ID: 1048872847

View in Genome Browser
Species Human (GRCh38)
Location 8:138813121-138813143
Sequence GACTCAGGAAGACCCCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048872847_1048872853 2 Left 1048872847 8:138813121-138813143 CCTCTTTGGGGTCTTCCTGAGTC 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1048872853 8:138813146-138813168 CCCCAGGATACCCCTATCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 137
1048872847_1048872861 25 Left 1048872847 8:138813121-138813143 CCTCTTTGGGGTCTTCCTGAGTC 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1048872861 8:138813169-138813191 CTCCACTCTGGATTTTCACAAGG 0: 1
1: 0
2: 4
3: 17
4: 215
1048872847_1048872858 13 Left 1048872847 8:138813121-138813143 CCTCTTTGGGGTCTTCCTGAGTC 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1048872858 8:138813157-138813179 CCCTATCCTGGGCTCCACTCTGG 0: 1
1: 0
2: 0
3: 12
4: 186
1048872847_1048872851 1 Left 1048872847 8:138813121-138813143 CCTCTTTGGGGTCTTCCTGAGTC 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1048872851 8:138813145-138813167 ACCCCAGGATACCCCTATCCTGG 0: 1
1: 0
2: 0
3: 5
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048872847 Original CRISPR GACTCAGGAAGACCCCAAAG AGG (reversed) Intronic
900234092 1:1578439-1578461 GGCTCAGGGAGTCTCCAAAGAGG - Intergenic
900234103 1:1578475-1578497 GGCTCAGGGAGCCCCCAAAAAGG - Intergenic
900234115 1:1578511-1578533 GGCTCAGGGAGTCCCCAAAGAGG - Intergenic
900500213 1:3000809-3000831 GACTCAGGAAGATCCCCCACAGG - Intergenic
904556808 1:31370579-31370601 GATTCAGGAGGAGCCTAAAGCGG + Intronic
905488868 1:38327977-38327999 GACCCAGGCAGCCCCCAAATAGG - Intergenic
906309144 1:44740521-44740543 GAGTTAGGAAAACCCCAAAAGGG + Intronic
907257981 1:53194627-53194649 GATTGAGGAAGACTTCAAAGAGG + Intergenic
907430279 1:54407091-54407113 TACTTTGGAAAACCCCAAAGTGG + Intronic
908012001 1:59787492-59787514 GAATGAGGAAGACACAAAAGTGG + Intergenic
908540851 1:65120701-65120723 GAGTCAGGAAGACTTCCAAGAGG + Intergenic
908757730 1:67484555-67484577 AACTCAGGATGACTTCAAAGTGG - Intergenic
908832575 1:68193886-68193908 GGCTCAAAAAGAACCCAAAGAGG + Intronic
910000197 1:82332165-82332187 CAGTCAGGGAGTCCCCAAAGTGG + Intergenic
910272247 1:85409290-85409312 GACTCAAGAAAACCACATAGGGG - Intronic
912579288 1:110705651-110705673 GAATGAGGAAGCCCCAAAAGTGG + Intergenic
914900814 1:151710207-151710229 GACTGAGGGAGACCCCACAAAGG + Intronic
915066644 1:153230540-153230562 GCATCGGGAAGACCCCGAAGGGG + Intergenic
915860043 1:159434465-159434487 CACTCAGCACAACCCCAAAGAGG + Intergenic
917283425 1:173400575-173400597 GAGGCATGAAGAGCCCAAAGTGG - Intergenic
918202193 1:182278024-182278046 GAATGAGGAAGACGCAAAAGCGG + Intergenic
922852315 1:228743581-228743603 GACTCAAAAAAACCTCAAAGAGG + Exonic
924795584 1:247290114-247290136 GAAACAGGAGGACCCCAATGAGG - Intergenic
1063641556 10:7835731-7835753 GAAACAGGAAAACCCCAAAAGGG - Intronic
1069840345 10:71335761-71335783 GGCTCAGCAGGACCCCCAAGCGG + Intronic
1069848810 10:71391689-71391711 GATTAGGGAAGACCCCAAACTGG - Intergenic
1071673699 10:87635753-87635775 GAGGCAGGAGGAGCCCAAAGTGG + Intergenic
1072526705 10:96277854-96277876 GAATGAGGAAGAAGCCAAAGTGG - Intergenic
1072612672 10:97029136-97029158 GACTCAGGCAGACCCTCAAAGGG + Intronic
1073121125 10:101123173-101123195 CACTCAGGAAGGCCCCTAACTGG + Intronic
1073991461 10:109266905-109266927 GAATCCAGAAAACCCCAAAGTGG + Intergenic
1074160415 10:110832289-110832311 GACTCAAGAAGTCCTCACAGTGG + Intronic
1074855236 10:117468546-117468568 GACTCAGGAAGATCTCACAAAGG + Intergenic
1075799643 10:125145406-125145428 GACTCAGTCAGTCCCCAGAGAGG - Intronic
1075988480 10:126810371-126810393 GAATCAGGAAGAAGCAAAAGTGG - Intergenic
1076223153 10:128751160-128751182 CACTCAGGAAGACCCCAGGATGG - Intergenic
1078143064 11:8705512-8705534 GACTGAGGAGGACCCCATACTGG + Intronic
1080182889 11:29445468-29445490 GAATAAGGAAGACACAAAAGTGG - Intergenic
1080183160 11:29447361-29447383 GAATGAGGAAGACACAAAAGTGG - Intergenic
1080343783 11:31298122-31298144 GACTCAAGAACAATCCAAAGGGG - Intronic
1082715446 11:56606481-56606503 GAGGCAGGAAGAGCTCAAAGTGG - Intergenic
1082726229 11:56740253-56740275 CACCCAGGAACACCACAAAGAGG - Intergenic
1082897144 11:58204043-58204065 TACTCAGGAAAAGCACAAAGAGG + Exonic
1090232052 11:125114391-125114413 GACTGAGGAACACACCACAGTGG + Intergenic
1092027797 12:5257728-5257750 GACTGAGGAAGGCTCCTAAGAGG + Intergenic
1092686242 12:11050394-11050416 GGCTCAGGAATACCCTTAAGTGG + Intronic
1095921676 12:47538200-47538222 GACTCAGGAAGCCCCCAAGAAGG + Intergenic
1095990349 12:48030033-48030055 GACCCAGGAAGATCCAAAGGAGG + Intergenic
1098054180 12:66486568-66486590 GAATGAGGAAGACACAAAAGCGG - Intronic
1099780545 12:87189743-87189765 GAATCAAGAAGACCACTAAGGGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1105553869 13:21427047-21427069 GACTCAGGAAGACTTTACAGAGG - Intronic
1105783534 13:23725098-23725120 GACCCAAGAAGGCCCCAAAGTGG - Intergenic
1108253936 13:48592907-48592929 GCCACAGGAAAACCCCAAGGGGG - Intergenic
1109214509 13:59572607-59572629 GAGTGAGGAAGATCCCAAAGGGG - Intergenic
1109496282 13:63177043-63177065 GAATGAGGAAGACGCAAAAGTGG - Intergenic
1111301505 13:86356426-86356448 GACTCAGGGAAAGCACAAAGTGG + Intergenic
1112885202 13:104162117-104162139 GAATGAGGAAGACACAAAAGGGG + Intergenic
1112923141 13:104640501-104640523 GAATGAGGAAGACACAAAAGTGG - Intergenic
1114272511 14:21110741-21110763 GAGTCAGGAAGACCAGAAATGGG - Intergenic
1116384804 14:44317069-44317091 GACTCATGCATACACCAAAGGGG - Intergenic
1118161048 14:63290913-63290935 GACTCAGAAAGGTCTCAAAGCGG + Exonic
1118192719 14:63594840-63594862 GTCTCAGCAGGACCTCAAAGAGG + Intergenic
1118696889 14:68394431-68394453 GACTGAGTCAGCCCCCAAAGAGG - Intronic
1119732414 14:76959200-76959222 GACTTAGAATGAGCCCAAAGTGG + Intergenic
1122063906 14:99158638-99158660 GACTGGGGAGGAACCCAAAGGGG + Intergenic
1122853272 14:104548057-104548079 CACTCAGGAAGACCCAGATGGGG + Intronic
1123112670 14:105880487-105880509 GTCTCAGGAAGACCCCCAGGAGG - Intergenic
1124422799 15:29537435-29537457 GAATCAGGAGGAAACCAAAGGGG - Intronic
1124598636 15:31112631-31112653 GAATCAGGAACCCCTCAAAGTGG - Intronic
1129670657 15:77606062-77606084 GACACAGGAAGACTCCAGAAAGG + Intergenic
1130375450 15:83325030-83325052 GACTCAGGCAGAACCAAAGGTGG + Intergenic
1130673787 15:85935021-85935043 GGCTTGGAAAGACCCCAAAGAGG + Intergenic
1132245448 15:100292932-100292954 CACCAAGGAAGACCCCACAGAGG + Intronic
1132472308 16:112291-112313 GGCACAGGAAGACTCCCAAGGGG - Intronic
1136990467 16:35148554-35148576 GCCTCAGAATGAGCCCAAAGTGG + Intergenic
1137418630 16:48310684-48310706 AACTCCAGAAGACCACAAAGCGG - Intronic
1137560146 16:49497143-49497165 GCCTCAGGGAGACTCCACAGGGG + Intronic
1137653589 16:50141114-50141136 CACACACCAAGACCCCAAAGTGG + Intergenic
1138212430 16:55174666-55174688 TACAGAGGAAGACCCCAAATGGG + Intergenic
1138492702 16:57385450-57385472 GAACCAGGAAGGCCACAAAGAGG - Intergenic
1139001100 16:62511314-62511336 CACTGAGGAAGACGCCAAATAGG - Intergenic
1139465672 16:67152828-67152850 GACTCAGAAAGACCCCTGACTGG + Intergenic
1140031728 16:71344641-71344663 GACTCAGGCAGGCCCTGAAGAGG + Intergenic
1140154476 16:72409038-72409060 GAATGAGGAAGACGCAAAAGTGG + Intergenic
1140287517 16:73618751-73618773 AACTAAGGATGACCCCAGAGAGG + Intergenic
1141133075 16:81447945-81447967 GCCTCAGGGAAACCCCACAGGGG - Intronic
1141401855 16:83754660-83754682 GAATGAGGAAGACGCAAAAGTGG - Intronic
1141736758 16:85859322-85859344 GACCCAGGAAGACAGCAATGAGG - Intergenic
1142184588 16:88688532-88688554 GACCCAAGAAGGCCCCACAGAGG + Intergenic
1142286318 16:89172958-89172980 GACTCAGGAAGCCCCTTCAGTGG - Intronic
1146017593 17:29246541-29246563 GTCTTAGGAAGATCCCAAGGTGG + Intergenic
1147893102 17:43731339-43731361 GAATGAGGAAGACGCTAAAGTGG - Intergenic
1148002241 17:44396299-44396321 GAAACAGGTAGACCCCACAGAGG - Intronic
1148521929 17:48285291-48285313 GACTCAGTATGACCAGAAAGAGG - Intronic
1148794967 17:50192569-50192591 GAATCTGGAAGAGACCAAAGAGG + Intronic
1152214746 17:79025405-79025427 GAGTCAGGAACACCTCACAGAGG - Intronic
1152803394 17:82342607-82342629 GCCTCAGCCACACCCCAAAGAGG - Intergenic
1155078203 18:22381618-22381640 GAGGAAGGAAGAGCCCAAAGTGG - Intergenic
1156438559 18:37160360-37160382 GATACATGTAGACCCCAAAGAGG + Exonic
1156827977 18:41455943-41455965 GATGCAGGAAGACCACATAGTGG + Intergenic
1158006350 18:52676142-52676164 GAAACAGGAAGACTCCACAGAGG + Intronic
1158474795 18:57770476-57770498 GAGTGAGGAAGATCCCAAACTGG - Intronic
1159282276 18:66301548-66301570 GAGTGAGGAAGACGCAAAAGTGG - Intergenic
1160753979 19:748184-748206 GACTCAGGCAGACTCCAGGGAGG - Exonic
1161632774 19:5367195-5367217 GGCTCAGGAAGAAACCAAGGAGG + Intergenic
1162493361 19:11008464-11008486 GACACAGGATGACCTCCAAGAGG - Intronic
1166294205 19:41881068-41881090 GACTAAGGAAGCCCCCAGAAGGG - Exonic
1167619995 19:50555422-50555444 GACACAGAAGGACCCCAAAGAGG + Intronic
1167640789 19:50680271-50680293 GAAGCAGGAAGAGCCCAGAGAGG + Intronic
1167660010 19:50790818-50790840 GACTCAGGAAGGCCTCGTAGCGG - Exonic
925538430 2:4940756-4940778 AACTCAGGAACACGCCAAGGGGG + Intergenic
925862643 2:8194739-8194761 GTCTCTGGAGGACCCAAAAGTGG + Intergenic
926105090 2:10144987-10145009 GAATCAGGGAGACACCAAAGAGG + Intronic
927040751 2:19228225-19228247 GATTCAGGAAGACTTCAAAGTGG - Intergenic
927245522 2:20954502-20954524 GAATGAGGAAGACGCAAAAGTGG + Intergenic
927410502 2:22820079-22820101 GAATCAGGAAGACTTAAAAGTGG - Intergenic
932824905 2:74930276-74930298 GATTCAGAAAGGCCCCAAAAAGG - Intergenic
933503580 2:83147627-83147649 GGGGCAGGAAAACCCCAAAGTGG - Intergenic
936830009 2:116632468-116632490 GAATGAGGAAGACGCAAAAGCGG + Intergenic
938379229 2:130827306-130827328 GCCGCAGGCAGCCCCCAAAGAGG + Intergenic
939869695 2:147513013-147513035 GACTCATGAGGACACAAAAGGGG + Intergenic
940888702 2:159014290-159014312 GAATGAGGAAGACACAAAAGTGG + Intronic
943117568 2:183692137-183692159 GACCCAGTAAGACCCCAGACAGG - Intergenic
943480389 2:188410659-188410681 GACGTAGGAAGAGCCCAAAGTGG + Intronic
944137417 2:196414526-196414548 GACTCAGGAAGGCCCCTTTGAGG - Intronic
946681632 2:222222865-222222887 GAATCAGGAAAACTCTAAAGTGG + Intronic
947871256 2:233440119-233440141 GATTTAGGAAGCCCCCACAGCGG + Intronic
948538209 2:238663808-238663830 AACTCTGAAAGACTCCAAAGTGG - Intergenic
948924618 2:241087454-241087476 GCCTCAAGAAGACCCCAAACAGG + Exonic
1173114092 20:40223635-40223657 GAGTCAGGAAGAGGCCAGAGAGG + Intergenic
1173336412 20:42115700-42115722 GACTCAGTCAGTCCCCAAACTGG - Intronic
1173418116 20:42876661-42876683 GTTTCAGGAGGACCCTAAAGGGG - Intronic
1173730834 20:45327365-45327387 GGATCAGGAAGACGGCAAAGAGG + Exonic
1173756474 20:45521106-45521128 GAGGCAGGAGGAGCCCAAAGTGG + Intergenic
1174531526 20:51218160-51218182 GAGGCAGGAAGAGCCCAAAGTGG - Intergenic
1177189925 21:17839537-17839559 GACTCAAGATGACCCCCAAATGG - Intergenic
1179323898 21:40320695-40320717 GAATGAGGAAGACGCAAAAGCGG + Intronic
1179983166 21:44906963-44906985 AACCCAGGAAGACCACAATGGGG - Exonic
1181455021 22:23054249-23054271 GAGTCAGGAGGGCCCCAAAGTGG + Intergenic
1182839821 22:33379838-33379860 AACTCAGGTATAACCCAAAGGGG + Intronic
1185207058 22:49545934-49545956 GCCTCAGGGAGACCGTAAAGAGG - Intronic
949831758 3:8222325-8222347 GACTGAAGAAGTCCCCAAAGAGG + Intergenic
952885561 3:38009350-38009372 GACTGGAGAAGCCCCCAAAGTGG + Exonic
953563983 3:44015378-44015400 GACTCAGAAACACCTGAAAGAGG - Intergenic
953766803 3:45749249-45749271 GAATGAGGAAGACTCAAAAGTGG + Intergenic
956734448 3:72227368-72227390 GGCTCAGGAACACCCAATAGTGG + Intergenic
957689840 3:83553614-83553636 GAGGAAGGAAGAGCCCAAAGTGG + Intergenic
957812749 3:85247745-85247767 GACACAGGAAGAGCATAAAGTGG - Intronic
958096512 3:88952462-88952484 CACACAGGAATACCCCAAACTGG + Intergenic
958546714 3:95562598-95562620 GACTCAGAAGGTCCTCAAAGAGG + Intergenic
959324745 3:104922402-104922424 GAATGAGGAAGACGCAAAAGTGG - Intergenic
959567697 3:107849385-107849407 GGGACAGGAAGACCCCAGAGAGG + Intergenic
960305849 3:116059924-116059946 GACTCAGGGAGAACTCCAAGTGG - Intronic
960843710 3:121987069-121987091 GATTCATGAAGCCTCCAAAGGGG + Intergenic
960874963 3:122286992-122287014 GACTCAGGATGACCCAAGTGAGG + Intergenic
963420747 3:145057980-145058002 GAGTCATGAGGACTCCAAAGTGG - Intergenic
963569274 3:146971331-146971353 GAAACATGAAGACCCCAAAGTGG - Intergenic
964419531 3:156486657-156486679 GACTCAAGAAGACCCCACACAGG - Intronic
964499537 3:157333596-157333618 GACTCAGTGTGACCACAAAGTGG - Intronic
969287883 4:6218013-6218035 GACTCAAGAGGACCCAAATGTGG + Intergenic
970199984 4:13594451-13594473 GCCTCAGGAATTCCCCAGAGAGG - Intronic
972137612 4:35911580-35911602 GACTCAGTAAGAGGGCAAAGAGG - Intergenic
973165744 4:47075893-47075915 GACCCAGGCAGGCTCCAAAGGGG - Intronic
973280268 4:48352975-48352997 GAATGAGGAAGACACAAAAGCGG - Intronic
976816658 4:89156003-89156025 AACTGAGGAAGACCTCAAATAGG + Intergenic
978580696 4:110228711-110228733 AACTCAGGAAGAGTCCACAGAGG + Intergenic
981979173 4:150771023-150771045 GAGGCAGGAGGAGCCCAAAGTGG + Intronic
984301383 4:177923242-177923264 GAGACATGAAGATCCCAAAGTGG + Intronic
985490621 5:176288-176310 CAGTCAGGCAGACCCCAAACAGG - Intronic
988028070 5:25726426-25726448 GAATGAGGAAGACGCAAAAGTGG + Intergenic
988197299 5:28020890-28020912 GTATCAGAAAGACACCAAAGAGG + Intergenic
991492968 5:67201257-67201279 AAGACAGGAAGATCCCAAAGCGG + Intergenic
992843013 5:80714974-80714996 GATTCAGGAAGAAACCTAAGAGG - Intronic
992938706 5:81739600-81739622 GACTCAGGAAGGCTCAACAGAGG + Intronic
994548597 5:101203992-101204014 GAATGAGGAAGACACAAAAGTGG - Intergenic
995231201 5:109765816-109765838 AACTCAGGAAAAGACCAAAGAGG - Intronic
995598163 5:113768729-113768751 GAATGAGGAAGACACAAAAGTGG - Intergenic
996620611 5:125497435-125497457 GGCTTAGGAGGACTCCAAAGGGG + Intergenic
997537689 5:134635301-134635323 GAGTCAGGCAGGCCCCTAAGAGG - Intronic
997940125 5:138149770-138149792 GGCTCAGCAAGAATCCAAAGGGG - Exonic
998216638 5:140242710-140242732 GGCTCAGGAAGACACCACACAGG + Intronic
999591693 5:153155566-153155588 AACTCAGGAGGACTCTAAAGTGG - Intergenic
1002346471 5:178551494-178551516 GAAACAGGAAATCCCCAAAGAGG - Intronic
1003952304 6:11127629-11127651 GAATGAGGAAGACGCAAAAGTGG + Intronic
1003995324 6:11534929-11534951 GAATGAGGAAGACGCAAAAGTGG - Intergenic
1005986460 6:30878840-30878862 GACTCAGGAAGACCTCAGGGAGG - Intronic
1007434822 6:41802537-41802559 GACTTTGGGAGACCCCAAGGTGG - Intronic
1009029410 6:58038444-58038466 GAATCAGGAAGACGGAAAAGCGG - Intergenic
1010662850 6:78590987-78591009 GAATGAGGAAGACACAAAAGTGG + Intergenic
1016373990 6:143401945-143401967 CACTCAGCAAAACCCTAAAGGGG + Intergenic
1017770462 6:157640128-157640150 CCCTGAGGAAGACCCCAAAAGGG + Intronic
1018054978 6:160044282-160044304 GACCCTGGAGGACCCCAATGTGG + Intronic
1018632989 6:165836383-165836405 AGCTCAGAAAGACCCCTAAGAGG - Intronic
1019618673 7:1978915-1978937 GACTCCGGCAGATCCCAGAGAGG + Intronic
1022496309 7:30855137-30855159 GACTAAGGAATAAGCCAAAGGGG - Intronic
1024985166 7:55187972-55187994 GCCTCAGGACCAGCCCAAAGTGG + Intronic
1025260759 7:57416054-57416076 GCCTCAGGGTGACCCCAAGGGGG + Intergenic
1026164983 7:67901552-67901574 AACACAGGAAAACCCCAAAGTGG + Intergenic
1026671101 7:72391415-72391437 GACACCAGAAGATCCCAAAGAGG + Intronic
1028668203 7:93371512-93371534 GAATGAGGAAGACACAAAAGTGG + Intergenic
1029097543 7:98100863-98100885 GAATGAGGAAGACACAAAAGTGG - Intergenic
1030976700 7:116133447-116133469 GACTGAGGAACCCCACAAAGTGG + Intronic
1032929631 7:136651732-136651754 GAATGAGGAAGACACAAAAGTGG + Intergenic
1034113739 7:148563742-148563764 GACTCTGGTAAAACCCAAAGGGG - Intergenic
1034480384 7:151315254-151315276 GACTCAGGAAGATCCCGAGGCGG + Intergenic
1035396154 7:158536430-158536452 GACTCAGGAAGACCCCACAAGGG + Intronic
1035450563 7:158974474-158974496 GAGTAACGAAGACCCCAAGGCGG + Intergenic
1038630263 8:29235568-29235590 GACCCAGGAAGAAGCCACAGTGG + Intronic
1038923453 8:32111726-32111748 GACTCAGGAAGATCCACATGGGG + Intronic
1038953700 8:32444603-32444625 GACTCAGGCATTTCCCAAAGGGG + Intronic
1040685354 8:49865256-49865278 GGCCCAGGAAGACAACAAAGTGG - Intergenic
1047189338 8:122663681-122663703 GAGTCAGGAAGACCTCTCAGAGG + Intergenic
1047978379 8:130154172-130154194 GTCTCTGGAAGACCCCTAAAGGG - Intronic
1047997141 8:130347745-130347767 GAATCAGGCAGACACCAATGTGG + Intronic
1048260944 8:132944550-132944572 GAATTGGGCAGACCCCAAAGTGG + Intronic
1048514407 8:135092949-135092971 GACTCAGCATGGCCCCAGAGTGG - Intergenic
1048872847 8:138813121-138813143 GACTCAGGAAGACCCCAAAGAGG - Intronic
1049435086 8:142582786-142582808 GACTCAGGGTGACCCCATAGTGG - Intergenic
1052246158 9:26337690-26337712 GATACAAGAAGACCCCACAGGGG + Intergenic
1052614654 9:30822113-30822135 AACTGAGGAAGACACAAAAGTGG - Intergenic
1052741339 9:32395607-32395629 GGCTGAGGAAGACCTCAAGGAGG + Intronic
1053148052 9:35725347-35725369 GGCTTATGAAGACCCCAATGTGG + Intronic
1053189584 9:36051221-36051243 GTCTCAAGAGGACTCCAAAGGGG - Intronic
1053523753 9:38808196-38808218 GAGTCACGAATAACCCAAAGTGG + Intergenic
1055931184 9:81561198-81561220 GAATGAGGAAGACGCAAAAGTGG - Intergenic
1056240944 9:84646151-84646173 GACACATGAGGAACCCAAAGTGG + Intergenic
1057421948 9:94919856-94919878 GACAAAGGAAGACCCGAGAGAGG - Intronic
1057720152 9:97525787-97525809 GAGTCATGAGGAGCCCAAAGTGG + Intronic
1060312526 9:122475229-122475251 GAGCCAGGAAGACCCCACCGTGG - Intergenic
1061079343 9:128360856-128360878 GACTCAGGAAGTCAACAGAGTGG + Exonic
1061132197 9:128714398-128714420 GAGTCAGGAAGCCGCCACAGAGG - Intronic
1061555222 9:131363903-131363925 GAAGCAGGAAGAACCCAATGAGG - Intergenic
1186215598 X:7296930-7296952 AACTCAGGAACAAACCAAAGAGG + Intronic
1187125903 X:16454186-16454208 GAGGCAGGAAGACACCAAAGAGG + Intergenic
1189289547 X:39875596-39875618 GACGCATGAAAACCCCAGAGAGG + Intergenic
1190292638 X:49002634-49002656 TCCTCCGGGAGACCCCAAAGGGG + Intergenic
1190640877 X:52482045-52482067 GCCTCAGGATGAGCCCAAAAGGG - Intergenic
1190646795 X:52530820-52530842 GCCTCAGGATGAGCCCAAAAGGG + Intergenic
1191716778 X:64199148-64199170 GATGCAGCAAGACCCCAAATTGG + Intronic
1193772922 X:85608987-85609009 GTCTAAGGAAGACAGCAAAGAGG + Intergenic
1194140626 X:90204535-90204557 GATTCATGAGGAGCCCAAAGTGG + Intergenic
1196725403 X:118890718-118890740 TACTCAGGACGCCCTCAAAGAGG + Intergenic
1197863654 X:130996059-130996081 CACTAAGGAAGACCACAAACTGG - Intergenic
1197975822 X:132164349-132164371 GAATGAGGAAGACACAAAAGTGG - Intergenic
1199823686 X:151476340-151476362 GAATGAGGAAGACGCAAAAGTGG - Intergenic