ID: 1048867536

View in Genome Browser
Species Human (GRCh38)
Location 8:138771841-138771863
Sequence AAGAGCTCTCCGCAGGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048867536_1048867541 14 Left 1048867536 8:138771841-138771863 CCCGGGGCCTGCGGAGAGCTCTT 0: 1
1: 0
2: 0
3: 15
4: 176
Right 1048867541 8:138771878-138771900 AGCCGACTGCACCGCGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048867536 Original CRISPR AAGAGCTCTCCGCAGGCCCC GGG (reversed) Intronic
900379621 1:2377398-2377420 CAGAGCACTCAGGAGGCCCCGGG + Intronic
900412734 1:2520274-2520296 CAGACATCTCCGCAGACCCCTGG + Intronic
900489242 1:2938683-2938705 AAGGCCTCTCCGCAGCCCCTTGG - Intergenic
900489578 1:2940487-2940509 AAGCCCTCTCCGCAGCCCCTTGG - Intergenic
900939353 1:5787837-5787859 AAGAGCTCTCCACAGCAGCCTGG + Intergenic
901058416 1:6460445-6460467 CAGAGCTCTCCCCAGCCCCGTGG + Exonic
902105771 1:14034898-14034920 AAGAGCTCTCTGCAGTTCCTCGG - Intergenic
902560871 1:17276798-17276820 AAGAGCTTGAAGCAGGCCCCAGG - Exonic
903378096 1:22879088-22879110 CAGAACTGTCCTCAGGCCCCTGG + Intronic
905015714 1:34777150-34777172 TAGAGCTCTGCCCAGGCCTCAGG - Intronic
907453043 1:54559385-54559407 AGCAGCTCTCCGAAGGCTCCCGG - Intronic
911498152 1:98655397-98655419 AAGAGCTCTCTGCAGGACACTGG + Intergenic
912685189 1:111756317-111756339 AAGAGCCCTCGGTCGGCCCCCGG + Intronic
914704927 1:150162686-150162708 AAGTGCCCTCCGGAGGCCCTAGG + Intronic
920691876 1:208153548-208153570 AAGAGCTCTCACCAGCCCACTGG - Intronic
922252245 1:223860149-223860171 AATAGCTCTCGGCTGGCACCTGG - Intergenic
923152023 1:231241718-231241740 AGGAGCTTTCTGAAGGCCCCAGG - Intronic
924621237 1:245662919-245662941 AAGAGCTCTCTGGAGCCCTCTGG - Intronic
924783478 1:247172833-247172855 AACATCTCTCCTCAGGCCCAAGG + Intergenic
1065844894 10:29736146-29736168 CAGAGCTGTCCCCACGCCCCAGG + Intronic
1067051632 10:43024886-43024908 AAGGGCTCTGGGCAGGCTCCCGG - Intergenic
1067071062 10:43132427-43132449 AAGATCTCTCAGCTGGACCCCGG + Intergenic
1069799313 10:71072417-71072439 AATAGCTCTCCACTGGCCCTGGG - Intergenic
1072554184 10:96502246-96502268 AAGAGCAATCAGCAGGCCCCGGG - Intronic
1074082593 10:110179519-110179541 AGGAGCTCTCCAAAGCCCCCAGG - Intergenic
1076360286 10:129883598-129883620 TAGGGCTCTCTGCAGCCCCCAGG - Intronic
1076538049 10:131195621-131195643 AGGACCTCTCCGCTGGGCCCAGG + Intronic
1076970957 11:131986-132008 AAGAGCTCAGCGCTGCCCCCTGG + Intergenic
1077523710 11:3051298-3051320 AAGAGCTCCCGGCACCCCCCAGG - Intronic
1081760141 11:45571295-45571317 AGGGGCTCTCCACAGGCCGCTGG + Intergenic
1083143427 11:60739976-60739998 GAGAGCTCCCTGAAGGCCCCAGG + Intronic
1083446021 11:62708528-62708550 GAGAGCTGTCCCCAGGCCTCTGG + Intronic
1089452456 11:118607772-118607794 CAGGGCTCTCGCCAGGCCCCGGG - Intronic
1089593441 11:119559799-119559821 GAGGGCTCTAAGCAGGCCCCAGG - Intergenic
1092070065 12:5624916-5624938 TAGAGCTCTCCCCAGCCCCTGGG - Intronic
1103767326 12:123289988-123290010 AAGGCCACTCTGCAGGCCCCTGG - Exonic
1104725429 12:131072689-131072711 AAGAGATCTCTGCAGGCTCATGG + Intronic
1106565864 13:30883991-30884013 CAGAGCTCACCGCAGCCTCCGGG - Intergenic
1107651436 13:42549244-42549266 CGGACCTCTCCGCAGGACCCTGG - Intergenic
1107869524 13:44734416-44734438 AAGAGCTTTCCACAAGCACCTGG - Intergenic
1113535965 13:111066627-111066649 AGGAGCTTTCCGAAGGCTCCGGG + Intergenic
1113881008 13:113626199-113626221 GAGAGCTCTCCACAGGGCCAGGG - Intronic
1119476720 14:74934775-74934797 GAGAGGGCTTCGCAGGCCCCAGG + Intergenic
1119652230 14:76392106-76392128 CATGGCTCTCAGCAGGCCCCGGG + Intronic
1122153956 14:99739257-99739279 AAGAGCTGTCTGCTGGCTCCCGG - Intronic
1202902011 14_GL000194v1_random:49626-49648 AAGAGCTCTCTCCAGTCCCTTGG + Intergenic
1127587839 15:60395433-60395455 AAAATGTCTCCGCAGGCTCCAGG + Intronic
1127963318 15:63906331-63906353 AAGAGCCCCTCGCAGGCCCAGGG + Intergenic
1128632590 15:69281285-69281307 CAGAGGTCTCTGCAGGGCCCTGG - Intergenic
1129167019 15:73784473-73784495 GAGAGCTCTCATCAGGCCCGAGG - Intergenic
1129312116 15:74720155-74720177 AAGAACTCTCTGGAAGCCCCTGG - Exonic
1130115389 15:81001271-81001293 CTGAGCTCTCCCGAGGCCCCGGG - Exonic
1130398721 15:83529516-83529538 TAGAGTGATCCGCAGGCCCCTGG + Intronic
1130888250 15:88111564-88111586 AAGGGCTTTCTGCAGGTCCCTGG + Intronic
1131261632 15:90890837-90890859 CAGAGCCATCCACAGGCCCCTGG - Intronic
1131548067 15:93332643-93332665 GAGAGCTCCCAGCAGGGCCCGGG - Intergenic
1132585681 16:705045-705067 AGTAGCTCAGCGCAGGCCCCGGG + Intronic
1132706388 16:1245289-1245311 CAGAGCTACCCGCATGCCCCGGG + Intergenic
1132949274 16:2551451-2551473 AACTGCTCTCTCCAGGCCCCCGG - Intronic
1132965314 16:2650677-2650699 AACTGCTCTCTCCAGGCCCCCGG + Intergenic
1133864235 16:9626868-9626890 AAGAGCTCTCTGCTGGCCACTGG + Intergenic
1136687709 16:32004789-32004811 ATGAGATCTCCCCAGGCCCTAGG - Intergenic
1136788317 16:32948340-32948362 ATGAGATCTCCCCAGGCCCTAGG - Intergenic
1136881499 16:33905591-33905613 ATGAGATCTCCCCAGGCCCTAGG + Intergenic
1139513486 16:67440334-67440356 AAGAGGTCAGCCCAGGCCCCAGG + Intronic
1141764742 16:86051117-86051139 TCGGGCTCTCAGCAGGCCCCAGG - Intergenic
1203090515 16_KI270728v1_random:1209855-1209877 ATGAGATCTCCCCAGGCCCTAGG - Intergenic
1147148695 17:38500459-38500481 ATGAGATCTCCCCAGGCCCTAGG - Intronic
1149182251 17:53953064-53953086 AAGAGCTATCCACAGACTCCAGG - Intergenic
1150601257 17:66652995-66653017 AAGAGCACTCACCTGGCCCCTGG + Intronic
1150618421 17:66790016-66790038 AGCAGCTCTCTGCAGTCCCCGGG - Intronic
1151396121 17:73824168-73824190 AAGAGCTCTCTGCTGGTCCCTGG + Intergenic
1152552472 17:81036449-81036471 AAGAGGGCTTCCCAGGCCCCTGG - Intronic
1158489689 18:57898705-57898727 AACAGCTTGCAGCAGGCCCCTGG + Intergenic
1158735659 18:60075763-60075785 CAGAGCCATCCCCAGGCCCCTGG - Intergenic
1159952773 18:74496826-74496848 TGGAGTTCTCAGCAGGCCCCTGG - Intronic
1160893966 19:1394326-1394348 AGGAGCTCTGCCCATGCCCCTGG + Intronic
1161064368 19:2230353-2230375 AAGAGCTCAGGGCAGGCGCCAGG - Exonic
1161533488 19:4804266-4804288 CAGAGCTCTCTGCAGCCCCCAGG - Intergenic
1162398139 19:10429963-10429985 TAGAGTTCTCCACAGACCCCAGG - Intronic
1162410624 19:10503083-10503105 AAGCGCTCACCTCAGCCCCCAGG + Intronic
1163588672 19:18177915-18177937 ATGAGCTCTCCGCAGCTCACCGG - Exonic
1164990297 19:32677717-32677739 AAGGGCTCTCCCCAGCCACCCGG + Exonic
1166471260 19:43081310-43081332 AAGAGACCTCCTCAGGACCCAGG - Intronic
1168115130 19:54218103-54218125 TAGAGCTCTCCCCAGGCCTCAGG - Intronic
1168120827 19:54251795-54251817 TAGAGCTCTCCCCAGGCCTCAGG - Intronic
1168124405 19:54275692-54275714 TAGAGCGCTCCCCAGGCCTCTGG - Intronic
1168177580 19:54635846-54635868 TAGAGCTCTCCCCAGGCCTCAGG + Intronic
927893463 2:26766699-26766721 AAGAGCACCTCGCATGCCCCAGG + Intronic
928258873 2:29749171-29749193 AAGAGCTGCCCTCAGTCCCCAGG + Intronic
929376968 2:41299263-41299285 AGGACCTCTCAGGAGGCCCCTGG + Intergenic
933776424 2:85773888-85773910 AAGGGCTCAGCGCAGGCCCACGG + Intronic
934504682 2:94880805-94880827 AAGAGCTCTCTCCAGTCCCTCGG - Intergenic
934714961 2:96537893-96537915 AGGAGTGCTCCGCGGGCCCCAGG + Intronic
935131996 2:100267577-100267599 AAGAGCTCTGCACGGGGCCCAGG - Intergenic
935535358 2:104286987-104287009 CACAGCTCTCTGCAGGCTCCGGG - Intergenic
935589885 2:104836472-104836494 GAGAGCTCCACACAGGCCCCTGG - Intergenic
936429945 2:112454015-112454037 AAGAGCTCTCAGGAAGCCACTGG + Intergenic
937407969 2:121648769-121648791 AGAAGCTCTTCGAAGGCCCCGGG + Intronic
938276146 2:130025738-130025760 AGGTGCTCTCCGCAAGCCTCAGG + Intergenic
942047243 2:172106893-172106915 ATCAGCTCTCCGCAGCCCCTTGG + Intergenic
942678454 2:178451634-178451656 AAGAGCGCACCGCAGCCCCCTGG - Exonic
942704512 2:178755044-178755066 CAGAGCTTTCCACAGACCCCTGG + Intronic
948124397 2:235554356-235554378 AAGAGCTCACCCCTGGGCCCTGG - Intronic
948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG + Intronic
948808273 2:240462244-240462266 TACAGCTCTCCGAAGGCGCCGGG - Exonic
949032329 2:241802956-241802978 AAGGGCCCTCCACGGGCCCCTGG - Intronic
1169544381 20:6635756-6635778 AAGAGCTCTTCACAGTACCCGGG - Intergenic
1171342530 20:24441814-24441836 AAGAGCTGCCCACAGGCACCAGG - Intergenic
1171891822 20:30724375-30724397 AAGAGCACTCCGCGGCCACCTGG + Intergenic
1172134978 20:32680820-32680842 GAGAGCTCTGCAAAGGCCCCAGG + Intergenic
1173837629 20:46136236-46136258 GAGCCCTCTCCACAGGCCCCAGG - Intergenic
1176281443 20:64316087-64316109 AATAGTTCTCAGCAGGGCCCTGG - Intergenic
1176621380 21:9064393-9064415 AAGAGCTCTCTCCAGTCCCTTGG + Intergenic
1181508784 22:23379612-23379634 CAGAGCTCTGCCCAGGGCCCAGG - Intergenic
1182528274 22:30935218-30935240 AAAAGCCCTTCCCAGGCCCCTGG + Intronic
1183727535 22:39597875-39597897 GAGAGCTCCCCTCAGGCCCAGGG - Intronic
950210210 3:11117546-11117568 AACAGCTCTTCGCCAGCCCCGGG - Intergenic
950480949 3:13243380-13243402 AGGAGCCCTGCGGAGGCCCCAGG + Intergenic
953236375 3:41111108-41111130 CAGAGCTCTGCCCAGACCCCAGG + Intergenic
954139912 3:48599494-48599516 AGCAGCTCTCCCCAGTCCCCTGG - Intronic
954518030 3:51197695-51197717 CAGGGCACTCCGCAGGCCCCAGG + Intronic
956779162 3:72590869-72590891 AAGAGCACAGCGGAGGCCCCGGG + Intergenic
961868961 3:129974711-129974733 AAGAGGGCTCGGCAGGCGCCCGG + Exonic
968742097 4:2336243-2336265 AAAAGCCCTCCACAAGCCCCGGG - Intronic
968980739 4:3848169-3848191 AAGAGCTCTCAGGAGACCCCAGG + Intergenic
970581352 4:17476992-17477014 AACACCTCTCCCCAGGCCCCAGG + Intronic
971237077 4:24852108-24852130 AAGAGCTCTCTGGATGACCCAGG + Intronic
971480922 4:27114423-27114445 GAGAGCTGTACGCAGGCCCTGGG - Intergenic
971785369 4:31095422-31095444 AACTGCTCTCTGCAGGCCCTTGG + Intronic
973001946 4:44962115-44962137 AATAGCTCTCCTCCTGCCCCAGG + Intergenic
974148823 4:57979541-57979563 AAGAGCTCTCCGAATGCTCTGGG + Intergenic
977758042 4:100697016-100697038 AAGAACTCTCCTCAGAACCCAGG - Intronic
979728450 4:123992512-123992534 AAGAACTCTGTGCAGGCCCATGG - Intergenic
981774656 4:148351563-148351585 AAGAGCCCTCTACAGACCCCAGG + Intronic
983440294 4:167773980-167774002 AAGAGGTATCTGCAGGCCCATGG + Intergenic
985749666 5:1667133-1667155 AAGGGCGCTCCGCAGGCGGCAGG + Intergenic
985960885 5:3302550-3302572 AAGGTCTCTCTGGAGGCCCCAGG + Intergenic
986326424 5:6678591-6678613 AAGAGCTCCCAGCAGGCTGCTGG - Intergenic
986556475 5:9014932-9014954 TAGGGCTCTCAGCAGGCCCAAGG + Intergenic
990357527 5:54985166-54985188 AAAAGCTCTCAGCATGCCCCGGG + Intronic
990666545 5:58079035-58079057 AAGGGCTCTCAGCAGTGCCCAGG - Intergenic
993346412 5:86789002-86789024 AAGAGCTCTTTAAAGGCCCCAGG + Intergenic
994353406 5:98770514-98770536 ATGAGCCCCCCGCAAGCCCCGGG + Intronic
995862023 5:116651061-116651083 AAATTCTCTCTGCAGGCCCCAGG + Intergenic
998177551 5:139911219-139911241 AAGGGCACACAGCAGGCCCCGGG - Intronic
999302528 5:150500105-150500127 AAGACATCTTAGCAGGCCCCAGG - Intronic
1001053360 5:168430015-168430037 TAGAGCTCACCATAGGCCCCAGG + Intronic
1001603315 5:172943285-172943307 GAGGCCTCTCCCCAGGCCCCCGG + Intronic
1002401532 5:178994058-178994080 TCGAGCGCTCCGCAGGCCCAGGG + Intronic
1002961758 6:1922223-1922245 GAGAGCTCTCAGCAGATCCCTGG + Intronic
1005593041 6:27348462-27348484 TAGACCTGTCCTCAGGCCCCTGG - Intergenic
1006581531 6:35080405-35080427 AAGAGCTCTCCCCCAGCCCCAGG + Intronic
1007635569 6:43297953-43297975 GAGAGCTGGCCCCAGGCCCCAGG + Intronic
1009900330 6:69801282-69801304 AACAACTCTCCTCAGGCCCAAGG - Intergenic
1014693239 6:124587610-124587632 AAGAGCTGGCCCCAGGCCCAGGG + Intronic
1015350380 6:132210743-132210765 AGCAGCTCTCCTCCGGCCCCAGG + Intergenic
1018433240 6:163740064-163740086 GCAAGCTCTCCACAGGCCCCAGG - Intergenic
1019121294 6:169806849-169806871 CAGAGCTCTCCACATGCCCAGGG + Intergenic
1019648811 7:2145162-2145184 AGCAGCTCTCGGCAGTCCCCGGG - Intronic
1020093546 7:5355029-5355051 AAAAGCTCTCCACCCGCCCCAGG + Intronic
1022490784 7:30816005-30816027 CAGAGCTTTCCCAAGGCCCCTGG - Intronic
1022870346 7:34471677-34471699 TAGATCTGTCCTCAGGCCCCTGG + Intergenic
1024046400 7:45588643-45588665 AGGACCTGTCCGCAGGCCCTGGG - Intronic
1029446652 7:100616781-100616803 AAGAGCTGTCCCCAGACTCCTGG - Intergenic
1032403681 7:131640842-131640864 AAGACCTCTCCGTCTGCCCCAGG - Intergenic
1034957142 7:155341974-155341996 AATAGCTGTCTGCAAGCCCCGGG - Intergenic
1035833371 8:2722686-2722708 AAGAGCCCTCAGCAGTCCCAGGG - Intergenic
1036966416 8:13303281-13303303 ATGTGATCTCCACAGGCCCCAGG - Intronic
1037179889 8:15992680-15992702 AAGATCAATCCCCAGGCCCCTGG + Intergenic
1039776171 8:40739183-40739205 AAGAGCTTTTCGGAGGCTCCTGG - Intronic
1039850620 8:41361647-41361669 ACTAGCTCACCGAAGGCCCCTGG + Intergenic
1041486441 8:58382701-58382723 AAGACCTCTCCGCATTTCCCAGG - Intergenic
1042109603 8:65366997-65367019 AGTAGCTCTCCCCCGGCCCCAGG - Intergenic
1048011921 8:130464700-130464722 AAGAGCTCTCCAGGGGACCCAGG - Intergenic
1048867536 8:138771841-138771863 AAGAGCTCTCCGCAGGCCCCGGG - Intronic
1049369552 8:142257349-142257371 AGGAGCTCCCCGCAAGCCCGAGG + Intronic
1049732055 8:144183571-144183593 TAGAGCTCTCCAGTGGCCCCTGG + Intronic
1049831613 8:144704647-144704669 TAGAGCTGGCAGCAGGCCCCAGG - Intergenic
1051197374 9:14577249-14577271 AAGATCAATCCCCAGGCCCCTGG - Intergenic
1054356992 9:64071322-64071344 AAGAGCACTCCGCGGCCACCTGG - Intergenic
1056025314 9:82488660-82488682 AATTGCTCTCCAAAGGCCCCTGG - Intergenic
1057227981 9:93302459-93302481 GAAAGCTCTCCCCAGGCCCTAGG - Intronic
1057684708 9:97221816-97221838 AGGGGCTCTCCGCAGCCACCGGG + Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061622996 9:131823911-131823933 AAGAGCTGTCTGCCGGCCGCGGG - Intergenic
1061807957 9:133147073-133147095 CATAGCTGTCCACAGGCCCCTGG + Intronic
1203744577 Un_GL000218v1:34863-34885 AAGAGCTCTCTCCAGTCCCTAGG + Intergenic
1203565524 Un_KI270744v1:84621-84643 AAGAGCTCTCTCCAGTCCCTCGG - Intergenic
1187648382 X:21374374-21374396 AATATCTCTCCGCAGCCCTCGGG - Intergenic
1197594735 X:128451502-128451524 AAGACCTGTCCTCAGGCCCCTGG + Intergenic
1198051672 X:132957592-132957614 CAGAGCTCTCCGGAGCTCCCCGG + Intronic