ID: 1048857446

View in Genome Browser
Species Human (GRCh38)
Location 8:138696877-138696899
Sequence TCCTCCTAGAAAACTACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048857443_1048857446 19 Left 1048857443 8:138696835-138696857 CCATTCACCACAGACAATAATAC 0: 1
1: 0
2: 3
3: 15
4: 267
Right 1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG No data
1048857441_1048857446 21 Left 1048857441 8:138696833-138696855 CCCCATTCACCACAGACAATAAT 0: 1
1: 0
2: 2
3: 10
4: 205
Right 1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG No data
1048857442_1048857446 20 Left 1048857442 8:138696834-138696856 CCCATTCACCACAGACAATAATA 0: 1
1: 0
2: 3
3: 18
4: 206
Right 1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG No data
1048857445_1048857446 -3 Left 1048857445 8:138696857-138696879 CCATTATTTCTAGCATGTTTTCC 0: 1
1: 0
2: 3
3: 46
4: 438
Right 1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG No data
1048857444_1048857446 12 Left 1048857444 8:138696842-138696864 CCACAGACAATAATACCATTATT 0: 1
1: 0
2: 3
3: 30
4: 281
Right 1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048857446 Original CRISPR TCCTCCTAGAAAACTACCCA TGG Intronic
No off target data available for this crispr