ID: 1048861410

View in Genome Browser
Species Human (GRCh38)
Location 8:138726938-138726960
Sequence TGGGGTGACCAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048861402_1048861410 -2 Left 1048861402 8:138726917-138726939 CCAGGAAAGCAGCCTGCAGTCTG 0: 1
1: 1
2: 2
3: 34
4: 447
Right 1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048861410 Original CRISPR TGGGGTGACCAGAGGGAGGA AGG Intronic
No off target data available for this crispr