ID: 1048863977

View in Genome Browser
Species Human (GRCh38)
Location 8:138745815-138745837
Sequence CTGAATCCTGAATGTTTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048863977 Original CRISPR CTGAATCCTGAATGTTTTGG CGG (reversed) Intronic
901106743 1:6762255-6762277 CTGATTTCTCAATGTTCTGGAGG + Intergenic
903496775 1:23773931-23773953 CTGAATCCTGATTCTTTTTATGG - Intergenic
906051971 1:42881716-42881738 CTGTATCTTGATTGTTGTGGTGG + Intergenic
906798949 1:48719454-48719476 CAGAATGGTGAATGGTTTGGAGG - Intronic
906959682 1:50411414-50411436 CTGAATCCTGATTGTGATGGTGG + Intergenic
907695555 1:56724225-56724247 CAGTTTGCTGAATGTTTTGGAGG + Intronic
908133724 1:61104588-61104610 ATGAATGCTGTATGTGTTGGGGG - Intronic
908379239 1:63579140-63579162 CTGTATCCTGATTGTGGTGGTGG - Intronic
908912414 1:69087633-69087655 AAGTCTCCTGAATGTTTTGGGGG + Intergenic
909940092 1:81601658-81601680 ATGAATCTGGAATATTTTGGGGG - Intronic
910136269 1:83973990-83974012 CTGGATCCTGAAGATTTTTGCGG + Intronic
910894073 1:92049284-92049306 CTGAATCCTGAATGGTTACAGGG - Intronic
911184588 1:94890532-94890554 ATGAATCCTGAATTTGTTGAAGG + Intronic
911281120 1:95930375-95930397 CTGAATCTTGAATGATTTGTAGG + Intergenic
911968394 1:104397641-104397663 GTGAATCATGAATGTTTTAATGG + Intergenic
911975210 1:104485580-104485602 CTTATTTCTGAATGTATTGGAGG - Intergenic
912902292 1:113664664-113664686 CAGAATCCTCAATGTTTTGCTGG - Intronic
913419741 1:118652722-118652744 CTGAGTCCTGAAGTTTTTGAGGG + Intergenic
917527485 1:175801957-175801979 CTTAAACCTGTATTTTTTGGAGG + Intergenic
919370473 1:196718479-196718501 CTGAATCCTGGATTTAGTGGAGG + Intronic
919390535 1:196978894-196978916 CTGAAGCTTGAAAGTTTTGTGGG - Intronic
924302064 1:242649885-242649907 CTGTATCCTGAATCTTTTCCTGG - Intergenic
1064003882 10:11684997-11685019 CTGAATCCTGAATGACTTGGCGG - Intergenic
1065334213 10:24639051-24639073 CTAAATACTGAATGTTCAGGTGG + Intronic
1068037541 10:51779757-51779779 CTGCATTCTGAATGTTTTTAAGG + Intronic
1070499825 10:77062055-77062077 CTGTATCCTGATTGTGGTGGTGG + Intronic
1070945845 10:80391039-80391061 CTGCATCGAGAGTGTTTTGGAGG + Intergenic
1071389605 10:85158726-85158748 CTGAATCCTGAATTATTTCCTGG + Intergenic
1075192544 10:120323842-120323864 CTGCATTCTTACTGTTTTGGTGG + Intergenic
1077163311 11:1123437-1123459 CTGTGGCCTGAATGTTATGGAGG - Intergenic
1078659542 11:13276387-13276409 CTGAATGCTGACTGTTTTCGAGG - Intergenic
1078834377 11:15013039-15013061 CTAAATCCTGAATTCTTTGTGGG - Intronic
1079127567 11:17729960-17729982 CTGAAGCCTGGAAGTTTTGGGGG - Intergenic
1082819242 11:57532923-57532945 CTGTATCCTGATTGTGGTGGTGG + Intergenic
1084122456 11:67077593-67077615 CTGGACCCTGAAGGATTTGGGGG - Intergenic
1084350995 11:68599244-68599266 CTGAATCCTCAATTCTTTGCTGG - Intronic
1088526577 11:110762547-110762569 ATGAATTCTGATTGCTTTGGAGG - Intergenic
1089964055 11:122640932-122640954 CTGAATTTTGTATATTTTGGGGG + Intergenic
1090231913 11:125113396-125113418 CTGAGACCTTAATATTTTGGAGG + Intergenic
1090449929 11:126797372-126797394 CTGGATGCTGATAGTTTTGGTGG + Intronic
1090563425 11:127959160-127959182 CTAAACCCTGAATGCTTTGTTGG - Intergenic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1091918354 12:4285156-4285178 CTGAATATTGTACGTTTTGGGGG + Intronic
1092237730 12:6820532-6820554 CTGTGTCCTGAATGGTCTGGAGG - Exonic
1092499660 12:9032936-9032958 CTGAAGGCTCAAAGTTTTGGGGG - Intergenic
1094430405 12:30362136-30362158 CTGAATCCTGAATTCTTTCCTGG - Intergenic
1094443937 12:30509417-30509439 CTGTATCCTGATTGTTGTGGTGG - Intergenic
1095326309 12:40897715-40897737 CTGAAACCTCAATGGTTTGGGGG + Intronic
1095411068 12:41923971-41923993 CTGCAACATGAATTTTTTGGGGG - Intergenic
1095484093 12:42666207-42666229 CTGTATCCTGAATGTGGTGGTGG - Intergenic
1095860731 12:46915158-46915180 CTGAATCCTTAATTATTTGTGGG - Intergenic
1098232583 12:68387636-68387658 CTGAAACCTGAATGATGAGGAGG - Intergenic
1098954947 12:76680166-76680188 CTGAAACCTGAATGAAGTGGAGG + Intergenic
1099378637 12:81926263-81926285 CAGAAGCCTGATTGATTTGGTGG + Intergenic
1099396343 12:82145693-82145715 CTGAATCTTAAATAGTTTGGGGG + Intergenic
1101572756 12:105970112-105970134 CTGTATCCTAAATGTGATGGTGG + Intergenic
1101917440 12:108906893-108906915 CTGACTCCTCAAGGATTTGGGGG - Intergenic
1106134080 13:26961413-26961435 CAGAATCCTGAAAGCTGTGGTGG + Intergenic
1107519238 13:41162828-41162850 CTGAATCCTGAATTATTTCCTGG + Intergenic
1108166287 13:47696668-47696690 CTGAATCCTGAATGACTGTGTGG - Intergenic
1108671047 13:52689101-52689123 CTGAATTCCTACTGTTTTGGAGG - Intronic
1109007497 13:56897793-56897815 CTGAATTCTGAATGCTTTACAGG - Intergenic
1110298495 13:73898131-73898153 CTGAATACTTCAGGTTTTGGAGG - Intronic
1111490612 13:88969277-88969299 CTGCATCCAGTAAGTTTTGGTGG - Intergenic
1112574147 13:100620471-100620493 GGGAATCCTATATGTTTTGGGGG - Intronic
1114362850 14:21994516-21994538 CTGAATCTTGATTATGTTGGTGG + Intergenic
1115895636 14:38084007-38084029 CTGGATCCTGCATGTTTTTTTGG - Intergenic
1117527757 14:56627838-56627860 CTGTGTCCTGACTGTTGTGGTGG - Intronic
1118072270 14:62258118-62258140 CTGGGTCATGAATGTTGTGGTGG + Intergenic
1119742813 14:77025677-77025699 GGGAATCCGGAATGTTTTGGGGG + Exonic
1120090834 14:80331740-80331762 CTGAGTCATGAAGGCTTTGGTGG - Intronic
1120496138 14:85238546-85238568 CTGAATTCTAAATATTTTAGAGG - Intergenic
1121357261 14:93226025-93226047 CTGCATCCTGAATCTGTTAGGGG + Intronic
1121756957 14:96411088-96411110 CTGTATCCTAATTGTTGTGGTGG - Intronic
1122180940 14:99954108-99954130 CTGAGTTCTGAAAGTTATGGTGG - Intergenic
1202842272 14_GL000009v2_random:132801-132823 CTGAATCCTGAATTATTTCCTGG - Intergenic
1202911659 14_GL000194v1_random:123036-123058 CTGAATCCTGAATTATTTCCTGG - Intergenic
1202880959 14_KI270722v1_random:59594-59616 CTGAATCCTGAATTATTTCCTGG + Intergenic
1123770913 15:23527598-23527620 CTGAATCCTGAATTCTTTCTGGG - Intergenic
1124587327 15:31021765-31021787 CTTAATCCAGAAAGTTTTGGGGG + Intronic
1125075826 15:35617037-35617059 CTGTATCTTGACTGTTGTGGTGG + Intergenic
1126760174 15:51962849-51962871 CTGCATCCTGAGTGTGGTGGTGG + Intronic
1128192260 15:65713827-65713849 CTGAGTCCTGATTCTTTTAGTGG + Intronic
1131833061 15:96366437-96366459 CTGGACCCTGACTTTTTTGGAGG - Intergenic
1133177759 16:4028112-4028134 CTGTATCCTGATTGTACTGGTGG + Intronic
1134010311 16:10847145-10847167 CTGAATGCAGAATCTTTTGGTGG + Intergenic
1134534350 16:15013487-15013509 CTGAATCTTGATTGTGTTGATGG + Intronic
1134846212 16:17442763-17442785 CTGCATCCTCATTCTTTTGGAGG + Intronic
1135140108 16:19913898-19913920 CTGAAGACTGAATGTTTCCGTGG + Intergenic
1135251947 16:20907762-20907784 CTGAGTCCTGAATGGTGTGATGG - Intronic
1137015332 16:35368578-35368600 CTGAAACCTGCATGCTTGGGTGG + Intergenic
1137798792 16:51243709-51243731 CTGTATCCTGATTGTGATGGTGG + Intergenic
1137937801 16:52651292-52651314 GTGCATCCTGGCTGTTTTGGAGG - Intergenic
1139287151 16:65825919-65825941 CTTCATCTTGAATGTGTTGGGGG - Intergenic
1139861694 16:70027262-70027284 CTGAATCTTGATTGTGTTGATGG - Intergenic
1145284272 17:21493277-21493299 CTGAATCCTGAATTCTTTTCTGG + Intergenic
1148577329 17:48721084-48721106 GTGAGTCCTGAGTGTTTTTGTGG + Intergenic
1148995599 17:51706698-51706720 TGGAATCCTGAAGGTTTTGGGGG - Intronic
1149706138 17:58696715-58696737 CAGATACCAGAATGTTTTGGAGG + Exonic
1151538336 17:74750930-74750952 CAGATTCCTGCATGTTTTGGAGG + Intronic
1153456787 18:5291614-5291636 CTGAACCCTGAGCGTTGTGGTGG + Exonic
1154108019 18:11541044-11541066 CTAAATCCTGAATTTTTTGTGGG + Intergenic
1155346137 18:24859315-24859337 CTGAAGACTGTATGTTTTGTGGG + Intergenic
1156271354 18:35535902-35535924 TTGCATCCTGATTGTTTTTGTGG + Intergenic
1156442147 18:37201376-37201398 CTGAATCCTGAATTATTTCCTGG - Intronic
1157937917 18:51893560-51893582 CTGAATCCTAAAGGTTGTAGAGG + Intergenic
1158615070 18:58979684-58979706 CTGATCCCTGAGTGTCTTGGGGG + Intronic
1158674648 18:59507206-59507228 CTGAATCCTGGATGGTTTAGGGG - Intronic
1161051824 19:2168082-2168104 CTGAATACTCAGTGTTGTGGGGG + Intronic
1161385543 19:3990302-3990324 CTGAAACGTGAATGTGATGGTGG - Intergenic
1162391043 19:10390384-10390406 CAGAATCAAGAATGTTTGGGGGG + Intergenic
1163607879 19:18285467-18285489 CTTAATCCTGAAAGTCTTGTAGG + Intergenic
1166273775 19:41736463-41736485 CTGAATCCTGAATTCTTTCCTGG - Intronic
1166429015 19:42707765-42707787 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166442666 19:42829130-42829152 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166450463 19:42895584-42895606 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166462356 19:42999900-42999922 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166479633 19:43159846-43159868 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166758881 19:45212340-45212362 CTGAGTCCTGAGTGTGTTGTGGG - Intronic
1167746959 19:51357422-51357444 TTGAAACCTGGCTGTTTTGGAGG + Intronic
1168496582 19:56856584-56856606 CTTAATCCTAAATGTAATGGAGG + Intergenic
1202656564 1_KI270708v1_random:28699-28721 CTGAATCCTGAATTATTTCCTGG + Intergenic
1202659492 1_KI270708v1_random:54899-54921 CTGAATCCTGAATCAGTTTGTGG + Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926501415 2:13657964-13657986 CTGTATCCTGATTGTAATGGTGG - Intergenic
926836417 2:17028458-17028480 CTGAATTCTGGATGATTTTGAGG - Intergenic
927394149 2:22630307-22630329 TAGAATGCTGAATGCTTTGGGGG + Intergenic
928271346 2:29858131-29858153 CTGAATCCTGACTGTGGTGATGG - Intronic
928551169 2:32372224-32372246 CTGTATCCTGACTGTGATGGTGG - Intronic
928631147 2:33193466-33193488 ATGAATGCTGAAAGTTTTAGGGG + Intronic
929859573 2:45665267-45665289 GTGAATTCTGAATGTTTTAAAGG - Intronic
930110046 2:47671056-47671078 CTGAACCCTGAATATTTTCCTGG - Intergenic
930389767 2:50746182-50746204 CTTAATCCTTAATGTTCTTGAGG - Intronic
931059595 2:58511782-58511804 CTGACTCCAGCATGTTTCGGGGG + Intergenic
931161076 2:59691329-59691351 CTGTCACCTTAATGTTTTGGAGG + Intergenic
931374182 2:61693421-61693443 CTGCATTCTGTATGATTTGGGGG + Intergenic
931659991 2:64551057-64551079 CTGAATCCTTAATGAATTGAAGG + Intronic
934236587 2:90238221-90238243 CTCACTCCTGAGGGTTTTGGGGG - Intergenic
934286955 2:91658222-91658244 CTGTATCATGAATGCTGTGGTGG - Intergenic
934987324 2:98897039-98897061 CTGCATCCTGACTGTGCTGGTGG - Intronic
937756739 2:125548380-125548402 CTGTCTCCTGAATAATTTGGGGG + Intergenic
940027608 2:149225106-149225128 CTTTATCCTGAATTTTTTGATGG + Intergenic
940415630 2:153416869-153416891 CTGAATCCTGAATCAGTTGTGGG + Intergenic
941148654 2:161886416-161886438 CTGAATCTTGAGAGTTTTGAAGG + Intronic
941221042 2:162781753-162781775 CTCAATCCTTAATGTTTCAGGGG + Intronic
943349389 2:186779474-186779496 CTGAATGGTGTGTGTTTTGGGGG - Intergenic
948917843 2:241046707-241046729 CTGTATCCTGACTGTGGTGGGGG + Intronic
1169295409 20:4393145-4393167 CTGAATCTTGAATGTAGTGGTGG + Intergenic
1169652116 20:7880948-7880970 CTGAAACCTGAGTGTATCGGTGG - Intergenic
1169772104 20:9212382-9212404 CTGAATATTGAATATCTTGGGGG + Intronic
1176631020 21:9137703-9137725 CTGAATCCTGAATTATTTCCTGG - Intergenic
1176642270 21:9317117-9317139 CTGAATCCTGAATTATTTCCTGG + Intergenic
1177522357 21:22242768-22242790 CTGAATTTTGAATGTTTTACTGG + Intergenic
1178784401 21:35639346-35639368 CTGTATCCTGATTGTGGTGGTGG - Intronic
1180326961 22:11438460-11438482 CTGAATCCTGAATCAGTTTGTGG + Intergenic
1180351280 22:11806469-11806491 CTGAATCCTGAATTATTTCCTGG + Intergenic
1180375571 22:12089898-12089920 CTGAATCCTGAATTATTTCCTGG + Intergenic
1180386921 22:12185606-12185628 CTGAATCCTGAATTATTTCCTGG - Intergenic
1182266957 22:29124459-29124481 CTGAATCCTGATTGTACTGGTGG + Intronic
1182780583 22:32864302-32864324 CTGAAGCCAGAAAGTGTTGGGGG - Intronic
1183965582 22:41440009-41440031 CTGAGTCCTGAGTGTTCTTGTGG - Intronic
1185181149 22:49364133-49364155 CCAAAGCCTGAAGGTTTTGGGGG + Intergenic
950833016 3:15893831-15893853 CTGCAGCCTGAATGTTGGGGAGG - Intergenic
952561691 3:34602979-34603001 CTGTATCCTGATTGTTATGGTGG + Intergenic
955044321 3:55345574-55345596 CTGTATCCTGATTGTGGTGGTGG + Intergenic
955880044 3:63533620-63533642 TTGTTTCCTGTATGTTTTGGAGG - Intronic
957097846 3:75793531-75793553 CTGAATCCTGAATTATTTCCTGG - Intergenic
957380587 3:79423712-79423734 CTGAATACTGAATCTTTTGGTGG - Intronic
958107161 3:89090923-89090945 CTGCATCCTGATTGTAGTGGGGG + Intergenic
958968909 3:100589572-100589594 CTTATTCCTGTATGTTTTAGAGG - Intergenic
959432756 3:106275218-106275240 CTGAATTCTGAATAGTTTTGGGG - Intergenic
959561110 3:107782600-107782622 CTGAAAAATGAATGTTTTGGGGG - Intronic
959864921 3:111255143-111255165 CTTTATTCTGAATTTTTTGGTGG + Intronic
961230498 3:125303281-125303303 CTGAATCTTGATTGCTTTGGTGG + Intronic
961232639 3:125331266-125331288 TTTAATCCTGATTCTTTTGGGGG - Intronic
962314871 3:134353094-134353116 CTGAAGCCTGTATAATTTGGAGG - Intergenic
963720780 3:148859661-148859683 CTGGATCATAAATGTTATGGGGG - Intronic
965043844 3:163549554-163549576 CTGTGTCCTGATTGTTATGGTGG + Intergenic
965063823 3:163817677-163817699 CTGTATCCTGACTGTGGTGGTGG - Intergenic
965666622 3:171100964-171100986 CTGAGTCCTGATTCTTTTGCTGG + Intronic
966587338 3:181641805-181641827 CTGAATGCTGAATGGCATGGGGG + Intergenic
966677862 3:182608834-182608856 CTGAATTCTGTATTTATTGGGGG + Intergenic
967596857 3:191335872-191335894 CTGTATCTTGATTGTTGTGGTGG - Intronic
1202744619 3_GL000221v1_random:87901-87923 CTGAATCCTGAATTATTTCCTGG - Intergenic
971505205 4:27358972-27358994 CCGAGTCCTGAATGCCTTGGCGG - Intergenic
973229347 4:47824022-47824044 CTGAGTCCTGAATGGTTCAGTGG - Intronic
973758787 4:54099314-54099336 CTCCATCCTGAAGATTTTGGAGG - Intronic
974380740 4:61136745-61136767 CTGAAGCCTGATTGGTGTGGTGG - Intergenic
974981457 4:68962488-68962510 CTTAATCCTGAATTTTTTCTTGG + Intergenic
978746288 4:112197818-112197840 CTTAGTCCAGAATATTTTGGGGG + Intergenic
979864961 4:125742741-125742763 CTAAATTCAGAGTGTTTTGGGGG + Intergenic
981252522 4:142620903-142620925 CTGTATTCTGATTGTGTTGGTGG + Intronic
982918734 4:161248536-161248558 CTAAATCCAGAATTTTTGGGGGG - Intergenic
983411704 4:167407436-167407458 CAGAATCCTGAATCTTGAGGTGG + Intergenic
983627569 4:169817206-169817228 CTGTATCCTGTTTATTTTGGTGG + Intergenic
1202757170 4_GL000008v2_random:75340-75362 CTGAATCCTGAATTATTTCCTGG + Intergenic
986226472 5:5819693-5819715 CTGAATGCAGAATGTGTTGTGGG - Intergenic
986351525 5:6884789-6884811 CAGAATCCTGACTGTCTTTGGGG - Intergenic
986822433 5:11482366-11482388 CTGAATCCTGAATATTTCTGGGG - Intronic
988498442 5:31764346-31764368 CTGATTCCTGAAGGTTTGAGAGG - Intronic
988938437 5:36115681-36115703 CTGAATCCTGATTGTGTTGGTGG + Intronic
990431064 5:55736336-55736358 ATGAATCCTGAAATTCTTGGTGG + Intronic
990842705 5:60101694-60101716 CTGAATTCTGAATCATTTAGTGG + Intronic
990863040 5:60349749-60349771 CTAAATCCTAAATCTTTTTGAGG + Intronic
992333382 5:75740671-75740693 TAGAATCCTGAATTTGTTGGGGG + Intergenic
992483415 5:77173216-77173238 CTGACTGCTGAATATTTTGGAGG + Intergenic
992670225 5:79052700-79052722 GTCAATCCTGAATGCTTTGCTGG - Intronic
995083186 5:108077759-108077781 CTGAATCCTGAATTGTTTCCTGG + Intronic
995286098 5:110389953-110389975 CAGAATTGTCAATGTTTTGGGGG - Intronic
1000497484 5:162002866-162002888 GTGAATTCTGAATGTTTTCCTGG - Intergenic
1001983076 5:176049607-176049629 CTGAAGTGTGAATGCTTTGGAGG + Intergenic
1002234388 5:177794445-177794467 CTGAAATGTGAATGCTTTGGAGG - Intergenic
1003384076 6:5651262-5651284 CTAACTCCTGAATCTTTTGGGGG - Intronic
1005706000 6:28453983-28454005 CTGAATCCTGTATAATCTGGGGG - Intergenic
1013659930 6:112284837-112284859 CTGTATCCTGATTGTGATGGTGG + Intergenic
1014017384 6:116548672-116548694 CTGACTTCTGAATGGTTTGTCGG - Intronic
1014080986 6:117285820-117285842 CTGAAACATGAAAGTTTTGTAGG + Intergenic
1014092170 6:117416452-117416474 CAAAATCCTGGATCTTTTGGAGG - Intronic
1014376914 6:120687509-120687531 TAGGTTCCTGAATGTTTTGGAGG + Intergenic
1016944550 6:149517223-149517245 CTGAATCCAGATTGTTTGTGAGG - Intronic
1017264014 6:152421598-152421620 CTGAATCCTGAATTGTTTCCTGG + Intronic
1018877727 6:167840173-167840195 CTGAATCCTGAAAAATTTGTAGG + Intronic
1021218510 7:17946685-17946707 GTGAATCATAAATGTTGTGGTGG + Intergenic
1021445948 7:20733802-20733824 CTAATTTCTGCATGTTTTGGTGG + Intronic
1022298952 7:29084369-29084391 CAGAACCCTGAATGATGTGGTGG - Intronic
1022358987 7:29641597-29641619 CTGTATGCTGTATGTTCTGGTGG + Intergenic
1024427769 7:49247393-49247415 CTGACTACTGAATGTTTTGATGG + Intergenic
1026462631 7:70628584-70628606 CTGATTACTGGATTTTTTGGGGG - Intronic
1028106581 7:86886131-86886153 CAGGTCCCTGAATGTTTTGGGGG - Intronic
1028569496 7:92270599-92270621 CTGAATCCTGATTATGATGGTGG - Intronic
1028583152 7:92427253-92427275 CTGAATCTTGATTGTGATGGAGG - Intergenic
1028819426 7:95189399-95189421 CATAATCCTAAATTTTTTGGAGG + Intronic
1031573825 7:123391810-123391832 CTGAAACCTTAGTGGTTTGGTGG - Intergenic
1031937527 7:127750987-127751009 CTGTATCTTGTCTGTTTTGGTGG + Intronic
1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG + Intergenic
1033017943 7:137691099-137691121 CTGAGTCCTGAATCAGTTGGAGG + Intronic
1034165546 7:149022528-149022550 CTGAAGCCAGAATGTTTCCGGGG + Intronic
1034297558 7:149987731-149987753 ATGCATCCTGAATGATTTCGAGG - Intergenic
1034808466 7:154109122-154109144 ATGCATCCTGAATGATTTCGAGG + Intronic
1035084334 7:156245373-156245395 TTTTATCCTGAATCTTTTGGGGG + Intergenic
1037474864 8:19247186-19247208 CTGAATTCAGAATTTTCTGGTGG + Intergenic
1037748702 8:21666141-21666163 CAGTATCCTGATGGTTTTGGAGG - Intergenic
1038670811 8:29581389-29581411 TTGAAGCATGAAAGTTTTGGAGG - Intergenic
1039240399 8:35549813-35549835 CAGAATTCTGAATATTTTTGAGG + Intronic
1039600505 8:38832967-38832989 CTCAATTGTGAATGTTTTGAGGG + Intronic
1039991280 8:42489900-42489922 CTGTATCCTGTTTGTGTTGGTGG + Intronic
1041496234 8:58488149-58488171 CTAAATCCTCACTGTTTGGGAGG - Intergenic
1043257351 8:78152573-78152595 CAGAATGCTGATTCTTTTGGAGG + Intergenic
1043820247 8:84854531-84854553 CTGCAGCCGGAATGCTTTGGGGG - Intronic
1044198632 8:89408506-89408528 CTGAATCCTGAATTTTTTCTGGG + Intergenic
1047758960 8:127939968-127939990 CTGAACCCTGCATTTTGTGGAGG + Intergenic
1047934637 8:129764834-129764856 CCGATTCCTGAACCTTTTGGGGG + Intronic
1048286963 8:133149320-133149342 CTGAATCCTGCATTGTTGGGAGG + Intergenic
1048545115 8:135379454-135379476 CTGCATCCTTTATGTTTTGATGG + Intergenic
1048863977 8:138745815-138745837 CTGAATCCTGAATGTTTTGGCGG - Intronic
1049227224 8:141461072-141461094 AAGAATTCTGAATCTTTTGGAGG + Intergenic
1049874059 8:145003751-145003773 CTAAATCTTTAATTTTTTGGGGG + Intergenic
1051212582 9:14760201-14760223 CTCAATCGTGAATGTTTTGAAGG + Intronic
1052810273 9:33052039-33052061 CTGTATCCTGATTGTAATGGTGG + Intronic
1053373793 9:37587001-37587023 CTGATTCCTGATTTTTTTGTGGG - Intronic
1055328462 9:75156994-75157016 CTGTATCCTGATTGTGGTGGTGG - Intergenic
1056282535 9:85055933-85055955 CAGAAGTCTGAATGTTTTGATGG - Intergenic
1056403755 9:86254279-86254301 CTGAATGCTGAATTCTTTGCTGG + Intronic
1060323401 9:122587966-122587988 CTACATCCTGATTGTGTTGGTGG + Intergenic
1060513961 9:124254339-124254361 CTGAATCCTGAAACTCTTTGGGG + Intergenic
1060712872 9:125888435-125888457 CTTAATCCTGAATGTTCTCAAGG - Intronic
1203688765 Un_GL000214v1:22405-22427 CTGAATCCTGAATTATTTCCTGG + Intergenic
1203753844 Un_GL000218v1:105319-105341 CTGAATCCTGAATTATTTCCTGG - Intergenic
1203713247 Un_KI270742v1:117851-117873 CTGAATCCTGAATTATTTTCTGG - Intergenic
1203537960 Un_KI270743v1:60200-60222 CTGAATCCTGAATTATTTCCTGG + Intergenic
1203647510 Un_KI270751v1:81648-81670 CTGAATCCTGAATTATTTCCTGG - Intergenic
1186416348 X:9386208-9386230 CTGACTTGTGAATGTTTTGATGG - Intergenic
1186808485 X:13163437-13163459 CTGTATTATGAAGGTTTTGGTGG - Intergenic
1186969675 X:14827911-14827933 CTGAACCCAAAATGTCTTGGAGG - Intergenic
1187188430 X:17010049-17010071 CTGAATCCTGAAGGTTGGGAAGG - Intronic
1187831138 X:23381963-23381985 CACAATCTTGAATGTTTTGGGGG + Intronic
1188624934 X:32272263-32272285 CTGAATGCTGAATGGTGTGTAGG + Intronic
1189597640 X:42586431-42586453 CTGTATCCTGATTGCTGTGGTGG + Intergenic
1190790351 X:53694131-53694153 CTGTATCCTGATTGTGGTGGTGG + Intergenic
1190956688 X:55202032-55202054 CTGAATCCTGAATTCTTTCAGGG - Intronic
1191706089 X:64095925-64095947 CTTATTCCTGAAAGATTTGGAGG + Intergenic
1193568387 X:83108954-83108976 CTGTATCCTGACTGTGTTAGTGG - Intergenic
1194157438 X:90409464-90409486 CTGATTCTTGACTGTGTTGGTGG - Intergenic
1194426627 X:93746901-93746923 CAGTATCCTGATTGTTTTTGAGG - Intergenic
1194572534 X:95570740-95570762 CTCACTGCTTAATGTTTTGGAGG + Intergenic
1194595152 X:95848177-95848199 CTGAATCCTGCATGTCTCAGAGG - Intergenic
1195515725 X:105773310-105773332 CTGCATCCTGAATTCATTGGTGG - Intergenic
1196076074 X:111577510-111577532 CTGAATCCTGAATTCTTTCCTGG + Intergenic
1196120022 X:112039924-112039946 CTGACTACTGAATATCTTGGAGG + Intronic
1197449941 X:126599990-126600012 CTAAATCATGAATTTTTTGTGGG - Intergenic
1200503771 Y:3986445-3986467 CTGATTCTTGACTGTGTTGGTGG - Intergenic
1201611330 Y:15846159-15846181 ATGAATCCTGAAAAATTTGGGGG - Intergenic