14582949 CTGAGCAGCTACTATGTGCCAGG - Intergenic
950769072 3:15296520-15296542 CTGAGCACCTACCATATGCCAGG - Intronic
951162535 3:19442161-19442183 CTGAAGAGCTACAATGTGCCAGG + Intronic
951409211 3:22341863-22341885 CTGAGCACCTACTATGTGCCTGG - Intronic
951586296 3:24218609-24218631 GTGAGTATCTACTATGTGCCAGG + Intronic
951631870 3:24730712-24730734 CTGAGGACCTACCATGTTCCAGG - Intergenic
951688298 3:25369354-25369376 CTGAATGCCTACCATGTGCCAGG + Intronic
951693673 3:25423568-25423590 TTGAATACCTACCATGTGCCAGG - Intronic
951697299 3:25458964-25458986 TTGATTATCTGCCATGTGCCAGG + Intronic
952036030 3:29202859-29202881 TTGAGGACCTACTATGTGCCAGG + Intergenic
952385408 3:32838034-32838056 TTGAGCATCTGCCATGTGCCTGG + Intronic
952545072 3:34410230-34410252 CTGAACACCTACCAAGTGCCAGG + Intergenic
952710553 3:36427657-36427679 TTGAGCATCTAACATGTGCCAGG + Intronic
952771591 3:37006369-37006391 TTGAGGAACTACCATGTGTCAGG - Intronic
953352545 3:42226810-42226832 TTGAGCACCTACCATGTGCCAGG + Intergenic
953505022 3:43477376-43477398 CTGAGCATCTACCATATGCTAGG + Intronic
953564085 3:44016242-44016264 CTGAGCACCTAACATGTGCCAGG - Intergenic
953591603 3:44261188-44261210 CCGAGGACCTACCATGTTCCTGG - Intronic
953717169 3:45325764-45325786 CTGGGCATCTCCCATGTGCCAGG - Intergenic
954025398 3:47779106-47779128 CTGAGCATTTACCATGTGCCGGG - Intronic
954550912 3:51480924-51480946 ATGATGATCTACCCACTGCCTGG + Intronic
954811962 3:53254267-53254289 CTGCAGAGCTACCGTGTGCCAGG + Intronic
954928699 3:54261064-54261086 CTGAGCATCTACTATGCGCCAGG - Intronic
954954659 3:54508499-54508521 TTGAGCATCTACCATGTGCTGGG - Intronic
954988719 3:54819336-54819358 TTGAGGGTCTACCATATGCCAGG - Intronic
955004063 3:54953138-54953160 CTGAATATTTACTATGTGCCTGG + Intronic
955088943 3:55730491-55730513 CTGAGCACCTACTATGTGCCTGG + Intronic
955104411 3:55883089-55883111 CTGATGATCTACTATGTGCTAGG - Intronic
955168272 3:56537138-56537160 CTGAGCACCTACAATGTGCCAGG + Intergenic
955205294 3:56890271-56890293 CTGAGCATTTACTATGTGCCAGG + Intronic
955214321 3:56972405-56972427 CTGAGTGTCTACCATGTGCTAGG + Intronic
955402505 3:58603304-58603326 CTGAACACCTACTATGTGCCAGG + Intronic
955413388 3:58670406-58670428 CTGAGCATCTACTATGGGCCAGG - Intergenic
955434510 3:58888267-58888289 TTGAGGCTCTACTATGTGCCAGG + Intronic
955531022 3:59873261-59873283 CTGAATAGCCACCATGTGCCTGG - Intronic
955697946 3:61655436-61655458 CTGAACATCTACTATGTGCCAGG - Intronic
955885075 3:63589425-63589447 TTGAGAATCTACCAGGTGCCAGG - Intronic
955939281 3:64132575-64132597 TTGAGTGTCTACCATGTGCCAGG - Intronic
955950223 3:64236286-64236308 TTGAGGACCTACTATGTGCCAGG - Intronic
956190585 3:66604043-66604065 CTGAGCACCTACTATGTGCCAGG - Intergenic
956302202 3:67784366-67784388 TTGAGTTTCTACCATGTGCCAGG + Intergenic
956353343 3:68363181-68363203 TTGAACACCTACCATGTGCCAGG - Intronic
956457870 3:69441664-69441686 CTGAACAGCTGCCATGTGCCAGG - Intronic
956724765 3:72147913-72147935 CTGAGTACCTACTATGTGCCAGG - Intergenic
956951246 3:74285608-74285630 CTGAAGACCTACTATGTGCTAGG + Intronic
957566609 3:81892212-81892234 CTGAGGTTCCACCTTGTGCCAGG + Intergenic
959967529 3:112373713-112373735 CTGAAGCTCTACAATGTTCCAGG - Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960363299 3:116740607-116740629 CAGAGGATTTACTATGTGCCAGG + Intronic
960682634 3:120264958-120264980 TTGATCACCTACTATGTGCCAGG - Intronic
960997241 3:123348355-123348377 TTGAGCACCTACCATGTGCCAGG + Intronic
961051580 3:123751603-123751625 TTCAGTATCTACCATGTGCCAGG + Intronic
961055064 3:123780781-123780803 CTGAATATCTACCACGGGCCGGG + Intronic
961112867 3:124299709-124299731 CTGATGACTTACTATGTGCCAGG - Intronic
961135558 3:124506929-124506951 CTGAGCTTCTACCATGTGCCAGG + Intronic
961361516 3:126371014-126371036 CTGAGTACCTACTATGTGCCTGG + Intergenic
961516402 3:127440150-127440172 CTGAGGACCTACTATGTGCCAGG - Intergenic
961538321 3:127583587-127583609 CTTAGGATCTACTATGTGTCAGG - Intronic
961676086 3:128567652-128567674 CTGAGCATGTGCCATGTGCCAGG - Intergenic
961736491 3:129004999-129005021 CCAAGCATCTACCATGTGCCAGG - Intronic
961749473 3:129086914-129086936 CTGAGCATCTACTGTGTGCCTGG + Intergenic
961786541 3:129350457-129350479 TTGAGTATCTACTATGTGCCAGG - Intergenic
961937593 3:130601979-130602001 CTCAAAATCTACCATGTCCCTGG - Intronic
962200042 3:133393445-133393467 CTAAGAACCTACCATGTGCCAGG - Intronic
962284399 3:134074367-134074389 CTGAGGACTTACTATGTGCCTGG - Intronic
962607005 3:137040687-137040709 CTGACTACCTACTATGTGCCTGG - Intergenic
962629185 3:137258724-137258746 CTGAATATCTATTATGTGCCAGG - Intergenic
962713197 3:138104367-138104389 CTGAGGACCTGCTATGTGCCAGG - Intronic
962835153 3:139183311-139183333 CTGAACACCTACTATGTGCCAGG + Intronic
962873142 3:139515582-139515604 ATGAAGATCTATTATGTGCCAGG - Intergenic
962945074 3:140161030-140161052 CGGAGCACCTACCATGTGCCAGG + Intronic
963324677 3:143849499-143849521 CAGATCATCTTCCATGTGGCAGG + Intergenic
963551106 3:146724241-146724263 TTGAATTTCTACCATGTGCCCGG - Intergenic
963730101 3:148962972-148962994 TTGATAATTTACTATGTGCCAGG + Intergenic
963783211 3:149507938-149507960 GTGAGCACCTACCATGTGCCAGG - Intergenic
963925004 3:150942542-150942564 CTGAGCACCTACTATGTGCCAGG + Intronic
964025031 3:152062680-152062702 CTGAGCATCTACTATGAGCCAGG + Intergenic
964849204 3:161076982-161077004 GTGAGCATCTACTATGTGCCAGG + Exonic
964899162 3:161636919-161636941 CTGATTGTCTACTATATGCCTGG + Intergenic
965447894 3:168798673-168798695 CTGAATACCTACCATGTGCTAGG + Intergenic
965453849 3:168873196-168873218 CTGAGTATCTACTATGTGTCAGG - Intergenic
965676196 3:171199485-171199507 CTGAGAATTTACCATGTGCCAGG + Intronic
966236718 3:177709434-177709456 TTGAGCATCAACCATGTGCCAGG - Intergenic
966248869 3:177839449-177839471 CTGAGCACCTACCATGTGCCAGG + Intergenic
966253270 3:177890715-177890737 TTGAGTATCTACTATGTGCCAGG - Intergenic
966379395 3:179328506-179328528 CTTATTGTCTACCATGTGCTAGG + Intronic
966830096 3:184000475-184000497 CTGAGGGCCTACTATGTGCCAGG + Intronic
966910077 3:184554665-184554687 CTGAAGACCTACTATGTGCTAGG + Intronic
967168527 3:186805849-186805871 CGGAGCATCTACCATGTACCAGG - Intronic
967213522 3:187190506-187190528 ATTATCAACTACCATGTGCCAGG - Intergenic
967266956 3:187699513-187699535 CTGAGGACCTACAGTGTGCCAGG - Intronic
967332701 3:188307653-188307675 CTGAGCATCTATTATGTGCCAGG - Intronic
967681494 3:192369158-192369180 CTCCTCATCTACCTTGTGCCTGG - Intronic
967825485 3:193874003-193874025 CTGAACACCTACTATGTGCCAGG + Intergenic
967845069 3:194036471-194036493 ATTAGGATCTACCATGTGTCAGG + Intergenic
968007148 3:195250868-195250890 CTGGGCATCTACTATGTGCCAGG - Intronic
968081941 3:195852614-195852636 CTGAGTGCCTACCATGTGCCAGG + Intergenic
969063092 4:4454886-4454908 CTAAGCATTTACCATGTGCCAGG - Intronic
969091814 4:4699795-4699817 CTGAGCATCTAGTATGTGCCAGG + Intergenic
969221399 4:5761210-5761232 CTGAGCACCTACCATGTGCCAGG - Intronic
969253464 4:5986891-5986913 CTGCCTATCTACTATGTGCCAGG - Intronic
969255304 4:5997276-5997298 CTGAGCATCTACTATGTGGCAGG + Intergenic
969427402 4:7133354-7133376 CTGGTGATCTGCCATGAGCCTGG - Intergenic
969465430 4:7353524-7353546 CTGAGCATCTACTAAGTGCCAGG - Intronic
969481105 4:7447394-7447416 TTGAGGGTTTACCATGTGCCAGG - Intronic
969941216 4:10733662-10733684 CTGAGCATCTGCCATATGCCAGG + Intergenic
970001277 4:11368523-11368545 CTGACCACCTACTATGTGCCAGG - Intergenic
970209541 4:13694533-13694555 CAGATGATGTAGAATGTGCCAGG - Intergenic
970241816 4:14016961-14016983 CTGAGCATCTATCATGTTCCGGG - Intergenic
970528005 4:16952391-16952413 CTGTTCACCTACTATGTGCCAGG + Intergenic
970607538 4:17694681-17694703 CTTGAGATCTACTATGTGCCAGG + Intronic
970847750 4:20562622-20562644 CTGAGCATCTACATTGTGCCAGG - Intronic
971169304 4:24216977-24216999 GTGATGACCTACTATGTGTCAGG - Intergenic
971750130 4:30636310-30636332 CTGAACATCTTCTATGTGCCAGG + Intergenic
972359423 4:38313865-38313887 CTGATTACCTTCCCTGTGCCAGG - Intergenic
973632628 4:52833710-52833732 CTGAGCATCTACTATGTACCAGG - Intergenic
973648021 4:52969491-52969513 CTGTTCATCTACTGTGTGCCTGG - Intronic
973662056 4:53118252-53118274 CTGAGCACCTACTATGTGCCAGG - Intronic
973831627 4:54765385-54765407 CTGAACACCTACTATGTGCCAGG - Intergenic
974104045 4:57447487-57447509 CTGAGCCTCTACCATGTGACAGG - Intergenic
974834769 4:67234689-67234711 CTGAGCATTTACCAAGTGCCAGG + Intergenic
975682274 4:76888605-76888627 GTGAGGATCTACTATGTGCCAGG + Intergenic
975849212 4:78554240-78554262 CTGAGCATCTACCATATGCAAGG - Intronic
975855558 4:78620850-78620872 TTGATAATCTAATATGTGCCAGG - Intergenic
976036160 4:80823675-80823697 CTGAATATCTACCTTATGCCTGG + Intronic
976207385 4:82636044-82636066 CTGATCACCTACTACGTGCCAGG + Intronic
977563813 4:98561448-98561470 CTGAATATCTACCATTTTCCAGG - Intronic
977828706 4:101564574-101564596 CTGATAACCTACTATGTGCCAGG - Intronic
978368481 4:108007015-108007037 CTGAGCATCTACTATGTGCCGGG - Intronic
978405855 4:108377976-108377998 CTGAGTACCTACGATGTGCCTGG + Intergenic
979100846 4:116611915-116611937 TTGAACATCTACCATTTGCCAGG - Intergenic
979239234 4:118433777-118433799 TTGAGTGTCTACCATGTGCCAGG + Intergenic
979572832 4:122250503-122250525 ATGATAATCTTCCATGTGACCGG + Exonic
979660311 4:123245888-123245910 CTGAGTATCTACTATGTGTCAGG - Intronic
979921991 4:126509149-126509171 TTGATGAACTACTGTGTGCCAGG - Intergenic
979980252 4:127246452-127246474 ATGAGTATTTACCATGTGCCAGG + Intergenic
980916371 4:139036926-139036948 CTGATGGACTCCCCTGTGCCAGG - Intronic
981004165 4:139858060-139858082 CTGAGTATCTACAATGTGACAGG + Intronic
981264045 4:142759671-142759693 TTGATTGTTTACCATGTGCCTGG - Intronic
981595918 4:146421682-146421704 TTGATCATCTACTATGTACCAGG + Intronic
981660711 4:147163418-147163440 CTGAGTATCTACTGTGTGCCAGG + Intergenic
981848282 4:149195438-149195460 TTGAGCATCTACTATGTGCCAGG + Intergenic
982044701 4:151432382-151432404 TTGATGATCTGCTGTGTGCCAGG + Intronic
982304305 4:153913796-153913818 CTGAGGATCTACCTTGTGAAAGG + Intergenic
982711405 4:158761803-158761825 CTGAGGAGATACCATGTGCCAGG + Intergenic
983065060 4:163199777-163199799 CTGAATACCTATCATGTGCCAGG + Intergenic
983272834 4:165583288-165583310 CTGAACACTTACCATGTGCCAGG + Intergenic
983989922 4:174106155-174106177 CTGATCTGCTACTATGTGCCAGG - Intergenic
984682285 4:182624131-182624153 CTGAAGATATACCATGTCCCAGG - Intronic
986192797 5:5512319-5512341 CTACTCATCTACCATGTGCATGG - Intergenic
987713098 5:21529586-21529608 CTGAATATCTACTCTGTGCCAGG - Intergenic
988642640 5:33058243-33058265 CTGAGGGCCTACTATGTGCCAGG + Intergenic
988711959 5:33787889-33787911 CTGAGCATCTACCATGTGTGAGG + Intronic
988732427 5:33986455-33986477 TTGAGGATCTACTAGGTGCCAGG - Intronic
988829472 5:34973454-34973476 CTGAGCATCTACTGTGTGCCAGG + Intergenic
989051972 5:37330446-37330468 CTGAATACCTACCATGTGTCAGG + Intronic
989196574 5:38722521-38722543 CTGATTATCTACTATGTGCTAGG - Intergenic
990339419 5:54808010-54808032 CTGACCACCTACCATGTGTCAGG - Intergenic
990363604 5:55047059-55047081 TTGAGTATCTACCATGTGCCAGG - Intergenic
990504318 5:56429728-56429750 CTGAGCACCTACTATGTGCCAGG + Intergenic
990597423 5:57325546-57325568 TTGAAGATCTACAATGAGCCAGG + Intergenic
990737658 5:58881424-58881446 CTGAGGACCTACCATGTGCCTGG - Intergenic
990749268 5:58995574-58995596 TTGAGCATCTACTATGTGCCAGG - Intronic
991045955 5:62222758-62222780 TTGAGAATCTACCATGTACCAGG - Intergenic
991096146 5:62741642-62741664 CTGAATATCTAGCATATGCCAGG + Intergenic
991358772 5:65798151-65798173 CTGAACATGTACCAGGTGCCAGG + Intronic
991499899 5:67266903-67266925 CTGAAAATCTACTATGTTCCAGG + Intergenic
992024460 5:72656956-72656978 TTGAACATCCACCATGTGCCAGG + Intergenic
992182608 5:74212892-74212914 CTGAGCACCTACCAAGTGCCAGG - Intergenic
992226605 5:74624980-74625002 CTGAGGACCTACTATGTGCCAGG + Intergenic
992441287 5:76799852-76799874 TTGAGCATCTACAATGTGCCAGG + Intergenic
992867025 5:80968116-80968138 CTGACCATTCACCATGTGCCAGG - Intronic
993143251 5:84061075-84061097 CTGAGGGTATGCCATGTGCCAGG + Intronic
993560755 5:89404167-89404189 TTGAGGAACTACTATGTGCCAGG - Intergenic
993654179 5:90558034-90558056 CTGAGGGTTTACCACGTGCCAGG + Intronic
993865337 5:93188049-93188071 CTGATCACCTATAATGTGCCAGG - Intergenic
994171680 5:96664167-96664189 TTGATCATCTATTATGTGCCAGG + Intronic
994176209 5:96714086-96714108 CTATTGATGTACCATGTGCCAGG + Intronic
994263953 5:97692502-97692524 TTGAGCATCTACTATGTGCCAGG + Intergenic
994574558 5:101561039-101561061 CTGATTATCTACCATGTATTTGG + Intergenic
995190085 5:109310496-109310518 CTGAGTATTTACAATGTGCCAGG + Intergenic
995444538 5:112228090-112228112 TGGTTGATCTACCATGTGACAGG - Intronic
995464997 5:112442334-112442356 GTGAGTATCTACCATGAGCCAGG - Intergenic
995538745 5:113163645-113163667 GTGAAATTCTACCATGTGCCAGG - Intronic
995701073 5:114936576-114936598 ATGATTGTCTACTATGTGCCAGG + Intergenic
995831839 5:116362366-116362388 TTGAGGACCTACTATGTGCCAGG - Intronic
996300495 5:121978142-121978164 CTGAGCATTTACTATGTGCCAGG + Intronic
996313659 5:122136897-122136919 GTTATGACCTACAATGTGCCTGG + Intronic
996347762 5:122505613-122505635 TTGATCATCTACCATGTGCCAGG + Intergenic
996388016 5:122929094-122929116 TTAATGGTCTACCAAGTGCCAGG - Intronic
996555194 5:124771159-124771181 TTGAAAATCTACCGTGTGCCAGG + Intergenic
996593712 5:125177633-125177655 TTGATAAACTACTATGTGCCAGG - Intergenic
996630019 5:125619541-125619563 GTGATTATCTACTACGTGCCAGG + Intergenic
996672160 5:126130907-126130929 TTGAGTATCTACTATGTGCCAGG + Intergenic
996940571 5:129000364-129000386 TTGAGGATCTACTATGTGTCAGG - Intronic
997214607 5:132100454-132100476 CTGAGTAGCTTCCATGTGCCAGG - Intergenic
997261723 5:132470438-132470460 TTGATTATCTGCCATATGCCTGG + Intronic
997579394 5:135007823-135007845 TTGAGCATCTACCTTGTGCCAGG + Intronic
997616733 5:135251677-135251699 CTGAGGATTTACCATGTGCTTGG + Intronic
997723041 5:136095954-136095976 CTGAGTGTCTACTATGTGCCAGG + Intergenic
997787996 5:136731026-136731048 CTGAGGGCCTACCATGTGCCAGG - Intergenic
997791806 5:136768802-136768824 CTGAGCATCCTCCATGTGCCAGG - Intergenic
997822512 5:137078727-137078749 TTAATTGTCTACCATGTGCCAGG - Intronic
997824414 5:137093432-137093454 CTGAGAATCTACCATATGCTAGG + Intronic
997941364 5:138160584-138160606 CTGATCACCTACTATGTACCAGG + Intronic
998006858 5:138662799-138662821 CTGAGCATCTACTATGTGCCAGG - Intronic
998054963 5:139066631-139066653 CTGACCATCTACTATGTGCCAGG + Intronic
998066409 5:139162717-139162739 TTGATCATCTACTATATGCCAGG + Intronic
998207515 5:140168890-140168912 CCTATGGCCTACCATGTGCCAGG - Intergenic
998344115 5:141446226-141446248 CTGAAGATCTACCACTTGCCAGG - Intronic
998446087 5:142199540-142199562 CTGACGAGCGACCATGTGGCCGG + Intergenic
998497620 5:142604403-142604425 TTGATCACCTACAATGTGCCAGG + Intronic
998640498 5:144004920-144004942 CTCAAGCTATACCATGTGCCCGG - Intergenic
998804989 5:145909676-145909698 TTGAGCATCTACTATGTGCCAGG - Intergenic
998853144 5:146369897-146369919 CTGAGAACTTACCATGTGCCAGG - Intergenic
998854090 5:146378008-146378030 TTGAAGATCTCCTATGTGCCTGG + Intergenic
998944617 5:147324875-147324897 TTGATGACTTACTATGTGCCAGG + Intronic
999115168 5:149156404-149156426 CTGAGTATTTTCCATGTGCCAGG - Intronic
999205188 5:149842569-149842591 CTGATGGTTTACGAAGTGCCAGG + Intronic
999458757 5:151739895-151739917 CTGAGCATCTACCATGTGTGAGG + Intergenic
999938217 5:156511794-156511816 CTGATCATGTACTATGTGCTAGG - Intronic
1000160542 5:158593236-158593258 TTTATGATTTACCATGTACCCGG + Intergenic
1000170152 5:158694265-158694287 CTGAGCACCTACCACGTGCCTGG - Intergenic
1000268989 5:159664979-159665001 CTGATTACTTACCATGTGCCAGG - Intergenic
1000303984 5:159979426-159979448 CTGAACAAGTACCATGTGCCAGG - Intergenic
1000372559 5:160550912-160550934 CTGAACACCTAGCATGTGCCAGG - Intergenic
1000419730 5:161025043-161025065 CTTCTGATCTACCAAGTGGCAGG - Intergenic
1000688378 5:164282898-164282920 CTGAGTGTCTACCATGTGTCAGG + Intergenic
1000756669 5:165169515-165169537 CTGAGCATCTACAATGTGGCAGG - Intergenic
1000953136 5:167509688-167509710 CTGAGCACTTACCATGTGCCAGG + Intronic
1000966839 5:167667758-167667780 CTGTTGATTTCCCAGGTGCCTGG + Intronic
1000989940 5:167901263-167901285 TTGAGTATCTACCATGTGCTAGG - Intronic
1001080118 5:168661342-168661364 TTGAGCATCTACTATGTGCCAGG - Intergenic
1001137195 5:169112442-169112464 ATGAGGGTCTACCTTGTGCCTGG - Intronic
1001143601 5:169165084-169165106 CTGAGCACCTACTATGTGCCAGG - Intronic
1001240597 5:170067093-170067115 CTTAGGACCTACTATGTGCCAGG + Intronic
1001314217 5:170631323-170631345 CTGAGCACCTACTATGTGCCAGG - Intronic
1001321975 5:170690100-170690122 CTGAGGACCTACTATGTGCTGGG - Intronic
1001405481 5:171474017-171474039 CTAAGGACCTACTATGTGCCAGG - Intergenic
1001522390 5:172403855-172403877 CCAATAATCTACTATGTGCCAGG + Intronic
1001545619 5:172568923-172568945 CTGATAAACTCCCATGGGCCAGG - Intergenic
1001567664 5:172710761-172710783 GTGAAGATTTACCATGTGCCAGG - Intergenic
1001662094 5:173401751-173401773 CTGAGCACCTACTATGTGCCAGG + Intergenic
1001714826 5:173806791-173806813 CTGAAGATCTACCATGTGCTTGG - Intergenic
1001773806 5:174314095-174314117 CTGAGGGCCTTCCATGTGCCAGG - Intergenic
1001785549 5:174409609-174409631 TTGAGTATCCACCATGTGCCAGG + Intergenic
1001811326 5:174630461-174630483 CTGAGGACCTATTATGTGCCTGG + Intergenic
1001959912 5:175873399-175873421 CTCAGGATCTACCATGTACCAGG + Intronic
1002281697 5:178134031-178134053 CTGAGCATCTACCATGGACCAGG + Intronic
1002479230 5:179488503-179488525 TTGATTATCTACTATGTGCTTGG - Intergenic
1002739475 5:181424363-181424385 TTGAGTGTCTACCATGTGCCAGG + Intergenic
1002805546 6:570544-570566 CTGAACACCTACCATGTGCCAGG + Intronic
1002959358 6:1899187-1899209 CTAATTATTTACCATGTGCCTGG - Intronic
1003458872 6:6310727-6310749 CTGAGCATTTACCATGTACCAGG - Intronic
1003916776 6:10794307-10794329 CTGAGAATCTACCATGTGGCAGG + Intronic
1004094760 6:12541920-12541942 CTGAGCACCTACCATGTGCCAGG - Intergenic
1004194500 6:13490984-13491006 CTGAATATCTAGCAGGTGCCAGG - Intergenic
1004218833 6:13727438-13727460 TTGATGGCCTACTATGTGCCAGG - Intergenic
1004389743 6:15200020-15200042 TTAATGATTTACTATGTGCCAGG - Intergenic
1004616978 6:17300160-17300182 CTAACCACCTACCATGTGCCAGG + Intergenic
1004737299 6:18420377-18420399 CTGAGTGTCTACTATGTGCCAGG + Intronic
1004992940 6:21159582-21159604 CTGAGCATCTACCATAGGCCAGG - Intronic
1005387285 6:25298150-25298172 CTCATGACTTACTATGTGCCAGG - Intronic
1005432128 6:25769287-25769309 CTGAACATGTACTATGTGCCAGG + Intronic
1006591321 6:35160166-35160188 TTGAGTATTTACCATGTGCCAGG + Intergenic
1006596986 6:35200789-35200811 CCGAGGACCTACCATGTGGCAGG + Intergenic
1006621725 6:35369903-35369925 CTGAATACCTACCAAGTGCCAGG - Intronic
1006662052 6:35655251-35655273 CTGAATACCTACTATGTGCCAGG + Intronic
1007143977 6:39608874-39608896 CTGATGACCTACTAGTTGCCAGG + Intronic
1007257136 6:40537274-40537296 CTGAGGGCCTACGATGTGCCAGG - Intronic
1007286356 6:40750573-40750595 TTGAGCATCTATCATGTGCCAGG - Intergenic
1007329283 6:41091858-41091880 CTGAGCACCTACTATGTGCCAGG + Intronic
1007450407 6:41937593-41937615 CTGATCATTTACTAGGTGCCAGG + Intronic
1007533420 6:42563659-42563681 TTGAGGGTCTACCATGTGCCAGG + Intergenic
1007674545 6:43582214-43582236 CTGATGAGTTACCATGAGCATGG - Intronic
1007718827 6:43873261-43873283 CTGAGTACCTACCATGTACCAGG + Intergenic
1007730168 6:43940774-43940796 CTGATGGTCTCCCCTGTCCCGGG + Intergenic
1007817388 6:44534297-44534319 CGGAGCATCTACTATGTGCCAGG + Intergenic
1007819589 6:44551429-44551451 CTGAAGATCTGCTATGTGTCAGG + Intergenic
1007835910 6:44673627-44673649 CTGAGCACCTACCAAGTGCCAGG + Intergenic
1008004119 6:46391870-46391892 CTGAGCATCTACAATGTTCCAGG - Intronic
1008405095 6:51110117-51110139 CTGGTTATGTACCATGTGCTAGG - Intergenic
1008662555 6:53683057-53683079 CTGAGTATCTACCATGTGCCAGG + Intergenic
1008690670 6:53975172-53975194 CTGAGTAACTACTATGTGCCAGG + Intronic
1008894315 6:56534945-56534967 TTGAACATCTACCATGGGCCAGG - Intronic
1009003621 6:57752329-57752351 CTGAATATCTACTCTGTGCCAGG + Intergenic
1009297086 6:61965182-61965204 CTTATGGTTTGCCATGTGCCAGG + Intronic
1011424455 6:87211641-87211663 CTGAATATTTACCATGTGCTAGG - Intronic
1011520568 6:88200049-88200071 CTGAAGCTCTACCATGTGCCAGG - Intergenic
1011527621 6:88282236-88282258 CTGATCATCTACTATGTGCTAGG + Intergenic
1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG + Intronic
1011606227 6:89109036-89109058 TTGAGCACCTACCATGTGCCAGG + Intronic
1012341615 6:98132294-98132316 CTGAGTATCTATTATGTGCCAGG + Intergenic
1012530532 6:100230157-100230179 CTAATGACCTACCAAGTGCAAGG - Intergenic
1012539673 6:100347150-100347172 CTGAATGTCTACCATATGCCAGG + Intergenic
1012952971 6:105538671-105538693 TTGAGGATCTTCCATGTGCCAGG - Intergenic
1013144486 6:107374449-107374471 CTAAGGACCTACTATGTGCCAGG + Intronic
1013212631 6:108000529-108000551 CTCATATTCTTCCATGTGCCTGG - Intergenic
1013432809 6:110070142-110070164 CTGATCACCCACCATGTGCCAGG - Intergenic
1013642052 6:112094668-112094690 CTGAGAATCCACCATGAGCCAGG - Intronic
1014320217 6:119918719-119918741 TTGATCACCTACCCTGTGCCAGG + Intergenic
1015372399 6:132469105-132469127 TTGAAGACCTTCCATGTGCCAGG - Intronic
1015756029 6:136607754-136607776 CTGAGGACCTACTATGGGCCAGG + Intronic
1016787378 6:148026671-148026693 TTGAGCAACTACCATGTGCCAGG + Intergenic
1016851747 6:148626581-148626603 TTGAGGCTCTACTATGTGCCAGG - Intergenic
1016966964 6:149727925-149727947 CTGAGTACCTACTATGTGCCAGG + Intronic
1017193933 6:151680809-151680831 CTGAGCACCTACCATGTGCCAGG - Intronic
1017538404 6:155373276-155373298 CTGAGTATCTATTATGTGCCAGG + Intergenic
1017597961 6:156049819-156049841 TTGAACATCTACTATGTGCCTGG + Intergenic
1018342341 6:162864389-162864411 TTGATGACCTACTATGTGCCAGG + Intronic
1018677060 6:166231344-166231366 CTGAGAATCTACCATATGTCAGG + Intergenic
1018680924 6:166263952-166263974 CTTCTGATCTGCCATGTGCAAGG + Intergenic
1018825523 6:167405681-167405703 CTGTGGGCCTACCATGTGCCAGG + Intergenic
1018886710 6:167944335-167944357 CTGAGCACCTACTATGTGCCGGG - Intronic
1019102413 6:169641898-169641920 CTGAGAATCTACTCTGTGCCAGG + Intronic
1019133657 6:169895053-169895075 CTGATCATCTGCTATGTGCTGGG + Intergenic
1019244591 6:170699934-170699956 TTGAGTGTCTACCATGTGCCAGG + Intergenic
1019851401 7:3561585-3561607 CTGAGCATTTACCATGTGCCAGG - Intronic
1020098062 7:5379547-5379569 CTGGTGACCATCCATGTGCCAGG - Intronic
1020426359 7:8070596-8070618 CTGAATATCTGCCATGTGCCAGG + Intronic
1020818902 7:12940715-12940737 CTGAGCATCTACCTAGTGCCAGG - Intergenic
1021337166 7:19417926-19417948 CTGATTATATACCAGATGCCAGG + Intergenic
1021576856 7:22112903-22112925 CTGATCATCTACTGTATGCCAGG - Intergenic
1021618118 7:22523473-22523495 CTGAGCATCTACTATGTTCCAGG + Intronic
1021638744 7:22717646-22717668 CTGGGACTCTACCATGTGCCAGG + Intergenic
1021647189 7:22800003-22800025 TTGAACACCTACCATGTGCCAGG + Intergenic
1021914356 7:25416582-25416604 CTGAGCATCTACTCTGTGCCAGG - Intergenic
1022132610 7:27418117-27418139 CTGAGGATCTGCTATGCGCCAGG + Intergenic
1022243917 7:28539221-28539243 CTGAGTATTTACTATGTGCCAGG - Intronic
1022596946 7:31721855-31721877 CTGAATATCTACCCTGTACCAGG + Intergenic
1022966787 7:35481575-35481597 ATGAGTATCCACCATGTGCCAGG - Intergenic
1022972839 7:35532988-35533010 TTGATTACCTACTATGTGCCAGG + Intergenic
1023363712 7:39442161-39442183 TTGATCACCTACCATGTGTCTGG + Intronic
1023491786 7:40750884-40750906 CTGAGTATATACTATGTGCCAGG + Intronic
1023513568 7:40978419-40978441 CTGAACACCTACCAAGTGCCAGG + Intergenic
1023633135 7:42183371-42183393 CTGATGAACTTTCATGTGCCAGG + Intronic
1024834585 7:53501343-53501365 CTGATGATCCTCCATGTTGCTGG + Intergenic
1024842918 7:53608095-53608117 CTGAGGCCCTCCCATGTGCCTGG + Intergenic
1025109602 7:56203036-56203058 CTGAGCACCTACTATGTGCCAGG + Intergenic
1025244072 7:57302993-57303015 CTGAGCACCTACTATGTGCCAGG + Intergenic
1025249899 7:57344612-57344634 CTGGGGACCTACTATGTGCCAGG + Intergenic
1025254207 7:57372606-57372628 CTGAACACCTACTATGTGCCAGG + Intergenic
1025282503 7:57638490-57638512 ATTATCACCTACCATGTGCCAGG + Intergenic
1025302221 7:57826920-57826942 ATTATGAGCTACCATGTGCCAGG - Intergenic
1026308304 7:69161582-69161604 CTGAGCACCTACTATGTGCCAGG - Intergenic
1026443527 7:70464167-70464189 CTGAGCATCTACCATGTGTTAGG - Intronic
1026640980 7:72125361-72125383 CTGATTGTCTCCTATGTGCCAGG + Intronic
1026682359 7:72476744-72476766 CTGAACACCTACCACGTGCCAGG + Intergenic
1026762230 7:73135456-73135478 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1027038566 7:74944262-74944284 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1027084994 7:75257233-75257255 CTGAGCATCTACTGTGTGCCAGG - Intergenic
1027449241 7:78311000-78311022 ATGATGACTTACCATGTGACAGG + Intronic
1027647304 7:80818946-80818968 CTGATTACCTACTATTTGCCAGG + Intronic
1028527195 7:91799722-91799744 TTGATTACCTACCATGTGCCAGG + Intronic
1028895469 7:96036302-96036324 CTAAGAACCTACCATGTGCCAGG + Intronic
1029190194 7:98766472-98766494 CTGAGCACCTACTATGTGCCAGG - Intergenic
1029329244 7:99837794-99837816 CTGATGCTCCACCAAGGGCCTGG + Intronic
1029794884 7:102883248-102883270 TTGATTATCTAGTATGTGCCAGG - Intronic
1030088828 7:105839755-105839777 CTGAGCACCTACTATGTGCCAGG + Intronic
1030100733 7:105943057-105943079 TTGAGCACCTACCATGTGCCAGG + Intronic
1030130613 7:106196261-106196283 CTGAATATCTTCCATATGCCAGG - Intergenic
1030134977 7:106237977-106237999 CTGAGTGTCTACCATGGGCCAGG + Intergenic
1030322702 7:108186093-108186115 CTGATTGCCTACTATGTGCCAGG + Intronic
1030737428 7:113066433-113066455 CTGAGGACCTACCAGTTGCCAGG + Intergenic
1030745328 7:113159275-113159297 CTGAGCATCTACTATATGCCAGG + Intergenic
1031138125 7:117908544-117908566 GTGAGGACTTACCATGTGCCAGG + Intergenic
1031515684 7:122695585-122695607 CTGAGTGGCTACCATGTGCCAGG - Intronic
1031644337 7:124204804-124204826 TTGATTATCTACTATGTGCTTGG - Intergenic
1031845712 7:126803906-126803928 GTGACGATTTACTATGTGCCAGG - Intronic
1031877056 7:127153737-127153759 ATGAGCATCTACCTTGTGCCAGG - Intronic
1032238491 7:130143464-130143486 CTGAGCATCTACTATGTGCTAGG - Intergenic
1032299634 7:130674670-130674692 TTGAACATCTACTATGTGCCAGG - Intronic
1032578331 7:133079523-133079545 ATGAAAATCTACAATGTGCCAGG + Intronic
1032650786 7:133876015-133876037 TTGATCACCTACTATGTGCCAGG - Intronic
1033107279 7:138539082-138539104 CTGATTATCTATAGTGTGCCAGG + Intronic
1033307544 7:140236051-140236073 TTGGGCATCTACCATGTGCCTGG - Intergenic
1033774613 7:144593945-144593967 TTGATCATTTACCATGTGCTAGG + Intronic
1034064318 7:148121895-148121917 CTGAGTATCTACTATGTCCCAGG + Intronic
1034547360 7:151797667-151797689 CTTTTGATCTATAATGTGCCTGG - Intronic
1034867530 7:154655021-154655043 TTGAGCATCTACCATGTGTCAGG + Intronic
1035116319 7:156527319-156527341 CTGGGCATCTACTATGTGCCAGG + Intergenic
1035503535 8:108242-108264 TTGAGTGTCTACCATGTGCCAGG - Intergenic
1036062351 8:5337677-5337699 CAGATGAAGTACCATGTGCCTGG + Intergenic
1036771638 8:11582570-11582592 CTGAGCACCTACCGTGTGCCAGG - Intergenic
1036801724 8:11797486-11797508 CTGAACATCTACAATGTGGCAGG - Intronic
1037756670 8:21714645-21714667 CTGAGGACCTACTATGTGTCAGG + Intronic
1037763115 8:21755483-21755505 ATGAGGACCTACTATGTGCCAGG + Intronic
1037936837 8:22920571-22920593 CTGATGACTTACAACGTGCCAGG - Intronic
1038155414 8:24984826-24984848 CTCAGTACCTACCATGTGCCTGG + Intergenic
1038227722 8:25672299-25672321 CTGATTATTTACCGTGTGCCAGG + Intergenic
1038465684 8:27760571-27760593 CTGAATACCTACTATGTGCCAGG + Intronic
1038486226 8:27937132-27937154 CTGATCACCTACCAGGTGCAAGG - Intronic
1038529417 8:28305853-28305875 CTGATCTCCTACTATGTGCCAGG - Intergenic
1038560558 8:28575416-28575438 CTGATTATCTACTATGTGCCAGG + Intergenic
1039440150 8:37589396-37589418 CTGAGCATCTACTACGTGCCAGG - Intergenic
1039774773 8:40724524-40724546 TTGATCATCTACTATATGCCAGG + Intronic
1039906883 8:41792907-41792929 ATGAGCATCTACCATGTGGCAGG + Intronic
1040046888 8:42973900-42973922 CTGAATATCTACTATGTGCAGGG - Intronic
1040836144 8:51733091-51733113 CTGAGCACCTACCATGTGACAGG - Intronic
1041276074 8:56158707-56158729 TTGATTATCTACCCTGTGCTTGG + Intergenic
1041455799 8:58057828-58057850 CTGAGCAACTTCCATGTGCCTGG - Intronic
1041882170 8:62764216-62764238 CTGAACATATTCCATGTGCCTGG + Intronic
1042048059 8:64676590-64676612 TTGAGGGTCTACTATGTGCCAGG - Intronic
1042192801 8:66205038-66205060 CTGAGTGCCTACCATGTGCCAGG + Intergenic
1042466818 8:69137532-69137554 TTGATAATCTATTATGTGCCAGG + Intergenic
1042602884 8:70516169-70516191 CTGAGGACCTACTATGTGCCAGG + Intergenic
1042723368 8:71847373-71847395 CTGATCTTCTCCCATGTACCAGG - Intronic
1043112717 8:76208251-76208273 CTGAAAGTCTATCATGTGCCAGG - Intergenic
1043139731 8:76573253-76573275 CTGAGTGTCTACTATGTGCCGGG + Intergenic
1043512709 8:80965459-80965481 CTGAGTATTTACTATGTGCCAGG - Intergenic
1043667399 8:82833426-82833448 CTGAATACCTACTATGTGCCAGG - Intergenic
1043855125 8:85255991-85256013 TTGAGCACCTACCATGTGCCAGG - Intronic
1044555315 8:93556541-93556563 CTGCCGATCTACCATGATCCAGG + Intergenic
1044576253 8:93772911-93772933 TTGATGACCTACTGTGTGCCGGG + Intronic
1044868067 8:96591828-96591850 CTGAGCATCTACTATATGCCAGG + Intronic
1044875258 8:96659070-96659092 CTGAGCATTTACCATGTGGCAGG - Intronic
1044888299 8:96803877-96803899 CTGATCACCTACCAAGTGGCAGG - Intronic
1045623734 8:104016186-104016208 TTGAGGGTCTACAATGTGCCAGG - Intronic
1045721246 8:105113496-105113518 GAGTTGTTCTACCATGTGCCTGG + Intronic
1045920805 8:107526804-107526826 CTGAACACCTACTATGTGCCAGG + Intergenic
1046004480 8:108462626-108462648 CTGATAATATACCACGTGGCAGG - Intronic
1046089137 8:109478272-109478294 CTGAGTATCCACTATGTGCCAGG + Intronic
1046112745 8:109745887-109745909 CTGAGCACCTACTATGTGCCTGG - Intergenic
1046345164 8:112914417-112914439 GTGAGTATCTGCCATGTGCCAGG + Intronic
1047007359 8:120634308-120634330 CTGAGAATCTACTATGTGCCAGG + Intronic
1047031282 8:120883892-120883914 CTGAAGATCTACTATTTCCCAGG + Intergenic
1047060825 8:121223184-121223206 CTGAGCATCTCTCATGTGCCAGG - Intergenic
1047338345 8:123956926-123956948 CTGAGGATCTACCCAGTGCTGGG - Intronic
1047415597 8:124662360-124662382 TTGAACATCTACTATGTGCCGGG - Intronic
1047564059 8:126022154-126022176 CTGAGCATTTACCATATGCCAGG + Intergenic
1047686195 8:127306866-127306888 CTGATTATCTAACTTGTGGCAGG + Intergenic
1047990932 8:130286015-130286037 CTGAAAACCTACTATGTGCCAGG + Intronic
1048003151 8:130396111-130396133 CTGACGACCTACTAAGTGCCAGG - Intronic
1048166230 8:132063876-132063898 CTGATGATCTAGCTGGAGCCTGG + Intronic
1048330274 8:133466324-133466346 CTGAGCACCTACCATGTGCCAGG + Intronic
1048349358 8:133603697-133603719 TGGATCATCTACCAGGTGCCAGG - Intergenic
1048378340 8:133842712-133842734 CTGATCAGCTACCACATGCCAGG + Intergenic
1048602376 8:135931675-135931697 CTGAGCATCTACTATGTGCCAGG - Intergenic
1048857183 8:138695239-138695261 CTGATGATCTACCATGTGCCAGG - Intronic
1049062307 8:140285951-140285973 CTGAAGACCTACTGTGTGCCAGG + Intronic
1049095027 8:140543676-140543698 CTGAGCATCTACTATGTGCCAGG + Intronic
1050461584 9:5881869-5881891 CTGAGGCTCTACCATGTGGCAGG + Intronic
1050563247 9:6856096-6856118 CTGAGTACCTACCAAGTGCCAGG - Intronic
1051261665 9:15270922-15270944 CTGAGTACCTATCATGTGCCAGG + Intronic
1051767659 9:20542211-20542233 CTGCTCATTGACCATGTGCCTGG - Intronic
1051956789 9:22704919-22704941 CTGAAGACCTACAATGTGCCAGG - Intergenic
1053047574 9:34932529-34932551 CTGAGGATCTATTTTGTGCCAGG - Intergenic
1053201966 9:36158520-36158542 TTGAGCATCTACTATGTGCCAGG + Intronic
1053414204 9:37936512-37936534 CTGAGTACCTATCATGTGCCAGG + Intronic
1054855466 9:69894496-69894518 CTTATTGTCTACCATGTTCCAGG + Intronic
1055472113 9:76622174-76622196 CTGAGCATCTACTATGTACCAGG + Intronic
1055660726 9:78501497-78501519 CTGAGTATGTACCATGTGCTAGG + Intergenic
1056156330 9:83842005-83842027 TTGATTGTCTGCCATGTGCCAGG - Intronic
1056354199 9:85781576-85781598 TTGATTGTCTGCCATGTGCCAGG + Intergenic
1056536145 9:87529515-87529537 CTGAGCATCTACTATGTGTCAGG - Intronic
1057282761 9:93724811-93724833 CTCATGCTCTTCCCTGTGCCTGG - Intergenic
1057310248 9:93938494-93938516 CTCATGCTCTTCCATCTGCCTGG - Intergenic
1057871542 9:98721884-98721906 CTGAGGACCTACTATGTGCCAGG - Intergenic
1057893606 9:98888585-98888607 CTAAACATCTACAATGTGCCTGG - Intergenic
1057925636 9:99145546-99145568 CTGAGGATCTACCATGTATTAGG - Intronic
1057929212 9:99179122-99179144 CTGAGCATCTAACATATGCCAGG + Intergenic
1057981146 9:99665094-99665116 TTGAGTATCTACCATGTGCCAGG + Intergenic
1058088262 9:100774633-100774655 TTAAGCATCTACCATGTGCCAGG + Intergenic
1058340225 9:103886383-103886405 CTGAAGCTATACCATGTTCCAGG + Intergenic
1058422662 9:104847428-104847450 GTGAGGAATTACCATGTGCCAGG - Intronic
1058751351 9:108041303-108041325 CTGAACACCTCCCATGTGCCTGG - Intergenic
1058872330 9:109213339-109213361 CTGAACATCTACAATGTGCCAGG + Intronic
1058918663 9:109592477-109592499 CTGATAAGCTACTATGTTCCAGG + Intergenic
1059239890 9:112795489-112795511 CTGAGTACCTACCATGGGCCAGG + Intronic
1059586542 9:115613742-115613764 CTAAAGATCTACAATGTTCCTGG - Intergenic
1059678037 9:116558885-116558907 TTAAGTATCTACCATGTGCCAGG - Intronic
1059926998 9:119219554-119219576 CTGAAGCCCTACTATGTGCCAGG + Intronic
1060120864 9:120988198-120988220 CTGAGCATCTACTATGTGCCAGG + Intronic
1060259227 9:122059304-122059326 CTGAGCATTTACTATGTGCCAGG + Intronic
1060385118 9:123218770-123218792 ATTATGATTAACCATGTGCCAGG + Intronic
1060458465 9:123824130-123824152 CTGAACATCTACAATGTGCTAGG + Intronic
1060476064 9:123987685-123987707 CTGAGCATCTGCTATGTGCCAGG - Intergenic
1060516566 9:124269743-124269765 CTGAGCACCTACTATGTGCCAGG - Intronic
1060518992 9:124283230-124283252 CTGAGCACCTACTATGTGCCAGG - Intronic
1060725394 9:126002718-126002740 CTGAGCACCTACTATGTGCCAGG - Intergenic
1060739429 9:126088550-126088572 CTGAGCATCTACCCTGTGGCAGG - Intergenic
1060890600 9:127185592-127185614 CTGAGCATCTACAAGGTGCCAGG - Intronic
1060897472 9:127226484-127226506 CAGATGATGTCCCATGGGCCAGG - Intronic
1061081557 9:128373823-128373845 TTGAGTGTCTACCATGTGCCAGG + Intronic
1061344564 9:130012343-130012365 CTGAGGGCTTACCATGTGCCAGG - Intronic
1061484626 9:130914099-130914121 CTGAACACCTACTATGTGCCAGG - Intronic
1061709932 9:132480497-132480519 CTGAAGACCTACTGTGTGCCGGG + Intronic
1061789978 9:133054203-133054225 CTGATGCTCTCACAAGTGCCTGG - Intronic
1062197736 9:135283643-135283665 CTGATAACCTACAAAGTGCCAGG - Intergenic
1062629630 9:137458073-137458095 CTGAAGCTCTAGCATGTGCGTGG + Intronic
1203604781 Un_KI270748v1:49164-49186 TTGAGTGTCTACCATGTGCCAGG + Intergenic
1203633530 Un_KI270750v1:91764-91786 ATTATCACCTACCATGTGCCAGG + Intergenic
1186738444 X:12491740-12491762 TTGAACATCTATCATGTGCCTGG + Intronic
1187212368 X:17244149-17244171 CTAAGCATCTACTATGTGCCAGG - Intergenic
1187274310 X:17804995-17805017 TTGAGCATCTACCATTTGCCAGG + Intronic
1187276775 X:17823250-17823272 CTGAGTATTTACCATGTGCCAGG - Intronic
1187369425 X:18692408-18692430 CTGGGTGTCTACCATGTGCCAGG - Intronic
1187408707 X:19027708-19027730 CTGAGCACCTACTATGTGCCAGG - Intronic
1187471786 X:19576398-19576420 CTGAATGCCTACCATGTGCCAGG + Intronic
1187564850 X:20438970-20438992 CTGATTACCTGCCATGAGCCAGG + Intergenic
1187765600 X:22638295-22638317 ATGATCACGTACCATGTGCCAGG - Intergenic
1187963603 X:24589036-24589058 TTGAGTATTTACCATGTGCCCGG - Intronic
1189606124 X:42679967-42679989 CTGATGGTCTACCTTGGTCCAGG - Intergenic
1189941926 X:46133301-46133323 CTGATGATTTACCATATCCCCGG - Intergenic
1190476686 X:50835051-50835073 CTGAGAACCTACTATGTGCCAGG - Intergenic
1190741762 X:53293365-53293387 CTGAGCATGTACCATGTGCCAGG - Intronic
1190935036 X:54992186-54992208 CTGAGCATCTACTATGAGCCAGG + Intronic
1192046758 X:67683686-67683708 CTGATAATCTATTATGTGCAAGG - Intronic
1192111102 X:68365731-68365753 GTGGAAATCTACCATGTGCCAGG + Intronic
1192345206 X:70297613-70297635 CTGAGAACCTACCATGTGCCAGG + Intronic
1192615611 X:72618449-72618471 TTGATCACCCACCATGTGCCAGG + Intronic
1193206883 X:78759754-78759776 CAGATGATTTACCATTTACCAGG - Intergenic
1193771197 X:85589482-85589504 TTGAACATCTACCATGTGCCAGG - Intergenic
1194980624 X:100436617-100436639 CTGAGGATCTACTATATACCAGG + Intergenic
1195422261 X:104688518-104688540 CTTATCCCCTACCATGTGCCAGG - Intronic
1195460106 X:105114951-105114973 CTGAACTTCTATCATGTGCCAGG - Intronic
1195994872 X:110721783-110721805 CTGAGCACCTACTATGTGCCAGG + Intronic
1196397619 X:115282392-115282414 CTGAGGACCTACTATGTGCTAGG + Intergenic
1196670712 X:118364579-118364601 TTGGTTATCTACCATGTGCCAGG - Intronic
1196792878 X:119480220-119480242 TTGAACATCTACTATGTGCCAGG - Intergenic
1196910888 X:120483244-120483266 CTGAGTATCTACTATGTACCAGG - Intergenic
1196926944 X:120642734-120642756 TTGAGCATCTACCATGTGCTAGG - Intergenic
1197150292 X:123213319-123213341 GTGAGCATCTACCATGTGCCAGG + Intronic
1197295501 X:124714056-124714078 CTGAACATCTATTATGTGCCAGG + Intronic
1198089551 X:133314061-133314083 CTGAGCACCTACTATGTGCCAGG + Intronic
1198223737 X:134626371-134626393 CTGAGCATCTACTATGTGCCAGG - Intronic
1198408614 X:136342341-136342363 CTAAACATCTACCATGTGCCAGG + Intronic
1198438197 X:136637147-136637169 CTGATCACCTACTATATGCCAGG + Intergenic
1198695403 X:139331777-139331799 TTGATTATCTATGATGTGCCAGG - Intergenic
1198812418 X:140549165-140549187 CTGAGTGCCTACCATGTGCCAGG - Intergenic
1198848725 X:140942127-140942149 TTGATAATCTACTATGTGTCAGG - Intergenic
1198977818 X:142356931-142356953 CTGAGAATCTACTCTGTGCCAGG + Intergenic
1199016958 X:142828950-142828972 CTGAGTAACTAACATGTGCCAGG + Intergenic
1199431517 X:147766153-147766175 CTGAATATCTACTATGTGCCTGG + Intergenic
1199677855 X:150202853-150202875 CTGCTCATCTATTATGTGCCAGG - Intergenic
1199858964 X:151782450-151782472 CTGAGGACCTCCAATGTGCCAGG - Intergenic
1201189096 Y:11430919-11430941 CTGATCATCTACCGTGTGCCAGG - Intergenic
1202386970 Y:24335560-24335582 TTGAGTGTCTACCATGTGCCAGG + Intergenic
1202483816 Y:25334568-25334590 TTGAGTGTCTACCATGTGCCAGG - Intergenic