ID: 1048867535

View in Genome Browser
Species Human (GRCh38)
Location 8:138771840-138771862
Sequence AGAGCTCTCCGCAGGCCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048867535_1048867541 15 Left 1048867535 8:138771840-138771862 CCCCGGGGCCTGCGGAGAGCTCT 0: 1
1: 0
2: 2
3: 16
4: 125
Right 1048867541 8:138771878-138771900 AGCCGACTGCACCGCGCCTCAGG No data
1048867535_1048867540 -10 Left 1048867535 8:138771840-138771862 CCCCGGGGCCTGCGGAGAGCTCT 0: 1
1: 0
2: 2
3: 16
4: 125
Right 1048867540 8:138771853-138771875 GGAGAGCTCTTTGCTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048867535 Original CRISPR AGAGCTCTCCGCAGGCCCCG GGG (reversed) Intronic
900157386 1:1208725-1208747 ACAGCACCCCCCAGGCCCCGTGG - Intergenic
900205845 1:1431566-1431588 ACAGCTCTCCACTGGCCCAGGGG + Intergenic
900474454 1:2869631-2869653 AGGGCTCCCCACAGGCCCCAAGG + Intergenic
900782823 1:4629007-4629029 AGAGTTCTCAGATGGCCCCGTGG + Intergenic
901056650 1:6451469-6451491 AGAGCTGCCCGCTGGCCCGGAGG + Intronic
901058417 1:6460446-6460468 AGAGCTCTCCCCAGCCCCGTGGG + Exonic
901830467 1:11888988-11889010 AGAGCTCCCTTCAGGGCCCGAGG + Intergenic
901909783 1:12446990-12447012 AGACCTTTCCGGAGGCCACGTGG - Intronic
902089680 1:13893216-13893238 AGAGCGCTGCCCAGGCCCCGCGG - Intergenic
902219789 1:14957706-14957728 ACAGCTCTGCGGAGGCCCTGAGG + Intronic
902477716 1:16697036-16697058 AGAGCTGCCCGCTGGCCCCGAGG - Intergenic
906191506 1:43902191-43902213 AGAGCTCTCCAGAAGCCCAGAGG - Intronic
911205664 1:95089731-95089753 AAAACTCTGTGCAGGCCCCGTGG + Intergenic
920049200 1:203153107-203153129 AGAGCTCTCTGCAGGCACACAGG + Intronic
922116445 1:222618287-222618309 TGGGGTCTCCGCCGGCCCCGGGG + Intronic
1064288113 10:14010513-14010535 GGAGCCCTCCCCAGTCCCCGCGG + Intronic
1069778701 10:70941661-70941683 AGAGCTCTCCTGATGCCCTGAGG - Intergenic
1069921189 10:71816704-71816726 CTAGCTCTCCGAAGGCCCTGCGG - Exonic
1070835201 10:79443593-79443615 TGAGCTCTGGGCAGGACCCGGGG - Intronic
1072554183 10:96502245-96502267 AGAGCAATCAGCAGGCCCCGGGG - Intronic
1075588132 10:123672026-123672048 AGAGCCATCCCCAGGCTCCGAGG - Intronic
1076985918 11:236148-236170 AGGGCTCACCGCGGGCCCCATGG + Exonic
1083261976 11:61528167-61528189 CCAGCTCTCCCCAGGCTCCGAGG - Exonic
1083322731 11:61857303-61857325 AGCCTTCTCTGCAGGCCCCGGGG + Intronic
1083446022 11:62708529-62708551 AGAGCTGTCCCCAGGCCTCTGGG + Intronic
1083611885 11:64008296-64008318 AGAGCGCTCGGCTGGCCCCCAGG + Intronic
1083991210 11:66246842-66246864 AGAGCTGTCCACAGGCCAGGTGG - Intergenic
1085705836 11:78786305-78786327 AGAGCTCCCCACAGGCCCTAAGG - Intronic
1089452455 11:118607771-118607793 AGGGCTCTCGCCAGGCCCCGGGG - Intronic
1090309570 11:125723055-125723077 AGTCCTCTCCACAGGCCCAGTGG - Intergenic
1090982960 11:131739572-131739594 AGAGTTCTCCACAGGAACCGCGG - Intronic
1091907023 12:4197224-4197246 AGACCTCTGCACAGGGCCCGGGG - Intergenic
1092070064 12:5624915-5624937 AGAGCTCTCCCCAGCCCCTGGGG - Intronic
1095565712 12:43621320-43621342 AGACTTGTCCTCAGGCCCCGTGG + Intergenic
1099540726 12:83904469-83904491 AGAACTGTGTGCAGGCCCCGTGG + Intergenic
1101589771 12:106115491-106115513 AGAGCACTCAGGAGCCCCCGAGG + Intronic
1103946618 12:124530966-124530988 ATAGCTGCCCCCAGGCCCCGAGG + Intronic
1107217083 13:37934529-37934551 CGAACTCCCTGCAGGCCCCGCGG + Intergenic
1107651435 13:42549243-42549265 GGACCTCTCCGCAGGACCCTGGG - Intergenic
1112203512 13:97301666-97301688 TGAGTTCTCCGCCAGCCCCGGGG + Intronic
1113751304 13:112778190-112778212 AAAGCTCACCGGAGGCCCCAAGG + Intronic
1113798137 13:113070745-113070767 ACAGCTCTCTGCAGACCCCCAGG + Intronic
1118186657 14:63543640-63543662 AGAGCTCCTCTCAGGCCCAGCGG - Intergenic
1119652231 14:76392107-76392129 ATGGCTCTCAGCAGGCCCCGGGG + Intronic
1122149317 14:99716304-99716326 AGAGCTCACCGCAGGGCTAGGGG + Intronic
1122855161 14:104556565-104556587 AGGGCTCTCCTCTGGCCCAGAGG + Intronic
1127313086 15:57769597-57769619 AGAGCTCTCCTCAGGCACCGTGG - Intronic
1129883957 15:79025812-79025834 GGAGCTGGCTGCAGGCCCCGAGG + Intronic
1130398722 15:83529517-83529539 AGAGTGATCCGCAGGCCCCTGGG + Intronic
1133042738 16:3069078-3069100 AAAGCTCTCCCCAGGCTCCTCGG - Exonic
1133044782 16:3081721-3081743 AAAGCTCTCCCCAGGCTCCTCGG - Intronic
1133864236 16:9626869-9626891 AGAGCTCTCTGCTGGCCACTGGG + Intergenic
1134464206 16:14458837-14458859 AGCGATCTCCGCAGGCTCAGCGG + Intronic
1137444502 16:48523528-48523550 AGAGCTCGCCCCAGGCCTGGTGG - Intergenic
1142147587 16:88499041-88499063 AGAGCCATCTGCAGCCCCCGAGG + Intronic
1143479382 17:7219835-7219857 ACAGCTCCCAGCATGCCCCGGGG + Intronic
1146794910 17:35774024-35774046 AGAGCTCTCCAGAGTCCCTGAGG - Intronic
1148725719 17:49788668-49788690 AGCGTTCTGCGCAGGCGCCGCGG - Exonic
1151396122 17:73824169-73824191 AGAGCTCTCTGCTGGTCCCTGGG + Intergenic
1151494159 17:74449608-74449630 GGAGCTGTCCGCGGGCCCCCAGG + Intronic
1152305235 17:79516529-79516551 AGAGCTCTGTTCACGCCCCGAGG + Intergenic
1153766926 18:8383913-8383935 GGAACTCTCATCAGGCCCCGGGG - Intronic
1155231957 18:23782908-23782930 AGAGCTCACCACAGGCCCCCAGG - Intronic
1156466191 18:37349066-37349088 AGGGCTCTCTCCAGGCCCCATGG - Intronic
1157823365 18:50790167-50790189 GGAGCTCTCCGCCTGCTCCGTGG + Intergenic
1158530630 18:58256611-58256633 AGAGGACTCCGCAGGGCCAGGGG + Intronic
1158735658 18:60075762-60075784 AGAGCCATCCCCAGGCCCCTGGG - Intergenic
1159952772 18:74496825-74496847 GGAGTTCTCAGCAGGCCCCTGGG - Intronic
1160592147 18:79951017-79951039 CCCGCTCCCCGCAGGCCCCGAGG - Exonic
1160859319 19:1231000-1231022 GGAGCGCTCTCCAGGCCCCGTGG - Exonic
1164465660 19:28485490-28485512 TGAGCTGTCCGCATGCCCAGTGG + Intergenic
1164651705 19:29895431-29895453 TGATCTCTCAGAAGGCCCCGTGG - Intergenic
1165586024 19:36916311-36916333 ACACCTCCCAGCAGGCCCCGCGG - Intronic
1166964485 19:46520178-46520200 ACAGGTCTCCACAGGCCCAGTGG - Intronic
1168636777 19:58002829-58002851 ACAGCTCCCAGCAGACCCCGCGG - Exonic
1168671886 19:58246846-58246868 AGAGCTCTCCGCAGGGCCCCAGG + Intronic
1202711732 1_KI270714v1_random:22862-22884 AGAGCTGCCCGCTGGCCCCGAGG - Intergenic
925018898 2:553392-553414 ACAGCTCTCCCCAGACACCGTGG - Intergenic
925777523 2:7349459-7349481 AGAGTTCTCCGAATCCCCCGTGG + Intergenic
927864427 2:26579608-26579630 AGAGCTTTCCGCAGGCCCTCAGG - Intergenic
927909585 2:26887426-26887448 ACACCTCCCCGCAGGCCCAGGGG + Intronic
939189707 2:138902033-138902055 AGAGCTGTGCCCAGGCCCTGCGG - Intergenic
948704109 2:239778662-239778684 AGTGCTGTTCCCAGGCCCCGAGG - Intronic
948808272 2:240462243-240462265 ACAGCTCTCCGAAGGCGCCGGGG - Exonic
1171530229 20:25848392-25848414 CGACCTCTCTGCAGGCCCCCAGG - Intronic
1172487306 20:35306062-35306084 ATAGCTGTCCTCAAGCCCCGGGG - Intronic
1176171809 20:63699593-63699615 ACAGCACTCGGCAGGCCCAGTGG + Exonic
1177012283 21:15743865-15743887 ACAGCTCTGCGCAGGCCTCCTGG + Intronic
1180994010 22:19955546-19955568 AGGGCCCTCTGCAGCCCCCGTGG + Intronic
1184827558 22:46963394-46963416 AGAGCTCTCTGAAGGCTCCCTGG - Intronic
1184962337 22:47940595-47940617 GTAGCTCTCCGCAGGCCCACAGG - Intergenic
1185148548 22:49151888-49151910 AGGCCCCTCCGCAGGCCCTGGGG - Intergenic
950788836 3:15456359-15456381 AAAGCCCTCCCCAGGCCCAGTGG + Intronic
951319393 3:21226341-21226363 CAAACTCTGCGCAGGCCCCGTGG - Intergenic
953236376 3:41111109-41111131 AGAGCTCTGCCCAGACCCCAGGG + Intergenic
956124737 3:66000661-66000683 AGAGCTCTGCTCAGCCCCCATGG + Intronic
956779163 3:72590870-72590892 AGAGCACAGCGGAGGCCCCGGGG + Intergenic
960969655 3:123130437-123130459 AGAGCTCAGAGCAGGCCCTGGGG - Intronic
968434055 4:576026-576048 AGAGCGCGGCGCAGGCCCCGCGG + Intergenic
968742096 4:2336242-2336264 AAAGCCCTCCACAAGCCCCGGGG - Intronic
969098309 4:4750796-4750818 AGAGCTCTCAGCAGCCCTCTTGG - Intergenic
970386713 4:15563787-15563809 ATAGTTCTCCTGAGGCCCCGTGG + Intronic
971888366 4:32483180-32483202 AGAGCTCTCACCAGGCCATGAGG + Intergenic
986809190 5:11338322-11338344 AGACCTCTCTGCAGTCCTCGAGG + Intronic
989379273 5:40797905-40797927 GGAGCTCTCCCCAGCCGCCGCGG - Intronic
990449879 5:55924319-55924341 AGAGCTCTCTGCAGGCACCCAGG - Intergenic
998177550 5:139911218-139911240 AGGGCACACAGCAGGCCCCGGGG - Intronic
1001053361 5:168430016-168430038 AGAGCTCACCATAGGCCCCAGGG + Intronic
1001940824 5:175738324-175738346 TGAGGTCTCCCCAGGGCCCGAGG - Intergenic
1002401533 5:178994059-178994081 CGAGCGCTCCGCAGGCCCAGGGG + Intronic
1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG + Intergenic
1007585129 6:42984735-42984757 AGAGCTCCGCGCAGGCTCCAAGG - Intronic
1007635570 6:43297954-43297976 AGAGCTGGCCCCAGGCCCCAGGG + Intronic
1007652608 6:43432682-43432704 GGAGCTCTCCACAGGCCCCACGG - Exonic
1011193703 6:84762621-84762643 TGCCCTCGCCGCAGGCCCCGCGG - Exonic
1011620843 6:89240991-89241013 AGAGCTCCAGGCAGGCCCCCAGG - Intergenic
1019714248 7:2531024-2531046 AGGGCTCTCCACAGGCTCAGAGG + Intergenic
1019762548 7:2824392-2824414 AGAGGCCTCCGCAGACCCAGAGG - Intronic
1020104070 7:5413063-5413085 AGGGCTCCCAGCAGGCCCTGGGG + Intronic
1020383134 7:7567263-7567285 GGAGGTCTCCGCAGGTCCCACGG - Intronic
1022870347 7:34471678-34471700 AGATCTGTCCTCAGGCCCCTGGG + Intergenic
1024046399 7:45588642-45588664 GGACCTGTCCGCAGGCCCTGGGG - Intronic
1027218886 7:76201807-76201829 AGCGCCCTCCGCAGGCCTGGAGG - Intergenic
1031124508 7:117757924-117757946 AGAGCTTCGCGCAGTCCCCGTGG - Exonic
1034957141 7:155341973-155341995 ATAGCTGTCTGCAAGCCCCGGGG - Intergenic
1037994288 8:23341322-23341344 AGAGCTCACTGCAGGGCCTGAGG - Intronic
1048867535 8:138771840-138771862 AGAGCTCTCCGCAGGCCCCGGGG - Intronic
1049310949 8:141933603-141933625 AGAGCTCACCCCAGGCTCTGGGG - Intergenic
1049409454 8:142465973-142465995 AGAGCCCTGTGGAGGCCCCGTGG + Intronic
1049732056 8:144183572-144183594 AGAGCTCTCCAGTGGCCCCTGGG + Intronic
1049794327 8:144489522-144489544 GGAGCAGTCTGCAGGCCCCGGGG + Intronic
1053434972 9:38068574-38068596 AGAGCCCCCCGCAGCCGCCGCGG - Exonic
1057227980 9:93302458-93302480 AAAGCTCTCCCCAGGCCCTAGGG - Intronic
1057544360 9:96006396-96006418 AGAGCACTCAGCAGGCACCTTGG + Intronic
1057684709 9:97221817-97221839 GGGGCTCTCCGCAGCCACCGGGG + Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061189108 9:129071393-129071415 AGGACTCTCTGCAGGCCCAGGGG - Exonic
1061622995 9:131823910-131823932 AGAGCTGTCTGCCGGCCGCGGGG - Intergenic
1061807958 9:133147074-133147096 ATAGCTGTCCACAGGCCCCTGGG + Intronic
1188108519 X:26170044-26170066 ACAGCTCTCCCTAGGCCCCTCGG + Intergenic
1189170616 X:38905882-38905904 AGAGCTCACCACAGGCCCTGTGG + Intergenic
1193655129 X:84188498-84188520 AGAGCGCTGCGCATGCTCCGTGG - Intergenic
1196986765 X:121282176-121282198 AGATCTGTCCTCAGGCCCCTTGG + Intergenic
1197727948 X:129788609-129788631 AGAGCGGTCCCCAGGCCCCCTGG - Intronic