ID: 1048871719

View in Genome Browser
Species Human (GRCh38)
Location 8:138804429-138804451
Sequence CTGCTGTGCTTGAGCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048871719 Original CRISPR CTGCTGTGCTTGAGCAGAGC AGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900420934 1:2555645-2555667 CGCCTGTGCTTGCCCAGAGCAGG - Intronic
900595967 1:3480361-3480383 CTGCTATGCCTGAGCACACCAGG - Intronic
900625174 1:3604705-3604727 CTGGTGATCTTGAGCAGATCAGG - Intronic
900695951 1:4010536-4010558 CTGCTGTGGTTCAGCAGGGGCGG + Intergenic
900792352 1:4688948-4688970 CCGCTGTGAGTGAGCAGGGCAGG - Intronic
902268143 1:15283644-15283666 CTGCTGTGCCAGAGGAGAGCTGG - Intronic
902687546 1:18088434-18088456 CAGCTGAGCTAGAGCAGAGACGG + Intergenic
903659226 1:24966689-24966711 CTGCTCAGATTCAGCAGAGCTGG - Intergenic
907342649 1:53747925-53747947 CTGCTGTGGTGGTGGAGAGCAGG - Intergenic
911855407 1:102869734-102869756 TTGCTTTGCTTTAGCAGAGACGG - Intergenic
912202431 1:107473242-107473264 CTGCTATGCTTGAGCAATGCTGG - Intronic
912641083 1:111346650-111346672 GCGATGTGCTTCAGCAGAGCAGG + Exonic
912736273 1:112152081-112152103 CTGATGGTCCTGAGCAGAGCAGG + Intergenic
912961966 1:114204039-114204061 CTGCTGTGCCTGAGCAGGCAAGG - Intergenic
913230459 1:116736729-116736751 CTGCTCCGGTTGAGCAGAGGAGG - Intergenic
914213514 1:145603590-145603612 CTGCTCTGCCTGAGCACAGACGG + Intergenic
914286790 1:146234225-146234247 CTGCTATGCTTGAGATAAGCAGG + Intergenic
914547821 1:148684965-148684987 CTGCTATGCTTGAGATAAGCAGG + Intergenic
914708007 1:150187280-150187302 CTCCTGGGCTCAAGCAGAGCTGG + Intergenic
915604112 1:156940084-156940106 CTGGTGTGCTTGAGGAGAGATGG - Intronic
915937036 1:160095671-160095693 CTCCTTTGCTTGAGGGGAGCTGG + Intronic
916420541 1:164634019-164634041 CGGCTGTGCCACAGCAGAGCTGG - Intronic
916517947 1:165537620-165537642 TGCCTGTGCTTTAGCAGAGCAGG - Intergenic
917011727 1:170481793-170481815 CTGCTGTACCTGGACAGAGCAGG - Intergenic
917592577 1:176491945-176491967 CTGCTGTGTTTGACAAGTGCAGG - Intronic
918417031 1:184320748-184320770 CAGCTGTCCATGAGGAGAGCTGG + Intergenic
920736984 1:208541743-208541765 AGGCTGTGCCTGAGCAAAGCTGG + Intergenic
920869795 1:209784521-209784543 CTGCGGGACTGGAGCAGAGCGGG - Exonic
922153027 1:223021276-223021298 CTGATGGCCGTGAGCAGAGCTGG + Intergenic
922501017 1:226096966-226096988 AGGCTGGGGTTGAGCAGAGCAGG - Intergenic
923013379 1:230106750-230106772 CTGGTGAGCTTGGGCAGTGCTGG + Intronic
923535939 1:234851903-234851925 CTGCTTTGCTTGCACAGAGAAGG + Intergenic
1063339759 10:5252309-5252331 CTCCTGGGCTACAGCAGAGCAGG - Intergenic
1063343968 10:5294341-5294363 CTCCTGGGCTACAGCAGAGCAGG + Intergenic
1064059784 10:12128303-12128325 CTGCTGTACTTGAGGTCAGCTGG - Intergenic
1064873461 10:19965671-19965693 CTGCTGTGCTCCTGCAGACCGGG - Intronic
1065636398 10:27740685-27740707 CTGCTGGGCTTAAGGAGAGGAGG - Intronic
1065796485 10:29312792-29312814 CTGTTCTGCTGGGGCAGAGCTGG + Intronic
1066324223 10:34340041-34340063 CTGCTGTGATTCAGAACAGCTGG + Intronic
1069598665 10:69689036-69689058 CAGCAGAGTTTGAGCAGAGCTGG - Intronic
1070240520 10:74675632-74675654 CTGCTGTGCTTTGTCACAGCAGG + Intronic
1070607980 10:77912802-77912824 TTGCTTTGCGTGAGCTGAGCTGG - Intronic
1072894930 10:99358690-99358712 CTGCTGTGCTTGCCCGGACCAGG + Intronic
1073458007 10:103649286-103649308 ATGCTGTGGATGAGCAAAGCCGG + Intronic
1074030921 10:109687315-109687337 CTGCTGTGCTAGCAAAGAGCAGG + Intergenic
1074289423 10:112127245-112127267 CAGCTGGGCATGAGCTGAGCAGG + Intergenic
1074292824 10:112153361-112153383 CTGCTGTGTTGATGCAGAGCTGG + Exonic
1075583473 10:123640035-123640057 CTGCTGTGCTTATGCAGACTGGG + Intergenic
1076472268 10:130727518-130727540 CTGCTGTGTTGGCCCAGAGCAGG + Intergenic
1076555552 10:131318977-131318999 CTGCTGTGCCTGCTCTGAGCAGG + Intergenic
1077366960 11:2165147-2165169 CTTCTGGCCTTGAGCAGGGCTGG - Intronic
1078012106 11:7580321-7580343 CTCCTGTGCTTCAGCTGAGGTGG + Intronic
1078757550 11:14225085-14225107 CTGCTGTGAGTGAGCAGACCTGG - Intronic
1080070150 11:28073293-28073315 CTGCTGAGTTTGACCAGAGCAGG - Intronic
1081906530 11:46673838-46673860 CAGCTGTGCTTCAGTGGAGCAGG + Intronic
1082697906 11:56392848-56392870 CTGCATTTCTTAAGCAGAGCAGG - Intergenic
1083289903 11:61684020-61684042 CTGCTGTGCTTTAGGGGTGCCGG + Intronic
1083733067 11:64663586-64663608 CTGCAGTGGGTGGGCAGAGCAGG - Intronic
1084766139 11:71309784-71309806 CTGCTGTGATTGGTCAGTGCAGG + Intergenic
1090359106 11:126160430-126160452 CTGCTGTGTTTGTGCAGGGGTGG + Intergenic
1090714775 11:129420692-129420714 CTGAGATGATTGAGCAGAGCTGG + Intronic
1091186481 11:133652214-133652236 CTCCTTTGCCTGAGCAGCGCTGG - Intergenic
1091451557 12:575429-575451 CTGTAGTCCTGGAGCAGAGCAGG - Intronic
1092841259 12:12543292-12543314 CTGATGTGCTTGAGGATAGTGGG + Intronic
1096608833 12:52787874-52787896 CAGCTGTGCTTTAGAAAAGCAGG - Intergenic
1098230905 12:68370881-68370903 CTGCTGTGCCTGGGCACTGCAGG - Intergenic
1100061439 12:90581378-90581400 CTGTTGCACTTGAGAAGAGCTGG - Intergenic
1101926776 12:108978393-108978415 GATCTGTGCTTGAGGAGAGCTGG - Intronic
1103613031 12:122135572-122135594 GCGCTGTGCTTGGGAAGAGCCGG - Exonic
1104043679 12:125146511-125146533 CTGCTTTGCTTGAGCTGGGATGG + Intergenic
1106546845 13:30738205-30738227 TTTCTGTGATTGGGCAGAGCTGG + Intronic
1106826100 13:33522283-33522305 GTGCTGTGCATGAGTGGAGCAGG - Intergenic
1107401071 13:40069761-40069783 CTGCTGTCCTTGATAATAGCAGG - Intergenic
1110162305 13:72393114-72393136 CAGCTGTGGTGGAGCAGAGATGG - Intergenic
1110645133 13:77873849-77873871 CTGCTGTGCTTGAGTAGAAGTGG + Intergenic
1113036591 13:106056576-106056598 CTGCTGTGTTTGAACAGTGCAGG + Intergenic
1113809566 13:113130083-113130105 CTGCTGTGCAGGAGCAGTACTGG - Intronic
1115912517 14:38272210-38272232 GTGTTGGGATTGAGCAGAGCAGG - Intergenic
1116997294 14:51336942-51336964 CTACTTTGTTTCAGCAGAGCTGG - Intergenic
1121610339 14:95274387-95274409 CTGCTGTGCATGGGCAGGGGTGG - Intronic
1122027127 14:98886188-98886210 CTGCAGTGCATGGGCAGAGCAGG - Intergenic
1123974821 15:25543325-25543347 CTGCACTGCTTGATCAGAGATGG + Intergenic
1124631956 15:31343065-31343087 CTCCTGTGCTTGGGGAGAGGAGG + Intronic
1125033822 15:35100326-35100348 CTGTTGATCTTGAACAGAGCAGG + Intergenic
1127190485 15:56525407-56525429 CTGATGTGCATGTCCAGAGCTGG + Intergenic
1127203652 15:56688089-56688111 CTGCTGTGTTTGTGTAGAGATGG - Intronic
1129272176 15:74424825-74424847 CTGCTGGGCTGGAGAACAGCTGG - Intronic
1130323411 15:82858841-82858863 CTGATGTGGTTGGCCAGAGCAGG + Intronic
1133762760 16:8813205-8813227 CTGCTCAGTTTGAGCAGGGCGGG - Intronic
1134686002 16:16159248-16159270 CTTCTGAGCTTGAGGAAAGCAGG - Intronic
1135226943 16:20669000-20669022 CTGCAGTGGTTGTGCAGAGCGGG + Intronic
1135232412 16:20721530-20721552 CTGTAGTGCTGGAGCAGAGTAGG + Intronic
1135632197 16:24045255-24045277 GTTCTCAGCTTGAGCAGAGCTGG + Intronic
1140450694 16:75068664-75068686 CTGCAGTGGATGAGCAGGGCTGG + Intronic
1141240607 16:82261966-82261988 CTTCTGTGCTAGAGAAGAGAGGG + Intergenic
1141441772 16:84033870-84033892 CTGCTGTGCATGAGCATTGTAGG + Intronic
1142010352 16:87710820-87710842 CTGCTGTGCCTGTGCTGGGCTGG + Intronic
1142698052 17:1644304-1644326 CTGCTGGGCTGGAGGAGAGCTGG + Intronic
1143620275 17:8076468-8076490 CTGGTGTGCTGGCCCAGAGCAGG - Intronic
1146590346 17:34123274-34123296 CTGCTGAGATCAAGCAGAGCTGG + Intronic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1147120227 17:38331251-38331273 CTGCGGGACTTGTGCAGAGCTGG + Exonic
1148018751 17:44540024-44540046 CTGCTTTACATGAGAAGAGCGGG - Intergenic
1148891526 17:50811075-50811097 GTGCTGTGCTTGCCCAGTGCGGG - Intergenic
1150270715 17:63862708-63862730 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150274344 17:63886229-63886251 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150276487 17:63901057-63901079 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1151315432 17:73318989-73319011 CGGCTGTTCTCCAGCAGAGCTGG - Intergenic
1151509241 17:74548113-74548135 CTGCTGTGCAGGAGCTGAGGGGG - Intergenic
1152224414 17:79086035-79086057 CAGCTGAGCTGGAGCAGAGCAGG - Exonic
1155577225 18:27260472-27260494 CTTCAGTGAGTGAGCAGAGCAGG + Intergenic
1156575085 18:38305495-38305517 CTGCTGTGTGTGAGCAGCTCTGG + Intergenic
1156759129 18:40565961-40565983 AAGCTGTTCTTGAGAAGAGCTGG - Intergenic
1156770656 18:40718657-40718679 CTGCTGTGCTTGGATAGAGATGG + Intergenic
1156816135 18:41313618-41313640 TTGCTATGCTTGAGCATAGGAGG + Intergenic
1157630813 18:49093387-49093409 CTTGTGTGCTGGATCAGAGCAGG + Intronic
1157823812 18:50794205-50794227 GTGCTGTGATTGCTCAGAGCGGG - Intergenic
1159388550 18:67758869-67758891 CTGCTATGTTGGAGCAGAGAAGG - Intergenic
1160201848 18:76802276-76802298 GGGCTGGGCTGGAGCAGAGCCGG + Intronic
1162522424 19:11189663-11189685 CTGCCTTGCTTGAGCCAAGCTGG - Intronic
1162573927 19:11487664-11487686 CTGCTGGGTTGGAGCACAGCGGG + Exonic
1162789866 19:13057256-13057278 CGGCTGTGCCTGTGCAGAGCGGG + Intronic
1163548617 19:17952914-17952936 CAGCTGGGCTGGGGCAGAGCAGG + Intronic
1166743505 19:45128861-45128883 CTGCTGTCCTGGAGCAGTGAGGG - Intronic
1167319815 19:48790119-48790141 CTGCTATCCATGAGCAGTGCTGG - Intergenic
1167795163 19:51704099-51704121 CCGCGGTGCGTGAGCTGAGCCGG - Intergenic
925493705 2:4423363-4423385 CTGCTGTGGCTGTGCAGAGTAGG - Intergenic
925706682 2:6691231-6691253 AAGCTGTTCTTGAGCAGAGGAGG - Intergenic
927442918 2:23132023-23132045 CTTCTCTGCTTGTGCAGGGCTGG + Intergenic
928793862 2:34992159-34992181 CTGCTGGGCTTGATCAGGGGAGG + Intergenic
932735215 2:74249641-74249663 CTGCTGTGCTGGGGAAGGGCAGG + Intronic
936266844 2:111017410-111017432 CTGCTGAGCTTGCGCAGAAATGG - Intronic
937996676 2:127699371-127699393 CTGCAGTGCTAGAGGAGAGTGGG + Intergenic
938068213 2:128293078-128293100 CTGGTGTGGCGGAGCAGAGCAGG - Intronic
938296229 2:130181395-130181417 CTGCCCTGCCTGGGCAGAGCCGG + Intronic
938344434 2:130557122-130557144 CTGTAGTGCGTGAGCAGAGGTGG + Intergenic
938345399 2:130563600-130563622 CTGTAGTGCGTGAGCAGAGGTGG - Intergenic
943094287 2:183410068-183410090 CAGCTTTGTTTGAGCAGAGCTGG + Intergenic
947502380 2:230680815-230680837 CTGTTGTCCTCGGGCAGAGCCGG - Intergenic
948385310 2:237577218-237577240 CTGCTGTGGAAGAGCAGAGCAGG + Intronic
948708751 2:239812240-239812262 CTACTGTGCTTCAGGAGAGCAGG + Intergenic
948836465 2:240628457-240628479 CTGCTGTACTTCACCAGAGGTGG + Intronic
1170831830 20:19849466-19849488 CTGCTGAGCAGGAGCAGAGTCGG - Intergenic
1171035980 20:21713432-21713454 TTGCTGTGGCTGCGCAGAGCTGG - Intronic
1171036564 20:21717000-21717022 CTTCTGTGTTTGAGCTGATCAGG + Intronic
1171189614 20:23149895-23149917 CTGCCCATCTTGAGCAGAGCCGG - Intergenic
1172662955 20:36579951-36579973 CTGCTTTCCTGGAGCAGAGGCGG + Intronic
1172929945 20:38579445-38579467 CTGTTGTGCGTGGGCAGAGCAGG - Intergenic
1173645396 20:44629954-44629976 CTTGTGAGCTGGAGCAGAGCCGG - Intronic
1174165388 20:48580313-48580335 CTGCAGGGCTTGAGCAGAGGAGG - Intergenic
1174690338 20:52497986-52498008 CAGCAATGCTTGAGAAGAGCAGG + Intergenic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1176067894 20:63208779-63208801 CTGCTGTGCCTGGGCAGCTCTGG - Intronic
1179470277 21:41605662-41605684 CGGCCGTGGGTGAGCAGAGCAGG + Intergenic
1181064910 22:20300923-20300945 CTGCTGTGCTTGTGCACACAAGG + Intergenic
1181581660 22:23832154-23832176 CTGGTGTGGATGTGCAGAGCCGG + Intronic
1184104374 22:42359072-42359094 CTTCAGAGCTTGAGCACAGCAGG + Intergenic
1184827948 22:46965843-46965865 CTCCTGTGCCTCAGCAGTGCTGG + Intronic
1185157401 22:49202411-49202433 CAGCTGGGCCTGAGCAGAGGTGG - Intergenic
1185186693 22:49405184-49405206 GGGCTGTGCTTGATCAGGGCAGG + Intergenic
1185404807 22:50641730-50641752 CTGCTGACCTTGTGGAGAGCAGG + Intergenic
951208676 3:19950165-19950187 ATGGTGTGCTTGAGCAGATGAGG + Intronic
952277355 3:31890320-31890342 CTGCTGTGATTTAGGAAAGCTGG - Intronic
953559894 3:43979443-43979465 CTGCTGTCCGTAATCAGAGCAGG - Intergenic
956678156 3:71754131-71754153 CTGCTGTGCGTGAGCCTAGCGGG + Exonic
957383721 3:79468024-79468046 CTACTGTGCTTAAGCACAGGTGG + Intronic
957413345 3:79868688-79868710 TTGCTGTGCTTCAGCTGTGCTGG + Intergenic
957919864 3:86733306-86733328 CTGCTGGGCTTGATCAGGGGAGG - Intergenic
963565777 3:146928484-146928506 CTGTGGTTCTTGAGCAGAGCAGG + Intergenic
964730718 3:159861540-159861562 CCGCTGTGCCTGAGCAGATGAGG - Intronic
966808479 3:183824606-183824628 CGGCTGTCCAGGAGCAGAGCTGG + Intronic
967786082 3:193497989-193498011 CTGTTGTTCTTTTGCAGAGCAGG + Intronic
967884160 3:194322032-194322054 CTGCTGGGGTTGACCAGGGCAGG + Intergenic
968093970 3:195915092-195915114 TTGCTGTGATTGGGCAGAGGGGG - Intergenic
969192330 4:5532332-5532354 TTGGTGGACTTGAGCAGAGCAGG - Intergenic
969870950 4:10104448-10104470 GTGCTGTGCAGGAGCAGAGCAGG + Intronic
971235857 4:24841772-24841794 CTGCTGTGTTTTTGCAGAGAAGG - Intronic
972643839 4:40949327-40949349 CTGCTGTGGTTGAAAAGATCAGG - Intronic
972933644 4:44104857-44104879 CTGTTGTACTTGAACAGAGCAGG - Intergenic
975640394 4:76494484-76494506 CTGCTGAGCTTGAGCAATGGCGG + Intronic
977293340 4:95186882-95186904 CTGCTGTGCCTGAGCTCAGCAGG + Intronic
977644806 4:99400809-99400831 ATGCTGTGATTGAACAGAGTTGG - Intergenic
983367588 4:166814467-166814489 CTGCTTTGTTCTAGCAGAGCTGG - Intronic
984597120 4:181682788-181682810 ATGCAGTGCTTGAGCTGAGGTGG + Intergenic
986269547 5:6218731-6218753 CTGCTGTGCTGGAGTGGAGGAGG + Intergenic
986289206 5:6385312-6385334 CTGCTGGTCTTGAGCAGAGAAGG - Intergenic
986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG + Intergenic
988335263 5:29899592-29899614 CTGCTTTGCACTAGCAGAGCTGG - Intergenic
989815240 5:45728809-45728831 CTGCTGTGCTAGATCAAATCCGG + Intergenic
991028116 5:62052488-62052510 CTGTTGGACTTGAACAGAGCAGG - Intergenic
993192193 5:84696628-84696650 CTGCTGTACTGCAGCTGAGCTGG - Intergenic
996794699 5:127332458-127332480 CTGCTGTGCTTGAGAGGCTCTGG - Intronic
997717571 5:136053389-136053411 CTGCTGTGCATGGGCAAAGAGGG + Intronic
998001684 5:138630777-138630799 CTGCTGTGGCTGAGAAGAGCTGG + Intronic
1000589119 5:163136888-163136910 CTGCTTTGCCTGCACAGAGCAGG + Intergenic
1001965731 5:175908645-175908667 CTGCTGTGCTGGGGCAGGGCTGG + Intergenic
1002251214 5:177930551-177930573 CTGCTGTGCTGGGGCAGGGCTGG - Intergenic
1002596747 5:180328668-180328690 GTGCTGTCCCTGAGCAGGGCAGG - Intronic
1002961083 6:1915399-1915421 GTGCTGAGCCTGAGCAGGGCAGG + Intronic
1003025168 6:2548300-2548322 CTGCTGTGCTTCCACATAGCTGG + Intergenic
1003174951 6:3747359-3747381 CTGCTGTGCTGGGAAAGAGCAGG - Intronic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004046828 6:12033505-12033527 CCGCTGAGGTTGAGCAGAGTGGG - Intronic
1004224246 6:13771689-13771711 CTGCTTTGCTGGAGAAGAGTAGG + Intergenic
1007446666 6:41911730-41911752 CTGCTGTGCGTGAACACAGCAGG + Intronic
1007860007 6:44898703-44898725 CTGGTGTGCTTGTGCACACCTGG + Intronic
1008085733 6:47242246-47242268 ATTCTGTGCTTGAACAGATCTGG - Intronic
1008857998 6:56114029-56114051 CTGTTGTGTTGCAGCAGAGCTGG - Intronic
1009621687 6:66085487-66085509 CTACTGGGCATGAACAGAGCAGG - Intergenic
1010869266 6:81017812-81017834 CTGCTGTGCTAGCAAAGAGCTGG + Intergenic
1013247289 6:108298904-108298926 CTGCTGTGGTGAAGGAGAGCAGG + Intronic
1015334880 6:132025628-132025650 CTGCTTTTCATGAGCAGGGCAGG + Intergenic
1016166874 6:140956894-140956916 CTGGTGGGCCTGATCAGAGCAGG + Intergenic
1016363460 6:143291736-143291758 CTGCTTTCCTTGAACACAGCAGG - Intronic
1017114336 6:150962838-150962860 CTGTTGTGCTAATGCAGAGCAGG - Intronic
1017720262 6:157238803-157238825 CTGATTTGCCTGAGCACAGCAGG - Intergenic
1017989692 6:159475405-159475427 TTGCTGTGATGGAGCAGAACTGG - Intergenic
1018065635 6:160123449-160123471 CTGCTTGCCTGGAGCAGAGCAGG + Intronic
1018535893 6:164818585-164818607 CTGCTGTACTGCAGCTGAGCTGG - Intergenic
1019079884 6:169423268-169423290 CTGCTCTGAGTGAGCCGAGCTGG - Intergenic
1019166942 6:170103337-170103359 CTGCTGTGCTTCTGCGGAGCTGG - Intergenic
1020769674 7:12373432-12373454 CTGCTCTCCTTGAGCAGGGCAGG + Intronic
1021579589 7:22138954-22138976 CTTGTTTGCTTAAGCAGAGCAGG + Intronic
1023674911 7:42618834-42618856 CTGCTGTGCTTGAGTGCAGGAGG + Intergenic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1026373061 7:69721201-69721223 CTGCAGTACTTGAGCAGATCAGG - Intronic
1029274186 7:99394355-99394377 CTGCTGTGCTGGGGCTGAGATGG + Intronic
1032794607 7:135267760-135267782 TGGCTGTGCTGGGGCAGAGCTGG + Intergenic
1034924266 7:155108326-155108348 ATGCTGTGTCTGAGCAGAGAAGG + Intergenic
1035632514 8:1119513-1119535 CTGCTCTTCTTCAGCAGATCGGG + Intergenic
1039607643 8:38895627-38895649 CAGCTGTGGTTGAGAAGGGCAGG - Intergenic
1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG + Intergenic
1047745347 8:127840674-127840696 TAGCTGTGCTTCCGCAGAGCTGG + Intergenic
1047788962 8:128182795-128182817 CAGCTGTGTTTCAGCAGAGAGGG + Intergenic
1048871719 8:138804429-138804451 CTGCTGTGCTTGAGCAGAGCAGG - Intronic
1049234776 8:141507051-141507073 CTGCTGGGGTTGAGCTGACCTGG + Intergenic
1049317705 8:141978104-141978126 GTGCTGTTCTTGAGCAGGCCTGG - Intergenic
1049399504 8:142418660-142418682 CTGCAGGGCTTGAGAGGAGCTGG - Intergenic
1049621179 8:143598980-143599002 CAGCTGGGCTTGGGCAGGGCGGG - Exonic
1049661236 8:143820534-143820556 CTGCTGCGCTCGTCCAGAGCTGG + Intronic
1049920878 9:363005-363027 CTGCTGTAATTGAGCAGCTCTGG - Intronic
1050787703 9:9426299-9426321 CTGCTGTGCTAGCACTGAGCAGG - Intronic
1053288801 9:36866615-36866637 CTCCTGTCCTTGTGCAGAACTGG - Intronic
1053840339 9:42184953-42184975 CGGCTGGGCTGGAGCAGAGAGGG + Intronic
1056463275 9:86828615-86828637 CTGCTGTGGTTGAGCATGGAAGG + Intergenic
1057314168 9:93958384-93958406 CGGCAGTGCCTGAGCAGAGGAGG - Intergenic
1058998282 9:110321246-110321268 TTACTGTGTTTGAGCAGAGGAGG + Intronic
1059819031 9:117951246-117951268 ATAATGTGCTTTAGCAGAGCGGG - Intergenic
1060979509 9:127784590-127784612 AGGCTGTCCTTGGGCAGAGCTGG + Intergenic
1062047800 9:134432459-134432481 CCCCTGTGGTTGAGGAGAGCAGG + Intronic
1062187361 9:135225045-135225067 CTGCGGGGCTAGAGCAGGGCCGG - Intergenic
1062289633 9:135788754-135788776 CGGCTCTGCTCGAGCCGAGCAGG - Intronic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1062555116 9:137110333-137110355 CTGCTGCGGCTCAGCAGAGCGGG + Intergenic
1186039779 X:5463099-5463121 ATCCTGTGCTTTAGGAGAGCTGG + Intergenic
1188977274 X:36690722-36690744 TTGGTGTGATTGAGGAGAGCAGG - Intergenic
1190911273 X:54774668-54774690 CTGCTGTTGCTGGGCAGAGCAGG + Intronic
1190919944 X:54841542-54841564 CTGCTGTTGCTGGGCAGAGCAGG - Intergenic
1193392850 X:80949336-80949358 CTGCTGGACTTGAACAAAGCAGG - Intergenic
1193487285 X:82102433-82102455 CTGTTGTACTTCAGCTGAGCTGG + Intergenic
1195195701 X:102496222-102496244 CTGCTTTGCTTGCACACAGCAGG + Intergenic
1195740614 X:108061408-108061430 GTGCTGTGTTTGAGCAGAAATGG - Exonic
1198788243 X:140314199-140314221 CTGCTGTACTGCAGCTGAGCTGG - Intergenic
1201800657 Y:17951488-17951510 CTCCAGTGCTTCAGCAGACCTGG - Intergenic
1202094151 Y:21227537-21227559 CTGTTGTGGCTGAGCTGAGCTGG + Intergenic