ID: 1048872773

View in Genome Browser
Species Human (GRCh38)
Location 8:138812757-138812779
Sequence CAAGCCATGCAGGTTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048872773_1048872788 29 Left 1048872773 8:138812757-138812779 CCTGGAGGAACCTGCATGGCTTG 0: 1
1: 0
2: 0
3: 21
4: 189
Right 1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1048872773_1048872787 26 Left 1048872773 8:138812757-138812779 CCTGGAGGAACCTGCATGGCTTG 0: 1
1: 0
2: 0
3: 21
4: 189
Right 1048872787 8:138812806-138812828 CCTCTCAGGCCATATTCTGATGG 0: 1
1: 0
2: 2
3: 16
4: 135
1048872773_1048872782 12 Left 1048872773 8:138812757-138812779 CCTGGAGGAACCTGCATGGCTTG 0: 1
1: 0
2: 0
3: 21
4: 189
Right 1048872782 8:138812792-138812814 CATACCCTAAGCTCCCTCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048872773 Original CRISPR CAAGCCATGCAGGTTCCTCC AGG (reversed) Intronic