ID: 1048865903

View in Genome Browser
Species Human (GRCh38)
Location 8:138761272-138761294
Sequence TCGTGCAGTGCCTGGTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048865903_1048865906 9 Left 1048865903 8:138761272-138761294 CCTGGCAACCAGGCACTGCACGA 0: 1
1: 0
2: 0
3: 10
4: 77
Right 1048865906 8:138761304-138761326 TTAAGCAAGTCAATAAATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048865903 Original CRISPR TCGTGCAGTGCCTGGTTGCC AGG (reversed) Intronic
902806932 1:18866959-18866981 TTGTGCTGGGCCTGGTGGCCAGG - Intronic
903780822 1:25819179-25819201 TCGGGCTGTGCCTGGCTCCCAGG - Intronic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906551885 1:46672054-46672076 TGGGACAGTGCCTGGCTGCCTGG + Intronic
914901221 1:151712161-151712183 AGGTGCTGCGCCTGGTTGCCAGG - Intronic
915213557 1:154326393-154326415 TGGAGCATTGCCTGCTTGCCGGG + Intronic
917927478 1:179801232-179801254 TTGTGCAGTGCCTGACTGCTGGG + Intronic
1066013756 10:31217580-31217602 TCTTTCAGTGCCTGGTTGAATGG + Intergenic
1070834257 10:79438057-79438079 TTCTGCCGTGCCTGGTAGCCTGG - Intronic
1074120174 10:110488172-110488194 TCCTGCAGGGTCTGGTTGCTTGG + Intergenic
1076037288 10:127210498-127210520 ACGTGCATTTCCTGGTTTCCCGG - Intronic
1076773809 10:132682005-132682027 AAGTACAGTGCCTGGTTGCCAGG + Intronic
1081613663 11:44578242-44578264 TAGTGCAGTGCCTGGTTTGCTGG + Intronic
1091171199 11:133521117-133521139 CTGTGCAGTTCCAGGTTGCCAGG - Intronic
1095952020 12:47786731-47786753 TCGTACTGTGCAGGGTTGCCAGG + Intronic
1103518703 12:121523784-121523806 TCGTTCTGTGCCTGGCTCCCCGG + Intronic
1105304798 13:19160892-19160914 CCGGCCAGTGCCTGGTGGCCTGG - Intergenic
1109726276 13:66345536-66345558 TCTTGAAGGGCCTCGTTGCCTGG - Intronic
1116336566 14:43665333-43665355 TGGTGCTGTGCTTGGTAGCCAGG - Intergenic
1118316983 14:64731540-64731562 TGGGGCAGGGCCTGGTTACCGGG - Exonic
1121346137 14:93137076-93137098 TGGTGCAGTGCCTGGCTGGCAGG + Intergenic
1129111409 15:73339419-73339441 TCTTGCAGTGCCAGGCAGCCTGG + Intronic
1131511185 15:93050435-93050457 TCCAGCAGAGCCTGGTTGACAGG + Intronic
1132285467 15:100659058-100659080 CCCTGCAGTGACTGGTGGCCGGG + Intergenic
1132891792 16:2208337-2208359 GCGTGCAGGGCCTGCTGGCCCGG + Intronic
1134087954 16:11371595-11371617 TGGAGCAGTGCCTGGTCTCCAGG + Intronic
1134552492 16:15144535-15144557 TCGTGCAGGGCTCTGTTGCCTGG - Intergenic
1136290268 16:29267448-29267470 TCCTGCAGGCCCTGGCTGCCAGG + Intergenic
1137611637 16:49822050-49822072 TCCAGCAGTCCCTGGTTGGCTGG + Intronic
1138527400 16:57616986-57617008 TAGCACAGTGCCTGGTTGCCAGG + Intronic
1141836999 16:86547494-86547516 TCCTGCAGTGCAGGGTTTCCTGG - Intronic
1142096154 16:88240969-88240991 TCCTGCAGGCCCTGGCTGCCAGG + Intergenic
1142398705 16:89848017-89848039 TCGTGCTGTCCCTGGTCGCGTGG - Intronic
1148044527 17:44734726-44734748 TCGTCCTGTGCCTGGATGCCAGG - Intronic
1152445005 17:80337339-80337361 TCCTCCAGTGCCTGGTGCCCCGG - Intronic
1152608160 17:81303289-81303311 ACAGGCAGTGCCTGGGTGCCCGG - Intergenic
1155992464 18:32293200-32293222 TTGGGCAGTGTCTGGTTGCTTGG - Intronic
1159136616 18:64344134-64344156 TCATGCACTGTCTGGTTGACTGG + Intergenic
1160799623 19:961591-961613 TGGTACAGTGCCTGGTGTCCTGG + Intronic
1160981896 19:1820047-1820069 TCGTTCAGTGCCTGGGGGACAGG + Exonic
1161489283 19:4553030-4553052 TTCAGCACTGCCTGGTTGCCTGG + Intronic
1161576666 19:5058316-5058338 GCGTGGAGTGTCTGGCTGCCCGG - Intronic
1162145918 19:8611907-8611929 TGGTACAGTGCCTGGTTCCAGGG + Intergenic
926302981 2:11617668-11617690 ACGTGCAGGGCCTGGGTGCGGGG + Intronic
926684968 2:15691268-15691290 GAGGGCAGGGCCTGGTTGCCTGG + Intronic
926920093 2:17931690-17931712 GCGTGCATTGCCTGGTTCACCGG + Exonic
927519270 2:23689334-23689356 TCCTCCTGTGCCTGGTGGCCAGG + Intronic
930558789 2:52933350-52933372 TGGTGCAGTGACTGGTTACCTGG - Intergenic
931621657 2:64216667-64216689 TCCTCCAGTGCCTGGTTGTGTGG + Intergenic
938607921 2:132915496-132915518 TTCTGCAGTGCCTTGTTCCCAGG - Intronic
948090688 2:235292233-235292255 TCCTGCTATGCCTGGTGGCCTGG + Intergenic
1174386532 20:50191032-50191054 TCATGCAACGCCTGGTGGCCTGG + Exonic
1180921571 22:19524202-19524224 TGGTGCTGTGCCTGGTGGGCTGG - Exonic
1181039099 22:20183638-20183660 TTGGGCCGTGCCTGGCTGCCAGG - Intergenic
1181778539 22:25177088-25177110 TAGTACAGTGCCTGGCTTCCTGG - Intronic
1183664099 22:39237472-39237494 ACGTGCAGCCCCTGGCTGCCCGG - Intronic
1185332135 22:50256615-50256637 TCGTTCACAGCCAGGTTGCCGGG + Exonic
959398377 3:105869094-105869116 TCGGGCAGTGCGCGGTTGCGCGG - Intronic
959710547 3:109381576-109381598 TCTTGCAGTACCTGGTTGTCTGG - Intergenic
961632006 3:128307965-128307987 CCAGGCAGTGCCTGGTTCCCTGG + Intronic
964191324 3:154004382-154004404 TCGCGCAGTGACTGGATTCCCGG + Intergenic
969687381 4:8683253-8683275 ATGTGCAGAGCCTGGGTGCCAGG + Intergenic
980097922 4:128512314-128512336 TCTGGCAGGGCCTGGCTGCCTGG - Intergenic
982297995 4:153849627-153849649 CCGTGAAGTGCCTGGGGGCCAGG - Intergenic
998480244 5:142457244-142457266 TCGTGCGGTTCTTGGTTGTCTGG + Intergenic
1002777907 6:344156-344178 TCAGGGAGTGCCTGGTTGCACGG - Intronic
1006377273 6:33678490-33678512 TGCAGCAGGGCCTGGTTGCCGGG - Exonic
1006933206 6:37699576-37699598 TCGGGAAGTGCCTGGTGGCATGG + Intergenic
1019451243 7:1099688-1099710 TCCTGCAGAGCTTGGTTGCCAGG + Intronic
1034400916 7:150860935-150860957 TCCTGCAGGACCTGGTGGCCTGG + Exonic
1036768493 8:11563744-11563766 TCGTGCGTTGCCTGGCTGCCCGG - Intronic
1038443213 8:27585965-27585987 TCTTGCAGTGCCTTGTGGGCTGG + Intergenic
1039457322 8:37716105-37716127 CTGTGCATTGCCTGGCTGCCAGG - Intergenic
1043115781 8:76252187-76252209 TCATTCAGTGCTTGCTTGCCTGG - Intergenic
1043542359 8:81279034-81279056 GCCTGAAGTGCCTGGTAGCCAGG + Intergenic
1045994600 8:108348072-108348094 TAGTGCAGTGCCTGTTCTCCAGG + Intronic
1047746984 8:127852614-127852636 TGGTACAGTGCCTGGCTTCCTGG + Intergenic
1048264842 8:132976599-132976621 GCTTGCAGTGTCTGGGTGCCTGG + Intronic
1048865903 8:138761272-138761294 TCGTGCAGTGCCTGGTTGCCAGG - Intronic
1048898809 8:139018519-139018541 TCGAGCAGAGCCTCTTTGCCAGG + Intergenic
1057220520 9:93255343-93255365 TCGGGCAGGGCCTGGCAGCCTGG - Intronic
1057885201 9:98824457-98824479 TTGAGCAGAGCGTGGTTGCCTGG + Intronic
1059484528 9:114616759-114616781 CTGTCCTGTGCCTGGTTGCCTGG + Intronic
1060225348 9:121786840-121786862 TCCTGCAGTGCTTGGTGGCCTGG - Intergenic
1062141808 9:134963294-134963316 GCGAGCAGTGCCTGGCTCCCGGG - Intergenic
1190024792 X:46912962-46912984 CCGGGTAGTGCCTGGTGGCCCGG + Intronic
1198578056 X:138032557-138032579 ACGTTCAGTGCCTGGGTGACAGG + Intergenic
1199646276 X:149915926-149915948 TCTTGAAGTGCCTAGCTGCCTGG + Intergenic