ID: 1048865004

View in Genome Browser
Species Human (GRCh38)
Location 8:138753946-138753968
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048864999_1048865004 5 Left 1048864999 8:138753918-138753940 CCCCTTTACGGAGCTCAGAGGAA 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1048865004 8:138753946-138753968 GTATACTCCGTGGTGAAAACAGG No data
1048864996_1048865004 23 Left 1048864996 8:138753900-138753922 CCATGAAGTAAAGTAATTCCCCT 0: 1
1: 0
2: 2
3: 14
4: 185
Right 1048865004 8:138753946-138753968 GTATACTCCGTGGTGAAAACAGG No data
1048865000_1048865004 4 Left 1048865000 8:138753919-138753941 CCCTTTACGGAGCTCAGAGGAAG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1048865004 8:138753946-138753968 GTATACTCCGTGGTGAAAACAGG No data
1048865001_1048865004 3 Left 1048865001 8:138753920-138753942 CCTTTACGGAGCTCAGAGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1048865004 8:138753946-138753968 GTATACTCCGTGGTGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr