ID: 1048872787

View in Genome Browser
Species Human (GRCh38)
Location 8:138812806-138812828
Sequence CCTCTCAGGCCATATTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 135}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048872780_1048872787 -7 Left 1048872780 8:138812790-138812812 CCCATACCCTAAGCTCCCTCTCA 0: 1
1: 0
2: 1
3: 20
4: 220
Right 1048872787 8:138812806-138812828 CCTCTCAGGCCATATTCTGATGG 0: 1
1: 0
2: 2
3: 16
4: 135
1048872776_1048872787 0 Left 1048872776 8:138812783-138812805 CCCCCAGCCCATACCCTAAGCTC 0: 1
1: 0
2: 0
3: 21
4: 211
Right 1048872787 8:138812806-138812828 CCTCTCAGGCCATATTCTGATGG 0: 1
1: 0
2: 2
3: 16
4: 135
1048872781_1048872787 -8 Left 1048872781 8:138812791-138812813 CCATACCCTAAGCTCCCTCTCAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1048872787 8:138812806-138812828 CCTCTCAGGCCATATTCTGATGG 0: 1
1: 0
2: 2
3: 16
4: 135
1048872775_1048872787 16 Left 1048872775 8:138812767-138812789 CCTGCATGGCTTGGCTCCCCCAG 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1048872787 8:138812806-138812828 CCTCTCAGGCCATATTCTGATGG 0: 1
1: 0
2: 2
3: 16
4: 135
1048872778_1048872787 -2 Left 1048872778 8:138812785-138812807 CCCAGCCCATACCCTAAGCTCCC 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1048872787 8:138812806-138812828 CCTCTCAGGCCATATTCTGATGG 0: 1
1: 0
2: 2
3: 16
4: 135
1048872777_1048872787 -1 Left 1048872777 8:138812784-138812806 CCCCAGCCCATACCCTAAGCTCC 0: 1
1: 0
2: 3
3: 22
4: 294
Right 1048872787 8:138812806-138812828 CCTCTCAGGCCATATTCTGATGG 0: 1
1: 0
2: 2
3: 16
4: 135
1048872779_1048872787 -3 Left 1048872779 8:138812786-138812808 CCAGCCCATACCCTAAGCTCCCT 0: 1
1: 0
2: 0
3: 16
4: 228
Right 1048872787 8:138812806-138812828 CCTCTCAGGCCATATTCTGATGG 0: 1
1: 0
2: 2
3: 16
4: 135
1048872772_1048872787 27 Left 1048872772 8:138812756-138812778 CCCTGGAGGAACCTGCATGGCTT 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1048872787 8:138812806-138812828 CCTCTCAGGCCATATTCTGATGG 0: 1
1: 0
2: 2
3: 16
4: 135
1048872773_1048872787 26 Left 1048872773 8:138812757-138812779 CCTGGAGGAACCTGCATGGCTTG 0: 1
1: 0
2: 0
3: 21
4: 189
Right 1048872787 8:138812806-138812828 CCTCTCAGGCCATATTCTGATGG 0: 1
1: 0
2: 2
3: 16
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048872787 Original CRISPR CCTCTCAGGCCATATTCTGA TGG Intronic