ID: 1048873312

View in Genome Browser
Species Human (GRCh38)
Location 8:138816365-138816387
Sequence TGGGGCAGCACAGTGATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048873312_1048873322 25 Left 1048873312 8:138816365-138816387 CCTGACATCACTGTGCTGCCCCA 0: 1
1: 0
2: 1
3: 8
4: 203
Right 1048873322 8:138816413-138816435 TTTCTGCCCTCAGCAATTATGGG No data
1048873312_1048873321 24 Left 1048873312 8:138816365-138816387 CCTGACATCACTGTGCTGCCCCA 0: 1
1: 0
2: 1
3: 8
4: 203
Right 1048873321 8:138816412-138816434 GTTTCTGCCCTCAGCAATTATGG No data
1048873312_1048873318 2 Left 1048873312 8:138816365-138816387 CCTGACATCACTGTGCTGCCCCA 0: 1
1: 0
2: 1
3: 8
4: 203
Right 1048873318 8:138816390-138816412 CCTGTCTGGAAGTCCTGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048873312 Original CRISPR TGGGGCAGCACAGTGATGTC AGG (reversed) Intronic
900209049 1:1444527-1444549 TGAGGCTGCAGAGTGATGTGGGG + Intergenic
900218884 1:1496445-1496467 TGAGGCTGCAGAGTGATGTGGGG + Intronic
900804180 1:4756530-4756552 TAGGGCAGAACAGAGATGGCTGG + Intronic
900820955 1:4888194-4888216 TGGGGCAGCTCAGTGTTCACAGG + Intergenic
901067714 1:6502305-6502327 TGGGGCAGGTCAGTGAAGTAGGG + Intronic
902883433 1:19387976-19387998 TGAAGCAGCACAGTGAATTCAGG - Intronic
904603888 1:31688691-31688713 TGGGGCAGCACAGGGACGGAGGG + Intronic
906109137 1:43311847-43311869 TGGGGCAGGACAGAGGTGTTGGG + Intronic
906534981 1:46546400-46546422 CTGGGAAGCACAGTGAAGTCAGG + Intronic
907437814 1:54460578-54460600 TGGGGCACCACTCTGATCTCAGG + Intergenic
910844173 1:91589509-91589531 TAGGGGAGCACAGTGCTATCAGG - Intergenic
912391509 1:109306401-109306423 TGGGGCAGCACAGTGACACTCGG - Intronic
913161922 1:116152534-116152556 TGCAGCAGCACAGATATGTCCGG - Intergenic
914412863 1:147448324-147448346 TGTGGCAACACATTGATGTTTGG + Intergenic
916299789 1:163261251-163261273 ATGGGCATCACAGTGATGACTGG - Intronic
917887304 1:179398986-179399008 TGGGCCAGCAAAGTGATGTGGGG + Intronic
919060441 1:192625326-192625348 TGGGGCAGAACAGTGAATGCAGG - Intergenic
921073513 1:211682005-211682027 GGGGGCAGCACAGTGATGGTAGG + Intergenic
921340372 1:214128519-214128541 AGGGACAGCACCTTGATGTCTGG - Intergenic
923440118 1:234009892-234009914 TGGGGAAGGACAGTTTTGTCAGG - Intronic
924461734 1:244265810-244265832 TGGGGCAGCACAGTGTAGCATGG + Intergenic
1062909952 10:1205890-1205912 TGGGGCAGCCCACTGGGGTCAGG + Intronic
1064517821 10:16169510-16169532 TGGAGGACCACAGTGATGTTTGG + Intergenic
1065478828 10:26171698-26171720 TGAGGCAGGCCTGTGATGTCTGG - Intronic
1070577894 10:77693576-77693598 TGGGGCAGGACAGTGGAGCCTGG + Intergenic
1070593032 10:77813624-77813646 TGGGGCAGGAGGGTGATGTAGGG - Intronic
1072930560 10:99658983-99659005 CGGGGCAAGACAGTGAGGTCGGG + Intergenic
1074490528 10:113935591-113935613 GGGGGCAGATCACTGATGTCAGG - Intergenic
1075324944 10:121523943-121523965 TGGCGCAGGCCAGAGATGTCAGG - Intronic
1075599525 10:123757080-123757102 TGGGCCAGCACAGTGCTGCGAGG - Intronic
1075908682 10:126105048-126105070 TGGGGATGGACAGGGATGTCAGG + Intronic
1076820732 10:132938168-132938190 TGGGGCAGCACAGGGCAGGCCGG - Intronic
1079179102 11:18173023-18173045 TGTGGCAGTAGAGAGATGTCAGG + Exonic
1080587198 11:33693030-33693052 ATGGGGAGCACAGTGAGGTCAGG - Intergenic
1080857300 11:36123404-36123426 TGGGGCAGCACATTGCTCCCAGG - Intronic
1081567831 11:44270688-44270710 TGGGGCTGCACAGTGGAGACAGG - Intronic
1082028208 11:47587727-47587749 TGGGGCAGCAGAGAGGAGTCAGG - Intronic
1082106625 11:48228302-48228324 TTGGGCAGGACAGTGAACTCAGG + Intergenic
1084190493 11:67496421-67496443 GGGAGCAGCACCCTGATGTCTGG + Intronic
1085464947 11:76716903-76716925 TGGGGCAGCCCAGAGAGGGCTGG + Intergenic
1086539202 11:87887257-87887279 TGCTACAGCACAGTGAGGTCAGG - Intergenic
1087036117 11:93758302-93758324 TGGGAGAGCACAGGGATGCCAGG - Intronic
1087153535 11:94879802-94879824 TGGGGAAGAACAGTGTGGTCTGG - Intergenic
1089254482 11:117187055-117187077 GGGTGCAGCACAGGGCTGTCTGG + Intronic
1089254617 11:117187729-117187751 TGGTGCAGGACGGTGTTGTCTGG + Intronic
1090684502 11:129100510-129100532 TGTGCCAGCAAAGTGATGTGTGG - Intronic
1090794580 11:130123806-130123828 TGCGGCAGCACCGTCCTGTCTGG + Intronic
1091260125 11:134227040-134227062 AGTAGCAGCACTGTGATGTCTGG + Intronic
1091281085 11:134382063-134382085 GGAGGCAGCAGAGTGAGGTCAGG - Intronic
1096578864 12:52571627-52571649 TGGGGCAGCTCTGTTATGCCTGG + Intronic
1100363073 12:93895546-93895568 TGGGATGGCACAGTGATGGCAGG + Intergenic
1102301615 12:111775626-111775648 TCCAGAAGCACAGTGATGTCTGG - Intronic
1103320666 12:120091056-120091078 CGGGGCAGCACAGCAATGGCAGG - Intronic
1104328827 12:127825497-127825519 TGGGGCAGAGCAGTGAGGACGGG - Intergenic
1104844192 12:131838656-131838678 TGGGTCAGGACAGGGAGGTCTGG - Exonic
1105945848 13:25188786-25188808 TGGGGCAGGACAGGAATGGCTGG + Intergenic
1106333905 13:28765368-28765390 TGGTTCAGCAGACTGATGTCAGG + Intergenic
1108112617 13:47092246-47092268 TGGGGCAGCATGGTGAAGACAGG + Intergenic
1109405086 13:61887264-61887286 TGGGGCAGGATATTGATGACAGG - Intergenic
1110544437 13:76740389-76740411 TGGGGCAGGAATGTGATATCAGG - Intergenic
1115023281 14:28709594-28709616 AGCAGCAGCACAGTGGTGTCAGG + Intergenic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1118615624 14:67572779-67572801 TGGGGCAGCAGAGAGGTGTGGGG - Intronic
1118703700 14:68460505-68460527 GCAGGCAGCACAGAGATGTCAGG - Intronic
1119230308 14:72974289-72974311 CAGGACAGCACAGTGGTGTCTGG - Intronic
1119533439 14:75379909-75379931 TGGGGCAGTCCAGTGGTGGCAGG + Intergenic
1121423758 14:93833708-93833730 CGGGGCAGAACAGTGATCCCTGG - Intergenic
1130520143 15:84655710-84655732 TGGGGCTTCAGAGTGAGGTCTGG - Intronic
1132543577 16:522759-522781 TTGGGCAGCACAGGGCTGTGTGG + Exonic
1132604270 16:787211-787233 CGGGGCAGCCCAGTGCTGCCGGG + Intronic
1132733711 16:1375473-1375495 TGGGGAAGGACAGTGTTGCCAGG - Intronic
1134357190 16:13493443-13493465 TGAGGCAGAACAGCGAGGTCAGG + Intergenic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1136655044 16:31704442-31704464 TGGGGCAGTGCAGTGTTGCCCGG - Intergenic
1137281073 16:46977278-46977300 TGGGGCAGCACAGTTGTATGTGG + Intergenic
1139704802 16:68733911-68733933 AGGGGCAGCAAAGTCAGGTCAGG - Intergenic
1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG + Intergenic
1143524509 17:7464223-7464245 TGTGGCAGCACAGGCATGTCCGG - Intronic
1146397757 17:32482421-32482443 TGGGGCCACACAGAGCTGTCTGG - Exonic
1146947115 17:36881101-36881123 TGGGGGTGCACAGTGAGGTTGGG - Intergenic
1154347999 18:13559889-13559911 AGGGGCAGCAAAGTGCTGTCTGG - Intronic
1157539757 18:48492223-48492245 TTGGGGAGAACAGTGATGACTGG - Intergenic
1158983690 18:62791317-62791339 TGTGGCTACACAGTGCTGTCAGG - Intronic
1160105404 18:75969914-75969936 TGGGGCAGCACAGTACTACCAGG + Intergenic
1160821671 19:1061930-1061952 TGGGGAAGCACAAGGACGTCAGG - Intronic
1161390641 19:4018686-4018708 AGGAGCAGCAGAGTGATGTAGGG + Intronic
1161678194 19:5665031-5665053 GGGGGCAGCACATTGCTGTGTGG + Intronic
1163560007 19:18013533-18013555 TGAGGCCACACAGTGAGGTCTGG + Exonic
1165897487 19:39151590-39151612 TGTGGAAGGACCGTGATGTCTGG - Intronic
1166623919 19:44332318-44332340 TGGGGCAGCACACTGATTGTGGG + Intronic
1166661085 19:44647705-44647727 GGGGGCAGCGCAATGATGTGGGG + Intronic
1167258479 19:48444280-48444302 GGGAGCTGCACAGTGATGTGGGG - Exonic
926808487 2:16735235-16735257 TGTGGGAGCACAGTGCTCTCTGG + Intergenic
927374314 2:22395895-22395917 TGGGGAAGAACAGAGATTTCTGG - Intergenic
928281398 2:29949510-29949532 TGGCTCAGCCTAGTGATGTCAGG + Intergenic
928599384 2:32888235-32888257 TGGGGCAGAAGAGAGATGTTTGG + Intergenic
929173022 2:38950108-38950130 TGGGCCAGGACAGTCTTGTCTGG - Intronic
929430846 2:41885049-41885071 TGAGGGAACACAGTGAAGTCAGG - Intergenic
932613589 2:73217773-73217795 TGTGGCAGCTCAGTGTTGACAGG + Intronic
934699752 2:96430133-96430155 AGTGGGAGCACAGGGATGTCTGG - Intergenic
934780679 2:96967943-96967965 CTAGGCAACACAGTGATGTCTGG - Intronic
935888364 2:107648865-107648887 TGAGCCAGCAAAGTGATGTGGGG - Intergenic
938407722 2:131041791-131041813 TGGGGCAGAACAGAGATGGAAGG - Intronic
943387271 2:187217430-187217452 TGGGGCAGCACACAGAACTCAGG - Intergenic
945104242 2:206294241-206294263 TGGGGCATTACAGGGATTTCTGG + Intronic
946333553 2:219023459-219023481 TGGGACTGCAGAGTGAGGTCAGG - Intronic
948243862 2:236461961-236461983 TGGGGCAGCACGGTGAGGGAAGG + Intronic
948754132 2:240149416-240149438 AGGGGCCGCACAGTTCTGTCTGG - Intergenic
1169719476 20:8658385-8658407 TGGAGAAGCACAGTGTTTTCAGG + Intronic
1169966617 20:11224813-11224835 TGGGGCAGCACATGGATGTCTGG - Intergenic
1171210893 20:23316148-23316170 TCTGGAAGCCCAGTGATGTCTGG - Intergenic
1172514509 20:35523617-35523639 TGTGCCAGCCCAGTGATATCAGG + Intronic
1172800635 20:37573900-37573922 AGGGGCAGCAGAGAGATGACAGG + Intergenic
1175862852 20:62159425-62159447 TGGGGAAGCACAGTTCTGCCAGG - Intronic
1175883168 20:62272063-62272085 TCGGGCAGCCCAGCGGTGTCAGG + Intronic
1179873255 21:44254404-44254426 CGGGGCATCACAGTGGTGGCTGG + Intronic
1180116112 21:45706254-45706276 TCCGGCTACACAGTGATGTCAGG - Intronic
1181767150 22:25100140-25100162 TGGGGCCCCACAGTGGTGTGGGG + Intronic
1182833125 22:33319867-33319889 TGGAGCATCACAGGGCTGTCTGG - Intronic
1183079379 22:35446886-35446908 TGGGGCAGGACACTGGTGACCGG - Intergenic
1183257945 22:36775154-36775176 TGGGGCAGCACAGTAACTTTGGG + Intronic
1183935211 22:41258033-41258055 TGGGCCAGGGCAGTGATGCCAGG + Exonic
1184915024 22:47563405-47563427 TGGGGCCGCCCCGTGATGTTAGG + Intergenic
1185128496 22:49024745-49024767 TGGGGCAGAGCAGGGATGTGTGG + Intergenic
950096566 3:10334153-10334175 TGGGCCTGCCCAGCGATGTCAGG + Intronic
952763220 3:36933918-36933940 CAGGTCAGCACTGTGATGTCTGG + Intronic
955937282 3:64113566-64113588 TGTGCCAGCAAAGTGATGTAGGG - Intronic
957700834 3:83708796-83708818 TGGAGCAGAACAGTGACCTCAGG + Intergenic
961390303 3:126548692-126548714 TGGGGCGGCACAGTGCAGCCCGG + Intronic
961391307 3:126553724-126553746 TGGGGCAGCCATGTGATTTCAGG + Intronic
964302495 3:155304636-155304658 TGGCCCAGCACAGTGCTCTCAGG + Intergenic
966540821 3:181088045-181088067 TGGGGGAGAACTGTGATTTCAGG + Intergenic
967722283 3:192828281-192828303 AAGGGCAGCACAGTGAAGTGTGG + Intronic
968927183 4:3555710-3555732 TGTGGGTGCACAGTGATGGCCGG + Intergenic
971356692 4:25901415-25901437 TGGGGCAGATGAGAGATGTCAGG - Intronic
973108378 4:46369134-46369156 TGGGGCAGCACAGTACTTCCTGG + Intronic
973566269 4:52190957-52190979 TGTGTCAGCTCAGTGATTTCAGG + Intergenic
974515607 4:62904662-62904684 TGAGGAAGCACAGTGAGGTTAGG + Intergenic
976025893 4:80687872-80687894 TGGGGAAGCACAGGGGGGTCAGG + Intronic
978508375 4:109486208-109486230 AGGAGCAGCTCAGAGATGTCAGG + Intronic
978652819 4:111027778-111027800 TGGAAGAGCACAGTGCTGTCTGG - Intergenic
978784223 4:112591638-112591660 TGGGGCAGAAGAATGATGGCTGG - Intronic
979813621 4:125070927-125070949 TGGGTCAGCTGATTGATGTCAGG - Intergenic
980165046 4:129215485-129215507 TGGAGGAGCAGATTGATGTCGGG + Intergenic
980351115 4:131684052-131684074 TATGGCAGCAAAGTGATGTGGGG + Intergenic
981478433 4:145211218-145211240 TGGGGCAGCACAGAGACTTCTGG - Intergenic
981887920 4:149700045-149700067 TGGGGCAACACAATGAGGGCAGG - Intergenic
982854967 4:160370238-160370260 TGGTGTAGCTCAGGGATGTCTGG + Intergenic
983700861 4:170591868-170591890 TGGGCCAGCAGAGGCATGTCTGG + Intergenic
984818298 4:183858140-183858162 TGGGGCTGTGCAGTGAGGTCAGG - Intronic
985478553 5:92799-92821 TGGGACAGAACAGTGATCTGTGG + Intergenic
985691310 5:1314278-1314300 TGGGGCTGAACCGGGATGTCTGG - Intergenic
987844312 5:23262171-23262193 TGTGGCAATACAGTGATGGCAGG + Intergenic
992397104 5:76378353-76378375 GGGGTCAGCCCAGTGCTGTCTGG - Intergenic
992565081 5:77988220-77988242 TGGGACAGCAGAGAGATGTGTGG - Intergenic
993311451 5:86338008-86338030 TGTGCCAGCAAAGTGATGTGGGG - Intergenic
998146996 5:139734640-139734662 AGGGGCAGCAGAGAGAAGTCAGG + Intergenic
998211760 5:140204966-140204988 TGGGGTAGGACTGTGATATCTGG + Intronic
1000282375 5:159793320-159793342 TGGCACAGCACAGTCATGTGAGG - Intergenic
1001493795 5:172173845-172173867 TGAGGCAGGACAGTGAGGGCTGG + Intronic
1004996819 6:21201322-21201344 TGTGGAAGCACAGTGATTCCAGG + Intronic
1007520878 6:42451423-42451445 TGGGGGAGCACACTCTTGTCGGG - Intronic
1008450816 6:51648334-51648356 TGGGGCAGGACAGTGAGGAGAGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1010148647 6:72702930-72702952 TGAGGCAGGTCAGTGATGGCAGG - Intronic
1015890759 6:137967777-137967799 TGGGGCATCAGAGTGATGGTGGG - Intergenic
1015890770 6:137967812-137967834 TGGGACAGCAGAGTGATGGTGGG - Intergenic
1015890787 6:137967882-137967904 TGGGACAGCAGAGTGATGGTGGG - Intergenic
1016688798 6:146911984-146912006 TGGGGCAGCAACATGATGTCAGG - Intergenic
1020256477 7:6505234-6505256 TGAGGAAGCACAGAGAGGTCAGG - Intronic
1020982217 7:15085118-15085140 TGGGGCAGCAGAGGCATCTCAGG + Intergenic
1023241401 7:38151454-38151476 TGTGTCAGCAAAGTGATGTGGGG - Intergenic
1024630314 7:51241871-51241893 TGAGGCAGGAGAGTAATGTCTGG + Intronic
1027627486 7:80563945-80563967 TGTGCCAGCAAAGTGATGTGGGG + Intronic
1029094042 7:98071154-98071176 GGAGGCAGAACAGTGAAGTCTGG + Intergenic
1029124647 7:98287782-98287804 TGGGGCTTCACAGTGCTGCCTGG - Intronic
1031008148 7:116497981-116498003 TGGGTAAGCAGGGTGATGTCTGG + Intronic
1033046589 7:137967834-137967856 TGGGGCATCACAGTGAGGGGAGG - Intronic
1033048316 7:137982023-137982045 TGGGGCTGCACAATGAGGTGGGG + Intronic
1033613038 7:142984335-142984357 TGTGCCAGCAAAGTGATGTGGGG + Intergenic
1035374726 7:158400524-158400546 TGATGCAGCATAATGATGTCAGG - Intronic
1037760590 8:21739052-21739074 TGGGGGTGCACTGTGATCTCTGG - Intronic
1038068416 8:23986989-23987011 TGATGGAGCACAGTCATGTCAGG + Intergenic
1038413224 8:27374428-27374450 TGGGGCAGCACAGGTGGGTCAGG + Intronic
1038524576 8:28262003-28262025 TGGGGGAGCAGAGAGATTTCAGG + Intergenic
1039118998 8:34124978-34125000 TGGGGTAGCACAGTGGAGGCAGG + Intergenic
1041594331 8:59629465-59629487 TGGGGCCTCACAGAGATGCCTGG - Intergenic
1043358624 8:79442757-79442779 TGGGGCAGCCCAGTTATGTATGG + Intergenic
1045554878 8:103206478-103206500 TGCGGCGGCACATTGAGGTCAGG - Intronic
1047225459 8:122952537-122952559 GCGGGCAGCACAGTGATGGTCGG - Exonic
1048320785 8:133398557-133398579 TAGGGCAGCACAGCCATGTGGGG + Intergenic
1048873312 8:138816365-138816387 TGGGGCAGCACAGTGATGTCAGG - Intronic
1049168083 8:141139318-141139340 TGGGGCAGCACAGACAGGCCCGG + Intronic
1053011444 9:34635984-34636006 TGGGCCAGCCCAGTGAGGTAGGG - Intronic
1053802108 9:41771120-41771142 TGTGGGTGCACAGTGATGGCGGG + Intergenic
1054143162 9:61544169-61544191 TGTGGGTGCACAGTGATGGCGGG - Intergenic
1054462871 9:65475050-65475072 TGTGGGTGCACAGTGATGGCAGG - Intergenic
1054647979 9:67605311-67605333 TGTGGGTGCACAGTGATGGCGGG - Intergenic
1058420840 9:104831688-104831710 TGGGGCAGCTCAATGCTGCCTGG + Exonic
1058872660 9:109216048-109216070 TGGGAGAGCAAAGTGGTGTCAGG - Intronic
1061296326 9:129678875-129678897 TGGGGCAGCCCAGCGAGCTCTGG - Intronic
1061643712 9:131981731-131981753 TGGGGTAGCAGTGTGATGACTGG - Intronic
1061684148 9:132260765-132260787 TGGGTCAGGAAAGAGATGTCTGG + Intergenic
1061684442 9:132263620-132263642 TTGGGCAGCACGGTTATGTTAGG - Exonic
1186485197 X:9929301-9929323 TGCAGCAGCACAGCAATGTCTGG - Intronic
1186858912 X:13652265-13652287 CGGGGCAGCTCAGAGCTGTCAGG - Intergenic
1189399143 X:40648800-40648822 TTGTGCAGCACAGTGCTGGCTGG + Exonic
1189606318 X:42681927-42681949 TGGGGCAGTACAGTGGTGGTGGG + Intergenic
1190302416 X:49064527-49064549 AGGAGCAGCTCAGGGATGTCCGG + Exonic
1192928115 X:75777771-75777793 TGGAGAAGCCCAGAGATGTCTGG - Intergenic
1194491624 X:94557192-94557214 ATAGGCAGCACAGTGATGCCAGG + Intergenic
1195614924 X:106904367-106904389 TGGGGCTGGACACTGAGGTCAGG - Intronic
1195865916 X:109432634-109432656 TGTGGCAGCCCTGTGATGTTAGG + Intronic