ID: 1048871994

View in Genome Browser
Species Human (GRCh38)
Location 8:138806829-138806851
Sequence CAGTGGAACAGGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048871988_1048871994 25 Left 1048871988 8:138806781-138806803 CCCACTCAAGCCTGACACACAGC 0: 1
1: 0
2: 1
3: 19
4: 247
Right 1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG No data
1048871990_1048871994 15 Left 1048871990 8:138806791-138806813 CCTGACACACAGCAGATGCAGTC 0: 1
1: 0
2: 3
3: 19
4: 254
Right 1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG No data
1048871989_1048871994 24 Left 1048871989 8:138806782-138806804 CCACTCAAGCCTGACACACAGCA 0: 1
1: 0
2: 0
3: 34
4: 271
Right 1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048871994 Original CRISPR CAGTGGAACAGGATGGAAGA TGG Intronic
No off target data available for this crispr