ID: 1048872782

View in Genome Browser
Species Human (GRCh38)
Location 8:138812792-138812814
Sequence CATACCCTAAGCTCCCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048872772_1048872782 13 Left 1048872772 8:138812756-138812778 CCCTGGAGGAACCTGCATGGCTT 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1048872782 8:138812792-138812814 CATACCCTAAGCTCCCTCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 111
1048872775_1048872782 2 Left 1048872775 8:138812767-138812789 CCTGCATGGCTTGGCTCCCCCAG 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1048872782 8:138812792-138812814 CATACCCTAAGCTCCCTCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 111
1048872770_1048872782 22 Left 1048872770 8:138812747-138812769 CCACAGTAGCCCTGGAGGAACCT 0: 1
1: 0
2: 0
3: 22
4: 173
Right 1048872782 8:138812792-138812814 CATACCCTAAGCTCCCTCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 111
1048872773_1048872782 12 Left 1048872773 8:138812757-138812779 CCTGGAGGAACCTGCATGGCTTG 0: 1
1: 0
2: 0
3: 21
4: 189
Right 1048872782 8:138812792-138812814 CATACCCTAAGCTCCCTCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048872782 Original CRISPR CATACCCTAAGCTCCCTCTC AGG Intronic