ID: 1048867835

View in Genome Browser
Species Human (GRCh38)
Location 8:138773703-138773725
Sequence CTGTGGGTGCTGAGGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048867822_1048867835 23 Left 1048867822 8:138773657-138773679 CCCGCTAAACTCTTGGGACCTTG 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG No data
1048867823_1048867835 22 Left 1048867823 8:138773658-138773680 CCGCTAAACTCTTGGGACCTTGA 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG No data
1048867831_1048867835 -8 Left 1048867831 8:138773688-138773710 CCTGCACCAGGCACTCTGTGGGT 0: 1
1: 0
2: 2
3: 21
4: 246
Right 1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG No data
1048867827_1048867835 5 Left 1048867827 8:138773675-138773697 CCTTGATGGAGGGCCTGCACCAG 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048867835 Original CRISPR CTGTGGGTGCTGAGGGAAGA CGG Intronic
No off target data available for this crispr