ID: 1048872788

View in Genome Browser
Species Human (GRCh38)
Location 8:138812809-138812831
Sequence CTCAGGCCATATTCTGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048872772_1048872788 30 Left 1048872772 8:138812756-138812778 CCCTGGAGGAACCTGCATGGCTT 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1048872775_1048872788 19 Left 1048872775 8:138812767-138812789 CCTGCATGGCTTGGCTCCCCCAG 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1048872776_1048872788 3 Left 1048872776 8:138812783-138812805 CCCCCAGCCCATACCCTAAGCTC 0: 1
1: 0
2: 0
3: 21
4: 211
Right 1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1048872783_1048872788 -10 Left 1048872783 8:138812796-138812818 CCCTAAGCTCCCTCTCAGGCCAT 0: 1
1: 1
2: 0
3: 16
4: 180
Right 1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1048872778_1048872788 1 Left 1048872778 8:138812785-138812807 CCCAGCCCATACCCTAAGCTCCC 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1048872779_1048872788 0 Left 1048872779 8:138812786-138812808 CCAGCCCATACCCTAAGCTCCCT 0: 1
1: 0
2: 0
3: 16
4: 228
Right 1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1048872780_1048872788 -4 Left 1048872780 8:138812790-138812812 CCCATACCCTAAGCTCCCTCTCA 0: 1
1: 0
2: 1
3: 20
4: 220
Right 1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1048872773_1048872788 29 Left 1048872773 8:138812757-138812779 CCTGGAGGAACCTGCATGGCTTG 0: 1
1: 0
2: 0
3: 21
4: 189
Right 1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1048872777_1048872788 2 Left 1048872777 8:138812784-138812806 CCCCAGCCCATACCCTAAGCTCC 0: 1
1: 0
2: 3
3: 22
4: 294
Right 1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1048872781_1048872788 -5 Left 1048872781 8:138812791-138812813 CCATACCCTAAGCTCCCTCTCAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG 0: 1
1: 0
2: 0
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048872788 Original CRISPR CTCAGGCCATATTCTGATGG TGG Intronic
904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG + Intergenic
904823342 1:33258733-33258755 CTCAGGAAAGATTATGATGGCGG - Intronic
910750221 1:90621144-90621166 CTCAGGGCATATTCAGAGAGTGG - Intergenic
912746046 1:112246247-112246269 CTCAGGACATCTCCTGAAGGAGG + Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
917229227 1:172818105-172818127 CTCAGGCCTTATTATGATATGGG - Intergenic
918296257 1:183160204-183160226 CTCTGGCCATGTTCTGGAGGCGG - Intergenic
918823170 1:189285703-189285725 CACAGACCATATTCTGAAGATGG + Intergenic
920665536 1:207960110-207960132 TACAGGCCATATTCTGCTGATGG + Intergenic
921082272 1:211751465-211751487 GTCAGGCAATATTCTTTTGGTGG + Intronic
1063182467 10:3617162-3617184 CTCCCTCCATATTCTGATGCTGG + Intergenic
1068550231 10:58399735-58399757 ATCAGGCAATATTTAGATGGGGG + Intergenic
1069855063 10:71435688-71435710 CTCAGGCCGCATCCTGAAGGTGG + Intronic
1070300886 10:75202744-75202766 TTCAGTCCATCTTCTGAAGGAGG - Intergenic
1073562446 10:104508299-104508321 CTCAGGCAACATTCTGATTCAGG - Intergenic
1076010654 10:126985536-126985558 CTGAGGCCCTATTCACATGGTGG + Intronic
1076719402 10:132386686-132386708 CTCAGCCCATCTTCTGAACGTGG + Intergenic
1077417557 11:2431873-2431895 CTCAGGCCATAGTCTCATGCAGG - Intergenic
1078532151 11:12145027-12145049 CTCAGCCCACATCCTGATGAAGG + Intronic
1080241364 11:30130481-30130503 AACAGGCCAGATTCTGATGAGGG + Intergenic
1084907716 11:72361068-72361090 CTCAGGCCATTTTCTGTTAAGGG - Intronic
1086901112 11:92368688-92368710 CTCAGGTTATATTCATATGGTGG + Intronic
1087770465 11:102204011-102204033 CTAAGGCATTATTCTGAGGGAGG + Intronic
1088227430 11:107636855-107636877 TTCTGGCCATTTTCTGATGGAGG + Intronic
1088237758 11:107743337-107743359 CTCAGGCCACAGTCTGACTGAGG - Intergenic
1088583525 11:111337152-111337174 CTCTGGCCATATTGGGTTGGCGG + Intergenic
1089489959 11:118876734-118876756 CAGAGGCGAGATTCTGATGGAGG - Intergenic
1090406101 11:126476542-126476564 ATCAGGCCCCATTCTGAGGGTGG - Intronic
1091153394 11:133350542-133350564 CTCAGCTCATATTTTGGTGGGGG - Intronic
1091753215 12:3035426-3035448 CTCAGGACATATTCTGTAGCTGG - Intronic
1092783473 12:12007976-12007998 TTCGGGCCTTATTCTAATGGTGG - Intergenic
1100484174 12:95008823-95008845 CCCAGGCCACAGTGTGATGGTGG - Intergenic
1101027094 12:100620470-100620492 CTCATGCCTTGTTCTGATTGTGG + Intronic
1101711183 12:107268259-107268281 ATAAGGGTATATTCTGATGGGGG - Intergenic
1102836556 12:116067451-116067473 TTCATCCTATATTCTGATGGGGG - Intronic
1106124162 13:26886487-26886509 CTCAAGACACATTCTGATGCAGG - Intergenic
1106469330 13:30040441-30040463 CCCAAGCCATTTTCTGAGGGAGG + Intergenic
1111041087 13:82749034-82749056 CTCAGCCCAGATTCTGATATGGG + Intergenic
1111536540 13:89608856-89608878 ATCAGCACATATTCAGATGGGGG - Intergenic
1112217247 13:97445747-97445769 CTCAGGACAAATGCTGCTGGTGG - Intronic
1114438594 14:22728376-22728398 GTCAGACCATAATCTGATGGTGG - Intergenic
1116049785 14:39788775-39788797 CTCAGACTATATTATGATAGAGG + Intergenic
1117578117 14:57122004-57122026 CACAGACCAAATTCTGATAGAGG + Intergenic
1118275861 14:64385911-64385933 CTCAGCTCATATTCTGGTGGAGG - Intergenic
1121908394 14:97767767-97767789 CTTAGCCCAGATTCTGATGCAGG + Intergenic
1125039731 15:35171277-35171299 CACAGGTCGTATCCTGATGGTGG - Intergenic
1125177721 15:36844507-36844529 GTCAGGCAATGTTCTGGTGGGGG - Intergenic
1125970330 15:43906270-43906292 CCCAGACCATCTTCTCATGGCGG - Intronic
1126226963 15:46282007-46282029 CTCAGGGCTTACTCTAATGGGGG + Intergenic
1127856626 15:62958848-62958870 CTCATGCTAGATTCTGCTGGGGG - Intergenic
1128075789 15:64824544-64824566 CCCAGGGCATATTCTAAGGGTGG - Intronic
1129265190 15:74389548-74389570 CTCAGGGCATATTCTTAGAGAGG - Intergenic
1129795011 15:78369441-78369463 CCCAGGCCACATTCAGATGCAGG + Intergenic
1131757940 15:95586290-95586312 CTCAAGTCGTATTCTGATGCAGG + Intergenic
1132072187 15:98788005-98788027 CTCAGGCCACGTTCCTATGGTGG + Intronic
1134907208 16:17990159-17990181 CTCATTACATATTCTGAAGGTGG - Intergenic
1136748057 16:32609614-32609636 CTCAGGTCAGATTAGGATGGAGG + Intergenic
1138451383 16:57095118-57095140 CTGAGGCCATATTCTGCAAGGGG - Intronic
1203050194 16_KI270728v1_random:868821-868843 CTCAGGTCAGATTAGGATGGAGG + Intergenic
1143314360 17:6020877-6020899 GTCAGGCAATATTCTCATGATGG + Intronic
1143875611 17:9988407-9988429 ATCAGGCCACATTCTCCTGGAGG + Intronic
1147604383 17:41765923-41765945 CTCAGGCTTTATTCTGAGGGAGG - Intronic
1148702659 17:49599047-49599069 CACAGTCCATATCCTGATGAGGG - Exonic
1152712217 17:81877720-81877742 CTCTGTCCAGATTCTGATGTGGG - Intergenic
1158885108 18:61819663-61819685 TTCAGGCCATATTCCACTGGAGG + Intronic
1159018068 18:63118575-63118597 CTCATGCCATAATCTAATGTAGG - Intergenic
1159259750 18:65998382-65998404 CTCATGCCACAATCTAATGGGGG - Intergenic
1165959169 19:39520187-39520209 GTCAGGTCCTTTTCTGATGGTGG + Exonic
926454743 2:13052771-13052793 CTCAGCTCATACTCTGAAGGAGG + Intergenic
928401047 2:30979044-30979066 CACAGGCCATGGCCTGATGGGGG + Intronic
929421212 2:41791806-41791828 CTCATGCCATATAGTCATGGGGG + Intergenic
930922174 2:56769310-56769332 CCCAGGCCATGTTCTGAGGTTGG + Intergenic
933596522 2:84288667-84288689 CTCAGGCAACATCCTGAGGGTGG - Intergenic
935939423 2:108222603-108222625 CTCAGGGCATATTGAGTTGGAGG - Intergenic
936748541 2:115611682-115611704 CTGAAGCCATATCATGATGGGGG + Intronic
939994479 2:148907295-148907317 CACAGGCCATATCCTCAAGGAGG - Intronic
942547862 2:177083471-177083493 CTCAAGACAAATTGTGATGGAGG + Intergenic
943691230 2:190871628-190871650 CTCAGGCCATTTTCTGCTGCTGG + Intergenic
947463708 2:230323786-230323808 CTCCGGCCACCTTCTGAAGGTGG - Intergenic
947472552 2:230412349-230412371 CTCTGGCCACCTTCTGAAGGTGG - Intergenic
948538016 2:238661513-238661535 TTCAGGAGATATTCTAATGGGGG - Intergenic
1169651101 20:7868289-7868311 ATCAGGCCTTATTCTGGTGAGGG - Intergenic
1171961624 20:31498759-31498781 CTCTGGCAGTCTTCTGATGGTGG - Intergenic
1175499165 20:59437380-59437402 CTCAGGGCATCTTCTCTTGGTGG - Intergenic
1178682711 21:34686539-34686561 GTCAGGCCAGATTCAGAGGGAGG - Intronic
1182624182 22:31634027-31634049 CTCAGGCCACCTGCAGATGGAGG + Intronic
950006862 3:9697029-9697051 CTCAGGCCTTCTTCAGATGGAGG - Intronic
953858419 3:46520644-46520666 CGCATGCCATTTTCTGAGGGTGG + Intronic
955795912 3:62636860-62636882 CAGAGGACATATTCTGAGGGTGG - Intronic
965945099 3:174231584-174231606 CTCAGGCCATATTTAGTTTGCGG + Intronic
966694695 3:182777847-182777869 CTCAGTCCACATTCCCATGGTGG - Intergenic
967222457 3:187258880-187258902 CTCTGAACATATTCTGGTGGTGG + Intronic
970420928 4:15905253-15905275 ATCATGGAATATTCTGATGGCGG + Intergenic
972799087 4:42453863-42453885 CAGAGGCCATAGTCTGATTGTGG + Intronic
977510372 4:97954330-97954352 CTCAGGGCATTTTCTGATAAAGG + Intronic
977994038 4:103481443-103481465 CTCAGGGCATGCTCTGATGAGGG + Intergenic
979208947 4:118077184-118077206 CACTGGCCACACTCTGATGGGGG + Intronic
979619656 4:122784572-122784594 CTCTGAACATATTCTGATGTGGG + Intergenic
979846091 4:125514035-125514057 TTCGGGCTATATTCTGATGCAGG + Intergenic
980401938 4:132300702-132300724 TTCTGGTCATATTCTGGTGGTGG + Intergenic
981854433 4:149271236-149271258 CCCTGGCCATATTCAGATGAGGG + Intergenic
982002673 4:151035590-151035612 GTCAAGCCAGTTTCTGATGGGGG + Intergenic
989745460 5:44824236-44824258 CTCAGGGGATATTGTTATGGTGG - Intergenic
996219715 5:120915732-120915754 CTGAGGTCATCTTCTGCTGGTGG + Intergenic
997588072 5:135055974-135055996 CTGAGGGCATCTTCTGATAGTGG + Intronic
997897161 5:137729424-137729446 CTCAGGTCAGATCCTCATGGTGG + Intronic
1001989968 5:176108289-176108311 CTCAGGTCATATTAGGAAGGAGG + Intronic
1002226902 5:177729849-177729871 CTCAGGTCATATTAGGAAGGAGG - Intronic
1003375143 6:5569765-5569787 GTCAGGGCATATTGTTATGGGGG + Intronic
1003898617 6:10632162-10632184 CCCAGGGCATAATGTGATGGAGG + Intergenic
1004301524 6:14462592-14462614 CTCATGACATATTCTTATGTGGG + Intergenic
1009283604 6:61782883-61782905 CTCAGGCCATATTCTTCTTATGG + Intronic
1012976246 6:105784055-105784077 CTCAGTGCAGATTCTGATGTGGG - Intergenic
1013842096 6:114408618-114408640 CTAATTCCATATTCTGATTGTGG - Intergenic
1016169548 6:140994253-140994275 CTTATGCCATAATTTGATGGTGG + Intergenic
1025142131 7:56475190-56475212 CTCAGGCCTGCTTCTGAGGGTGG + Intergenic
1025708278 7:63886618-63886640 CTCAGGCCTGCTTCTGAGGGTGG + Intergenic
1026907743 7:74072365-74072387 CTCTGGATATATTCTGAAGGTGG - Intergenic
1033635342 7:143206860-143206882 CTCAGGCCCTATACTAATGTGGG + Intergenic
1037555056 8:20014140-20014162 CACAGGCCATGTGCAGATGGAGG + Intergenic
1038230928 8:25699234-25699256 CTCAGGACTCAATCTGATGGAGG - Intergenic
1039844539 8:41316518-41316540 CTCAGGCCATCTTCTTGTAGCGG - Intergenic
1046777512 8:118179701-118179723 CTTAGGTCATATTCTGATTTAGG + Intergenic
1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG + Intronic
1052433280 9:28394259-28394281 GCCAGGCCTTTTTCTGATGGAGG + Intronic
1059920145 9:119151195-119151217 ATCTGGCCACATTCTGATAGAGG + Intergenic
1060331378 9:122674083-122674105 TTCAGGCCATCTTCTGATTAAGG - Intergenic
1186555183 X:10550529-10550551 CTCAGGGCATCTGCAGATGGCGG + Intronic
1188986995 X:36776863-36776885 CTCATGCCATATTCTCCTGTAGG + Intergenic
1196238807 X:113316137-113316159 CTCAGGCCCTATTATTATGTTGG - Intergenic
1197533535 X:127661707-127661729 CTATGGCCGTATTCTGCTGGAGG - Intergenic
1198693581 X:139310853-139310875 CTTATGCCATATCTTGATGGGGG + Intergenic
1201354684 Y:13084312-13084334 GTCAGGCCAAAATCAGATGGTGG + Intergenic