ID: 1048874638

View in Genome Browser
Species Human (GRCh38)
Location 8:138827386-138827408
Sequence TTCCCTGTACTCTCACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 1, 2: 4, 3: 54, 4: 385}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048874638_1048874642 -6 Left 1048874638 8:138827386-138827408 CCACCATGTGAGAGTACAGGGAA 0: 1
1: 1
2: 4
3: 54
4: 385
Right 1048874642 8:138827403-138827425 AGGGAAGGATGGTGTCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048874638 Original CRISPR TTCCCTGTACTCTCACATGG TGG (reversed) Intronic
900743860 1:4346897-4346919 TTGGCTGTGCTCTGACATGGTGG - Intergenic
900874170 1:5329792-5329814 CTCACTGTATCCTCACATGGTGG + Intergenic
903441523 1:23391522-23391544 CTCACTGTAACCTCACATGGTGG - Intronic
904121399 1:28200519-28200541 TTCCTTGTACTCTCCCTTGTGGG - Exonic
905919185 1:41708073-41708095 CTCCCTGTGCACTCACCTGGGGG - Intronic
905927362 1:41760937-41760959 TTACCTGTCCTCTCAAATGTAGG + Intronic
907201326 1:52729146-52729168 TTCACTGTTTTCACACATGGTGG + Intronic
907706128 1:56834285-56834307 CTCACTGTAACCTCACATGGTGG - Intergenic
909707478 1:78604677-78604699 CTCACTCTAATCTCACATGGTGG - Intergenic
909757317 1:79242643-79242665 TTCACTGTGCCTTCACATGGTGG - Intergenic
910041388 1:82855863-82855885 CTCACTGTATTCCCACATGGTGG - Intergenic
911818389 1:102384473-102384495 TTGCCTGCCATCTCACATGGTGG - Intergenic
912174100 1:107137219-107137241 CTCCTTGTATTCTCACATGGTGG - Intergenic
912386960 1:109275781-109275803 TACCCTGTCCTCCCACAGGGAGG + Intergenic
912632580 1:111258727-111258749 TTCCCAATACTATCACCTGGGGG - Intergenic
912877856 1:113380397-113380419 TTCTCTGTGCCCTCTCATGGTGG + Intergenic
913649207 1:120894445-120894467 TTTGCTGTGCCCTCACATGGTGG - Intergenic
914949211 1:152097227-152097249 CTCCCTGTACCCTCACATGGTGG + Intergenic
915647579 1:157284694-157284716 AACACTGTATTCTCACATGGTGG + Intergenic
916232131 1:162550874-162550896 TTCACTGCATTCTCACCTGGAGG + Intergenic
916267492 1:162905238-162905260 TTCCCTGTCCTCTCACTCAGAGG + Intergenic
918764995 1:188470013-188470035 TTTGCTGTGCCCTCACATGGTGG - Intergenic
919438970 1:197602631-197602653 TTTCCTGTAATCTAACATGAAGG - Intronic
920717343 1:208352809-208352831 CTCTCTGTGTTCTCACATGGAGG + Intergenic
921126311 1:212181051-212181073 CTACTTGTACCCTCACATGGTGG - Intergenic
921889057 1:220335566-220335588 TTCCCTGCCCTCTCTCTTGGGGG - Intergenic
924798934 1:247313073-247313095 TTCATTGTGTTCTCACATGGTGG + Intronic
924809649 1:247389854-247389876 TTAGCTATAATCTCACATGGTGG + Intergenic
1063133619 10:3198484-3198506 CTCACTGTATCCTCACATGGGGG + Intergenic
1063315153 10:4996741-4996763 TTACCTTTACTCTCACTTAGAGG + Intronic
1063821904 10:9845855-9845877 CTCCCTGTATCCTCACATGGTGG + Intergenic
1064131305 10:12712560-12712582 CTCACTGTGTTCTCACATGGTGG + Intronic
1064417293 10:15160803-15160825 TTCCATGTCCTTTCACATGCTGG - Intronic
1065595257 10:27304412-27304434 TTCCCTGTTCACTCTGATGGTGG - Intergenic
1065684264 10:28268210-28268232 TGCCCTTGTCTCTCACATGGCGG - Intronic
1066539387 10:36428886-36428908 TTCCATGTGTCCTCACATGGTGG - Intergenic
1066645994 10:37609687-37609709 TTCCATGTGTCCTCACATGGTGG - Intergenic
1067146003 10:43694484-43694506 TGCCCTGCACTCTGACAGGGAGG + Intergenic
1067424736 10:46198161-46198183 TTCCCAATACTGTCACATTGTGG + Intergenic
1068567429 10:58591454-58591476 TTCTCTGTAACCTCACATGATGG + Intronic
1069073416 10:64013463-64013485 CTCCCTCTAATCCCACATGGCGG - Intergenic
1071026968 10:81126472-81126494 TCTCCTGTATCCTCACATGGTGG + Intergenic
1071085763 10:81867089-81867111 TGCCCTGGACTGTCACAGGGAGG - Intergenic
1071642968 10:87333324-87333346 TTCCCAATACTGTCACATTGTGG - Intergenic
1071860237 10:89664838-89664860 CTCCCTGTGTCCTCACATGGTGG - Intergenic
1072130980 10:92493918-92493940 TTCCCTGTACTTTCACACTCTGG - Intronic
1072356891 10:94620412-94620434 TTGCCTGTTCACTCTCATGGTGG + Intergenic
1072642374 10:97221616-97221638 TTCACTGTAACCTCACATGGTGG - Intronic
1072897572 10:99379971-99379993 CTCATTGTATTCTCACATGGTGG + Intronic
1073646715 10:105312269-105312291 TTCCATGTGCCCTCACATGGTGG - Intergenic
1074336082 10:112577222-112577244 TTACCTGTACTATCACATCTAGG + Intronic
1075681348 10:124335095-124335117 CTCCCTGTAACCTCACATGGTGG + Intergenic
1076623273 10:131806516-131806538 TTCCCTTTGGTCTCACGTGGTGG - Intergenic
1077750503 11:4962903-4962925 TCCCCTGTACTTTGACATGTGGG - Intronic
1078239593 11:9518869-9518891 TTCACTGTACTCTTGCATTGAGG + Intronic
1078685591 11:13527943-13527965 ATCCCTGTTCTCACACATGAGGG - Intergenic
1078712132 11:13803626-13803648 CTCCCTGTAATCTCACACAGTGG - Intergenic
1078717622 11:13854857-13854879 TTCACTGTAACATCACATGGTGG - Intergenic
1079075553 11:17383410-17383432 TCCCCTGTAATCTTACATGGTGG - Intergenic
1080046485 11:27813925-27813947 TTACCTTAATTCTCACATGGAGG + Intergenic
1082978252 11:59096705-59096727 ATCTCTGTGCCCTCACATGGTGG + Intergenic
1083542017 11:63518106-63518128 CTTGCTGTAATCTCACATGGTGG - Intergenic
1085277426 11:75309120-75309142 CTCCCTGTGCTCTCAGAAGGTGG + Intronic
1085409976 11:76285095-76285117 CTCCTTGTATCCTCACATGGTGG - Intergenic
1087881841 11:103425403-103425425 TTCCTTGTATCCTCATATGGTGG + Intronic
1091114209 11:132998343-132998365 CTCCCTGTCTTCTCACTTGGGGG + Intronic
1093523958 12:20085055-20085077 CACACTGTATTCTCACATGGAGG + Intergenic
1093598609 12:20993357-20993379 CTCACTGTAATCTCACATGCTGG - Intergenic
1093611545 12:21165730-21165752 CTCTTTGTATTCTCACATGGAGG - Intronic
1094689708 12:32756685-32756707 TTCCCTGGACTCTGAGTTGGGGG + Intergenic
1094722873 12:33083207-33083229 TTCACTGTATCCTCACTTGGAGG - Intergenic
1095444391 12:42269756-42269778 TTCACTGTGTTCTCACATAGTGG - Intronic
1095695895 12:45143785-45143807 CTCCTTGTATTCTCCCATGGTGG + Intergenic
1096038178 12:48491279-48491301 TTCACTGTGTCCTCACATGGAGG + Intronic
1096384546 12:51186383-51186405 TTCACTGTAACCTCACATGGTGG - Intergenic
1097354824 12:58589326-58589348 GTTGCTGTATTCTCACATGGGGG - Intronic
1097766966 12:63536886-63536908 CTCTCTGTACCCTCACATGGTGG - Intergenic
1097783314 12:63731815-63731837 CTCTCTGTATCCTCACATGGTGG - Intergenic
1098235525 12:68414551-68414573 CTCTCTGTGGTCTCACATGGTGG - Intergenic
1099109819 12:78544610-78544632 TTCCCTATATACTCACACGGTGG - Intergenic
1099387222 12:82029246-82029268 TTCACTGTAAGCTCACATGGTGG - Intergenic
1099506932 12:83489679-83489701 TTCATTGTATCCTCACATGGAGG + Intergenic
1100428181 12:94507037-94507059 TTCCCTGTCTTCTCACAAGGAGG + Intergenic
1101722441 12:107361831-107361853 CTCCTAATACTCTCACATGGAGG - Intronic
1102414326 12:112747315-112747337 TTCACTGTGTCCTCACATGGTGG - Intronic
1102972398 12:117179847-117179869 TTCCATGTACTGTATCATGGGGG - Intronic
1103076410 12:117986320-117986342 CTCACTGTACCCTCACATGGTGG - Intergenic
1103093321 12:118113117-118113139 TTCACTGTATCTTCACATGGTGG - Intronic
1103238445 12:119394436-119394458 TTGCCTGGACTACCACATGGTGG - Intronic
1104154778 12:126120858-126120880 TTTGCTGTACACTCCCATGGGGG + Intergenic
1104455438 12:128907713-128907735 TTCCCAGGGATCTCACATGGGGG - Intronic
1104652579 12:130546889-130546911 TTCCCTGTAGTTTCACTTGATGG + Intronic
1104806609 12:131593214-131593236 TTCCCTGGCCTCACACAGGGAGG + Intergenic
1105485647 13:20828712-20828734 TTCCCTGTACCTCCACAAGGGGG - Intronic
1106484225 13:30158446-30158468 TTCCATGTGTCCTCACATGGTGG + Intergenic
1106551132 13:30772047-30772069 CTCGCTGTGTTCTCACATGGTGG - Intergenic
1106643131 13:31607002-31607024 TTTACTGTATCCTCACATGGGGG - Intergenic
1106820279 13:33456743-33456765 GTCCCTGTATTCCCACATAGTGG - Intergenic
1107345416 13:39455012-39455034 CTCCCTGTACCCTCACAGGGTGG - Intronic
1108254177 13:48594657-48594679 CTCACTGTGCCCTCACATGGAGG - Intergenic
1108334728 13:49427879-49427901 TTCGCTGTATCCTCACATAGTGG + Intronic
1108602067 13:52003673-52003695 TTGCCTGTACTGTCACAAGTAGG + Intronic
1108931739 13:55832653-55832675 TTCCTTGTGTTTTCACATGGTGG - Intergenic
1109444114 13:62410719-62410741 TTTCATATATTCTCACATGGTGG - Intergenic
1109470369 13:62796649-62796671 CTCCCTGTATCCTCACATGGTGG + Intergenic
1109926534 13:69148426-69148448 CTCGCTGTGTTCTCACATGGTGG + Intergenic
1110479702 13:75960129-75960151 GTCCCTGGATTCTCACATAGAGG - Intergenic
1110778658 13:79439331-79439353 CTTCATGTATTCTCACATGGTGG + Intergenic
1111299872 13:86334729-86334751 TTTCCTCTGCTCCCACATGGCGG + Intergenic
1111802498 13:92997684-92997706 TTCACTGTGTCCTCACATGGTGG + Intergenic
1111872707 13:93853644-93853666 ATCCCTTTAAACTCACATGGTGG + Intronic
1112659392 13:101490223-101490245 CTTGCTGTACCCTCACATGGTGG - Intronic
1113158494 13:107352554-107352576 CTCCTTGTGCTCTCACAAGGAGG + Intronic
1113204896 13:107906012-107906034 CCCTCTGTACTCTCACATAGTGG - Intergenic
1113618311 13:111696350-111696372 TTCCCTGTAAAATCACATGAAGG - Intergenic
1113623842 13:111781611-111781633 TTCCCTGTAAAATCACATGAAGG - Intergenic
1116624788 14:47250588-47250610 CCCACTGTCCTCTCACATGGTGG - Intronic
1116710083 14:48357296-48357318 TTTGCTGTGTTCTCACATGGTGG + Intergenic
1117173815 14:53128436-53128458 CTCACTGTGCCCTCACATGGTGG + Intronic
1119502277 14:75140037-75140059 CTCACTGTGTTCTCACATGGAGG - Intronic
1119851945 14:77872551-77872573 CTCTCTGTGCTCTCAGATGGGGG + Intronic
1120468357 14:84890671-84890693 CTCCTTGTATTCTCACGTGGTGG + Intergenic
1122159170 14:99770305-99770327 CTTCTTGTATTCTCACATGGTGG + Intronic
1124101830 15:26702997-26703019 TTTGCTTTAATCTCACATGGTGG + Intronic
1124353402 15:28977240-28977262 CTTCCTGTGCTCTCACATCGGGG + Intronic
1125214098 15:37249858-37249880 TTACCTGTACTCTCCCAGGAAGG + Intergenic
1126541164 15:49825578-49825600 CTCACTGTGTTCTCACATGGTGG - Intergenic
1127975299 15:63992710-63992732 TTCCCTGTGCTCCCACAAGGAGG - Intronic
1128405468 15:67333047-67333069 TTCTCTGTGTCCTCACATGGTGG + Intronic
1128696477 15:69767704-69767726 CTCCCTGTGTTCTCACATGATGG + Intergenic
1128877108 15:71211410-71211432 CTCCCTGTGTTCTCATATGGTGG + Intronic
1130757378 15:86779212-86779234 CTCCCTGTGTCCTCACATGGTGG - Intronic
1131802991 15:96091131-96091153 TTCCCTGCTCTCTCAAATAGAGG - Intergenic
1132129362 15:99261502-99261524 TTTGCTGTATTCTCACATGGTGG + Intronic
1132132125 15:99292138-99292160 TGCCCTGTACTCTGTGATGGTGG + Intronic
1133707622 16:8370187-8370209 TTCACTGTGCCCTCACATGGTGG + Intergenic
1135760496 16:25134117-25134139 TTCCCATTACTGTCACATGACGG - Intronic
1138730000 16:59184094-59184116 TTCACTGTGTCCTCACATGGTGG + Intergenic
1140026279 16:71293110-71293132 CTTGCTGTATTCTCACATGGTGG + Intergenic
1140047481 16:71451570-71451592 CTCACTGTATCCTCACATGGTGG - Intronic
1141876780 16:86830343-86830365 TTCCCTGTATCATGACATGGAGG + Intergenic
1142800811 17:2344352-2344374 TTCCCTGTCCCTTCAGATGGGGG - Intronic
1144146125 17:12399435-12399457 TTCACTGCAACCTCACATGGTGG - Intergenic
1145408352 17:22631240-22631262 TTCCCAATACTGTCACATTGTGG - Intergenic
1146296316 17:31653404-31653426 TTAGCTGTGTTCTCACATGGTGG - Intergenic
1147872375 17:43596670-43596692 TTCTCTGGGCTCTCACATGGTGG + Intergenic
1150129412 17:62659096-62659118 CTCACTGTACCCTCACATGGTGG + Intronic
1150997900 17:70340158-70340180 CTCACTGTAACCTCACATGGAGG - Intergenic
1152466621 17:80470133-80470155 TACCCTGTGCTCTCCCGTGGAGG - Exonic
1153433911 18:5048510-5048532 TTTATTGTATTCTCACATGGTGG - Intergenic
1155450637 18:25959361-25959383 CTCCCTGTACTCCCCCATTGAGG - Intergenic
1157111926 18:44828843-44828865 CTCCCTGTGTCCTCACATGGTGG - Intronic
1157198514 18:45639599-45639621 TCCCATGTTCTCTCACATGCTGG + Intronic
1157492844 18:48136333-48136355 TTCCCTGGACTCCAACCTGGGGG - Intronic
1159376334 18:67598294-67598316 CCCACTGTATTCTCACATGGTGG + Intergenic
1159407781 18:68027758-68027780 GTCCCTGTGTCCTCACATGGTGG + Intergenic
1159463900 18:68754869-68754891 CTCCCTGCATGCTCACATGGTGG - Intronic
1159809456 18:72999118-72999140 TTCCCTGTGTTCACACAGGGTGG + Intergenic
1161185055 19:2912191-2912213 TTCCTTCTCCTCTCACTTGGCGG + Intronic
1162444569 19:10714435-10714457 TTTTCTCTAATCTCACATGGCGG + Intergenic
1164946687 19:32300404-32300426 TTCACTGTAACTTCACATGGAGG - Intergenic
1165921655 19:39302376-39302398 TTCCTTGTCCTCTCTCATGGTGG + Intergenic
1166459440 19:42973258-42973280 CTCCCTGTGTTCTCCCATGGTGG + Intronic
1166476762 19:43133303-43133325 CTCCCTGTGTTCTCCCATGGTGG + Intronic
1168510910 19:56972962-56972984 CTCCCTGTGTCCTCACATGGTGG + Intergenic
925043150 2:749514-749536 TTCCCTGTCCTCGCACTGGGGGG + Intergenic
925483365 2:4301420-4301442 TTCTCTGTGTCCTCACATGGTGG - Intergenic
925729353 2:6906700-6906722 GTCCCTGTGTTCTCACATGGAGG + Intergenic
926431477 2:12790409-12790431 TTGCCTGTTCACTCTCATGGTGG + Intergenic
926679664 2:15653976-15653998 TTCTCTGGGCTCCCACATGGAGG + Intergenic
926805067 2:16700786-16700808 TTCTCTGCACCCTCACACGGTGG + Intergenic
926841203 2:17082315-17082337 TTCCCTGTATAATCACATGCTGG - Intergenic
926961869 2:18365823-18365845 TTCACTGCATCCTCACATGGTGG - Intergenic
928185424 2:29105775-29105797 TTCAGTGTAGCCTCACATGGGGG - Intronic
928801666 2:35101479-35101501 TTCCCTGAAGCCTCACTTGGAGG - Intergenic
928946919 2:36779867-36779889 TTCCCTACACTGTCACATGGAGG - Intronic
929022619 2:37568497-37568519 CTCACTGTGTTCTCACATGGTGG - Intergenic
929228113 2:39531619-39531641 TTCACTGTGTCCTCACATGGTGG + Intergenic
929985834 2:46731293-46731315 CTCACTGTAACCTCACATGGTGG - Intronic
930761799 2:55046619-55046641 TTATCTGTACTCTCCCAAGGGGG + Intronic
930912847 2:56650788-56650810 TTCTCTCTGTTCTCACATGGTGG - Intergenic
931007873 2:57873074-57873096 TTTCCTGTGTCCTCACATGGTGG - Intergenic
932261958 2:70334420-70334442 CTCCCTGTATCATCACATGGTGG - Intergenic
933806409 2:86001157-86001179 TTCCCTGCCCACTCAGATGGAGG + Intergenic
934064356 2:88326496-88326518 GTCCCTGTGTTCTCACATAGTGG - Intergenic
935180624 2:100687375-100687397 CTCCCTGTGTCCTCACATGGAGG - Intergenic
935730521 2:106061552-106061574 CTCACTGTGCTCTCACATGTCGG + Intergenic
936107321 2:109636058-109636080 CTCTCTGTATCCTCACATGGAGG - Intergenic
936930624 2:117784876-117784898 CTCCCTGTGTCCTCACATGGTGG - Intergenic
937029726 2:118728395-118728417 CTATCTGTACCCTCACATGGTGG - Intergenic
937626478 2:124049894-124049916 CTTACTGTAATCTCACATGGTGG + Intronic
937635419 2:124150621-124150643 CTCCTTGTACCCTCACATGGTGG + Intronic
938079371 2:128361460-128361482 CTCACTGTATCCTCACATGGTGG - Intergenic
939132869 2:138258587-138258609 TTGCCTGTTCACTCTCATGGTGG - Intergenic
940465936 2:154026599-154026621 TTCTCTGTGTTCTCACATGCAGG + Intronic
940570181 2:155422155-155422177 TTTGCTGTGTTCTCACATGGTGG + Intergenic
940672984 2:156693641-156693663 TTCTCTGTGCTCTCACATGGTGG - Intergenic
941145416 2:161837916-161837938 CTCCTTGTAATATCACATGGTGG - Intronic
941349855 2:164418764-164418786 TTCCCTGTATCCTCACATGGTGG + Intergenic
942555939 2:177172314-177172336 CTCCCTGTACCCTTACATGGGGG - Intergenic
942796982 2:179832634-179832656 TACCCTGGAATCTCACAGGGTGG - Intronic
947083812 2:226428287-226428309 GTCATTGTACTCTCACTTGGAGG + Intergenic
948212413 2:236204460-236204482 TTCCGTTTACTCTCACTTGCTGG + Intronic
948548162 2:238746983-238747005 TTCCCTGATCTCTCACAGTGTGG - Intergenic
1169398424 20:5257662-5257684 CTCACTGTACTTTCCCATGGTGG + Intergenic
1169606272 20:7323124-7323146 ATCACTGTATCCTCACATGGTGG + Intergenic
1169833316 20:9849898-9849920 CTCTCTGGAATCTCACATGGAGG - Intergenic
1170349542 20:15423989-15424011 ATCCTTGTATTCTCACATGGTGG + Intronic
1171256529 20:23692848-23692870 CTCCCTCTCCTCACACATGGTGG + Intergenic
1171381762 20:24738769-24738791 TTCCATGTGTCCTCACATGGTGG - Intergenic
1173163521 20:40670159-40670181 TTTCCTGTACTGTAACATAGAGG - Intergenic
1174662326 20:52224331-52224353 TTTCCTTTATTCTCACATGGTGG + Intergenic
1174814064 20:53671499-53671521 CTCCCTGTAGTCTTACATGGTGG - Intergenic
1175323762 20:58108153-58108175 CTCACTGTACTCTAACGTGGTGG - Intergenic
1175596498 20:60238940-60238962 CTCTCTGTAACCTCACATGGTGG - Intergenic
1176880508 21:14186791-14186813 TTCACTGTGTCCTCACATGGTGG - Intronic
1176937273 21:14881976-14881998 CTCTCTGTATACTCACATGGTGG + Intergenic
1177535305 21:22419546-22419568 TTCCCTGTATTCTCACATGGTGG - Intergenic
1177537563 21:22448301-22448323 TTGCCTGTTCTCTCTGATGGTGG + Intergenic
1178522832 21:33300726-33300748 TTCTCTGTGTCCTCACATGGTGG - Intergenic
1179335224 21:40445082-40445104 CTCTCTGTATCCTCACATGGTGG + Intronic
1180947880 22:19706748-19706770 TTCTCTATAATTTCACATGGTGG - Intergenic
1182931143 22:34175478-34175500 TTCACTGTGTCCTCACATGGTGG + Intergenic
1183870860 22:40741120-40741142 TTTGCTGTAATCTCACATGCTGG - Intergenic
1184039024 22:41932643-41932665 TGCCCTCTAGTCTCACATGGAGG - Intergenic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
1184637467 22:45845434-45845456 TTCCCTGTCCTCTACCGTGGAGG + Intergenic
1184834300 22:47012046-47012068 TTCCCTGTACACTCACCTGTGGG + Intronic
1184888822 22:47367246-47367268 TTCCCTGTACTCTTGCCTGTGGG + Intergenic
1184912264 22:47543924-47543946 TTCTCTGTGTCCTCACATGGTGG - Intergenic
950177886 3:10888616-10888638 ATCCCTGTACTCTCACTGCGTGG - Intronic
951347463 3:21563203-21563225 TTCACTGTATTTTCACATGGTGG - Intronic
951735149 3:25855298-25855320 CTTGCTGTATTCTCACATGGTGG + Intergenic
951999382 3:28768309-28768331 ATCCATGTATCCTCACATGGTGG + Intergenic
952333649 3:32386749-32386771 CTCGTTGTATTCTCACATGGTGG + Intergenic
952434324 3:33257118-33257140 TTCACTGTGTCCTCACATGGTGG - Intergenic
954915113 3:54142206-54142228 GTCCCTGAACTCACACAAGGAGG - Intronic
955541443 3:59980696-59980718 CTCCCTGTGTCCTCACATGGTGG - Intronic
956280113 3:67547090-67547112 CTCCCAGTACTATCACCTGGGGG - Intronic
956571861 3:70705565-70705587 TTCACTGCATCCTCACATGGGGG + Intergenic
957005763 3:74944849-74944871 TGCCCTGTGTCCTCACATGGCGG - Intergenic
957549393 3:81684472-81684494 CTCCATGTTGTCTCACATGGTGG + Intronic
957931168 3:86880078-86880100 TTCCGTGTAGCCTCACCTGGTGG - Intergenic
958458093 3:94358522-94358544 TTCTATGTATCCTCACATGGTGG - Intergenic
958682139 3:97344494-97344516 CTCCCTGTATCCTCACATGGTGG - Intronic
959450568 3:106494323-106494345 CTTCCTGTATTCTCACATGGTGG + Intergenic
959528375 3:107403210-107403232 TTCACTGTGTTTTCACATGGTGG - Intergenic
960314089 3:116155176-116155198 TTCACTGGACTCTCTCATGAGGG + Intronic
960461589 3:117942529-117942551 CTCACTGTATCCTCACATGGTGG - Intergenic
961251803 3:125513221-125513243 TTCACTGTGTCCTCACATGGTGG - Intronic
961364737 3:126392145-126392167 TGCCCAGATCTCTCACATGGGGG - Intergenic
961925845 3:130479204-130479226 TTCACTAAATTCTCACATGGTGG - Intronic
962301240 3:134244929-134244951 CTCCCTGTGTTCTCACATGGTGG - Intronic
964277197 3:155021256-155021278 TTCATTCTACGCTCACATGGTGG + Intergenic
964778886 3:160313439-160313461 TTCCCTAAAGCCTCACATGGAGG + Intronic
965088793 3:164136095-164136117 TTGCCTGTTCACTCTCATGGTGG - Intergenic
965272333 3:166634589-166634611 CTCCTTGTATCCTCACATGGTGG - Intergenic
965443454 3:168745603-168745625 CTCCCTGTGTCCTCACATGGTGG + Intergenic
966202615 3:177373599-177373621 TTCATTGTACCCTCACTTGGTGG + Intergenic
967440876 3:189507259-189507281 TTGCCTGTACTCGCTCATGTGGG + Intergenic
967769536 3:193319481-193319503 CTTCCTGTATCCTCACATGGTGG - Intronic
967771626 3:193340151-193340173 CTCCCTGTGCTGTCACGTGGAGG + Intronic
967879333 3:194288119-194288141 ATCCCTGAACTCTCAAATAGGGG - Intergenic
968453492 4:686075-686097 TCCCCGGAACTCACACATGGTGG + Exonic
969241327 4:5900274-5900296 TTCCCTGTTCTCTCCAATGATGG + Intronic
970005795 4:11409522-11409544 TTGCCTGTGCCTTCACATGGTGG - Intronic
970349118 4:15183384-15183406 TTCCCAGGCCACTCACATGGGGG + Intergenic
970778833 4:19710669-19710691 TTCCAAATACCCTCACATGGGGG - Intergenic
971129201 4:23787357-23787379 TTCACTGGACTTTCAAATGGAGG + Intronic
971324638 4:25633981-25634003 CTCCCTGTATCCTCACATGGTGG + Intergenic
971353886 4:25877054-25877076 TTCACTGTGTCCTCACATGGTGG - Intronic
972414104 4:38821729-38821751 TTCACTGTATCCTCACCTGGGGG - Intronic
973152096 4:46900745-46900767 CTTGCTGTATTCTCACATGGTGG - Intronic
973543382 4:51956599-51956621 TTCTATGTATCCTCACATGGTGG + Intergenic
974394717 4:61320071-61320093 TTCACTGTGCCCTCATATGGAGG - Intronic
974898091 4:67963916-67963938 TTGCCTGTACTCTCAGAAGTGGG - Exonic
975225485 4:71866404-71866426 CTCACTGTATTGTCACATGGTGG - Intergenic
975225603 4:71867726-71867748 CTCACTATATTCTCACATGGTGG - Intergenic
975409027 4:74026185-74026207 TTCACTGAGTTCTCACATGGTGG - Intergenic
975570738 4:75815275-75815297 CTCACTCTACTCGCACATGGCGG - Intergenic
976104764 4:81604857-81604879 TTACTTGTACTCTCAAAGGGTGG + Intronic
976513965 4:85943407-85943429 TTCACTGTGCCCTCAGATGGTGG + Intronic
976989244 4:91344201-91344223 TTCTATGTGTTCTCACATGGAGG - Intronic
977610899 4:99029820-99029842 TTCCCTGTTCCTTCAAATGGTGG - Intronic
977991034 4:103442708-103442730 TGCACTGTATTCTCACATGACGG + Intergenic
979021225 4:115501054-115501076 CTCACTGTATCCTCACATGGTGG - Intergenic
979173778 4:117636268-117636290 TTTACTATACCCTCACATGGTGG - Intergenic
979550027 4:121980058-121980080 TTCCCTGTACTATCAAATCATGG - Intergenic
979727091 4:123975056-123975078 TTCACTGTGTCCTCACATGGTGG - Intergenic
981038739 4:140199910-140199932 TTCACTGTGTTCTCACATGGTGG + Intergenic
981190074 4:141852130-141852152 CTCACTGTTTTCTCACATGGTGG + Intergenic
981485524 4:145282133-145282155 TTCCATGTACTCTGGCAGGGAGG + Intergenic
981959062 4:150513676-150513698 CTCCCTGTCCCCTCACATAGTGG + Intronic
982167203 4:152624951-152624973 TTCCATGTTCTCCCACAAGGAGG + Exonic
982376638 4:154697942-154697964 CTCCCTGTACTCTTAAGTGGCGG - Intronic
984045732 4:174796191-174796213 TTCACTGTAACCTCACATGGTGG - Intronic
984489027 4:180408842-180408864 CTCACTGTGTTCTCACATGGTGG - Intergenic
984578924 4:181487495-181487517 TTTACTGTGTTCTCACATGGTGG + Intergenic
986241892 5:5967663-5967685 TTGAATGTACTCTCATATGGAGG + Intergenic
986447573 5:7836009-7836031 CTCCCTGTATCCTCACATGCTGG + Intronic
986633890 5:9801208-9801230 TTTCCTGTATCCTCACATGGTGG - Intergenic
986945691 5:13016488-13016510 CTCACTGTATCCTCACATGGTGG + Intergenic
986961587 5:13219382-13219404 TTCTCAGTGCTCTCACATGGTGG - Intergenic
987546464 5:19316101-19316123 TATCCTGTACCTTCACATGGAGG + Intergenic
987877272 5:23693900-23693922 CTCACTGTATCCTCACATGGTGG + Intergenic
988104151 5:26721950-26721972 TTCACTGTAACCTCACATGGTGG + Intergenic
988178904 5:27764437-27764459 CTCTCTGAACTGTCACATGGTGG + Intergenic
989398845 5:40987471-40987493 TTCTCTGTGTCCTCACATGGTGG + Intergenic
989800000 5:45525982-45526004 CTCACTGTATTCTCACCTGGTGG - Intronic
991953707 5:71971721-71971743 CTTGCTGTATTCTCACATGGGGG + Intergenic
992529890 5:77643741-77643763 TTGCCTGTTCACTCACACGGAGG + Intergenic
993105706 5:83597950-83597972 TTTCCTGTGTCCTCACATGGTGG + Intergenic
995004810 5:107179453-107179475 CTTGCTGTATTCTCACATGGTGG - Intergenic
996039959 5:118798320-118798342 TTCACTGTATCCTTACATGGTGG - Intergenic
996049039 5:118910867-118910889 TTCTATGTGCTCTCAAATGGGGG + Intronic
996191946 5:120555483-120555505 CTTGCTGTATTCTCACATGGTGG + Intronic
996571861 5:124940451-124940473 TTCTATGTCCCCTCACATGGTGG + Intergenic
996678947 5:126209062-126209084 TTCTCTGTGTTCTCACAAGGCGG + Intergenic
997385348 5:133468032-133468054 TTGCCTGTCCTCTCACAGGCAGG + Intronic
998860015 5:146433412-146433434 TTGCCTGTACACTCTGATGGTGG - Intergenic
999846615 5:155488392-155488414 TTCACTGTATAATCACATGGTGG - Intergenic
1000284086 5:159811532-159811554 CTCCCTGTGTGCTCACATGGTGG - Intergenic
1000553156 5:162691715-162691737 TTGCCTGTTCACTCTCATGGTGG + Intergenic
1000554787 5:162713420-162713442 TTGCCTGTTCACTCTCATGGTGG - Intergenic
1001508859 5:172303217-172303239 CTACCTGTGCCCTCACATGGTGG + Intergenic
1002836994 6:873378-873400 CTCCCTGTGTCCTCACATGGTGG - Intergenic
1002855635 6:1035672-1035694 TTCCCTGCACCCCCACACGGAGG - Intergenic
1003303901 6:4909265-4909287 TTCCCTGATTCCTCACATGGAGG - Intronic
1003636047 6:7832396-7832418 CTCGCTGTGCCCTCACATGGTGG - Intronic
1003846899 6:10183109-10183131 TTCATTGTGCCCTCACATGGTGG - Intronic
1003877034 6:10447069-10447091 CTCCCTGTGTCCTCACATGGTGG + Intergenic
1004678184 6:17864880-17864902 CTCCCAGTACACACACATGGTGG - Intronic
1005235570 6:23758053-23758075 TTGCCTGTTCACTCTCATGGTGG - Intergenic
1005275775 6:24215902-24215924 TTCCCTCAACTCTCACATCCTGG - Intronic
1006857273 6:37143396-37143418 TTCCATGTAGTCTCCCATGTAGG - Intergenic
1007888164 6:45256378-45256400 TTCTCTGTTTCCTCACATGGAGG + Intronic
1007945004 6:45818191-45818213 CTCCATGTGTTCTCACATGGTGG - Intergenic
1007953027 6:45889249-45889271 CTCCTTGTATCCTCACATGGTGG + Intergenic
1008167949 6:48163699-48163721 TTCACTATAAACTCACATGGGGG - Intergenic
1008741832 6:54617750-54617772 TTCCCCTTCTTCTCACATGGAGG - Intergenic
1009623143 6:66101333-66101355 CTAGCTGTACCCTCACATGGTGG + Intergenic
1009753152 6:67898929-67898951 TTCACTGTGTCCTCACATGGTGG + Intergenic
1009947417 6:70355918-70355940 TTTGCTGTATCCTCACATGGTGG - Intergenic
1009947650 6:70358331-70358353 CTCACTGTGTTCTCACATGGTGG - Intergenic
1010098572 6:72076380-72076402 CTCACTGTGCTCTCACATGGTGG + Intronic
1010491168 6:76477598-76477620 TTCCCTGTTGTTTCACATGATGG - Intergenic
1010986970 6:82435707-82435729 CTCCCTGTGTCCTCACATGGTGG - Intergenic
1011465023 6:87646378-87646400 TTCTCTTTAATCTCACATGGTGG + Intronic
1011889891 6:92145005-92145027 TTCACTTTAACCTCACATGGTGG - Intergenic
1012795983 6:103761954-103761976 TTCCCTGCATCCTTACATGGTGG + Intergenic
1013340092 6:109205550-109205572 CTCCCTGTGTCCTCACATGGTGG + Intergenic
1013497284 6:110710644-110710666 CTCACTGTAACCTCACATGGTGG + Intronic
1013754341 6:113443372-113443394 TTCACTGTAATCTCACATGGTGG - Intergenic
1014008136 6:116444718-116444740 TTCACTGTAGCCTCACATGTTGG - Intergenic
1014127096 6:117789314-117789336 TTCACTGTGATCTCACATGGTGG + Intergenic
1014846886 6:126288570-126288592 TTCCCTTTGCCCTCACATGGTGG + Intergenic
1015650047 6:135446602-135446624 TTCACTATATTCTCACATGGTGG - Intronic
1016129590 6:140449990-140450012 TTCACTGTGTTCTCACATGGTGG - Intergenic
1016950961 6:149579370-149579392 TTCCCCGTACTCCCACTTTGGGG - Intronic
1016951158 6:149581475-149581497 TTCCCCGTACTCCCACTTTGGGG + Intronic
1017371467 6:153714221-153714243 TGCACTGTGCCCTCACATGGGGG + Intergenic
1017419610 6:154260177-154260199 TTGCCTGGACTCTCACCTGTGGG - Intronic
1017607679 6:156150871-156150893 CTGGCTGTATTCTCACATGGTGG + Intergenic
1019137641 6:169921170-169921192 TTCCCTTTTCTCTCAGATTGAGG - Intergenic
1020160412 7:5766528-5766550 CTCCCTGTGTTCTCACATGATGG - Intronic
1021010061 7:15451522-15451544 CTCACTGTATTCTTACATGGTGG + Intronic
1021920410 7:25479419-25479441 TTCCCTTTGCTCTCTCTTGGTGG + Intergenic
1022059862 7:26782803-26782825 TTCTATGTGCCCTCACATGGTGG - Intronic
1022316067 7:29246790-29246812 TTCACTGTGCCCGCACATGGTGG + Intronic
1023385002 7:39647739-39647761 CTCACTGTAACCTCACATGGTGG - Intronic
1024196150 7:47060785-47060807 CTCCCTGTGCCCTCATATGGTGG - Intergenic
1025992319 7:66505368-66505390 TATCCTGTACTCACACATGGTGG - Intergenic
1026028500 7:66767712-66767734 CTCCCTGTGTCCTCACATGGTGG - Intronic
1026760084 7:73120120-73120142 CTCCCTGTATCCTCACATGATGG - Intergenic
1027036426 7:74928932-74928954 CTCCCTGTATCCTCACATGATGG - Intergenic
1027087137 7:75272534-75272556 CTCCCTGTATCCTCACATGATGG + Intergenic
1028150506 7:87366218-87366240 TCCCCTGTACCCTCGCAAGGGGG + Intronic
1028286517 7:89009681-89009703 CTCCCTGTGTCCTCACATGGTGG - Intronic
1029393443 7:100290515-100290537 CTCCCTGTATCCTCACATGATGG + Intergenic
1030901104 7:115124724-115124746 CTCCCTGTATCCTCACATGGTGG - Intergenic
1031609535 7:123808834-123808856 TTCACTGTTTCCTCACATGGTGG + Intergenic
1034472015 7:151260095-151260117 TTCACTGTGCTATCACAGGGTGG + Intronic
1034737158 7:153439975-153439997 CTCCCTGTGTCCTCACATGGCGG - Intergenic
1034996830 7:155582622-155582644 TTCGATGTGCTCTCACATGGTGG - Intergenic
1035702570 8:1647884-1647906 TTCCCTGCGTCCTCACATGGTGG + Intronic
1037286047 8:17301682-17301704 TTCCCTGTACTTGGACAGGGAGG - Intronic
1037297625 8:17417714-17417736 TTCACTGTAGCTTCACATGGTGG - Intergenic
1038036508 8:23691057-23691079 TTCCCTGCCCTCTCACTGGGTGG + Intergenic
1039014459 8:33130465-33130487 TTCCTGGTTTTCTCACATGGTGG + Intergenic
1039083763 8:33759690-33759712 TACCCTGTGCCCTCACATGATGG + Intergenic
1039099741 8:33928477-33928499 TTCACTGCATTCTCACATGGTGG + Intergenic
1041516374 8:58703089-58703111 TTCTCTGTATCCTCACGTGGTGG - Intergenic
1042725329 8:71868899-71868921 CTTCCTGTATCCTCACATGGTGG + Intronic
1043022427 8:75020496-75020518 TTCTCTGTGTCCTCACATGGTGG + Intronic
1043615629 8:82121392-82121414 TCCCTTCTACTCTCACATGTTGG + Intergenic
1044548146 8:93482341-93482363 CTCACTGTATCCTCACATGGTGG - Intergenic
1044799349 8:95937623-95937645 CTCCCTGTATGCTCACATGGTGG + Intergenic
1044843392 8:96357033-96357055 TTTCCAGTGCTCTCCCATGGAGG - Intergenic
1045186568 8:99844317-99844339 TTCACTGTAACCTCACATGATGG + Intronic
1045651294 8:104343788-104343810 CTCCCTGTGTCCTCACATGGCGG - Intronic
1046079429 8:109353337-109353359 TTCACTGCATCCTCACATGGTGG + Intergenic
1046701085 8:117401972-117401994 TTCCCTGTCCTTTTGCATGGTGG - Intergenic
1046724532 8:117660013-117660035 TTTCCTGTAGTCCCTCATGGTGG + Intergenic
1047824833 8:128562068-128562090 TTTCCTGTTCCTTCACATGGTGG - Intergenic
1048685223 8:136897457-136897479 TTCACTGTGCCCTCACATGGTGG - Intergenic
1048874638 8:138827386-138827408 TTCCCTGTACTCTCACATGGTGG - Intronic
1050038743 9:1465099-1465121 CTCACTGTATTCTCACATAGGGG - Intergenic
1050637142 9:7624451-7624473 CTCACTGTGTTCTCACATGGTGG + Intergenic
1051588654 9:18753318-18753340 GTCCATGTAGTCTCACATGTGGG + Exonic
1052399134 9:27978520-27978542 CTCCCTGTGTCCTCACATGGTGG - Intronic
1053049813 9:34951215-34951237 TGGCCTGTATTCTCATATGGGGG + Intergenic
1055877367 9:80959464-80959486 CTCACTGTAACCTCACATGGAGG - Intergenic
1056222956 9:84468045-84468067 TTCGCTGTAACCTCACTTGGTGG - Intergenic
1056495359 9:87149851-87149873 TTCCCTGTGTCCTCATATGGTGG - Intronic
1057785191 9:98082050-98082072 TTCCTTGTACTCTTACGTGGAGG + Intronic
1058561658 9:106235461-106235483 TTCACTGTAATTTAACATGGTGG - Intergenic
1058890738 9:109358521-109358543 TTCACTGTGTCCTCACATGGTGG - Intergenic
1059726288 9:117011395-117011417 CTCCCTGTGTTCTCACATGGTGG - Intronic
1060964337 9:127704190-127704212 TTTTATGTACTCTCACATGTTGG - Intronic
1061044224 9:128155891-128155913 TTCTTTGTACCCTCACTTGGTGG - Intergenic
1185759867 X:2682230-2682252 TTTGCTGTGTTCTCACATGGAGG + Intergenic
1185827026 X:3261310-3261332 GTCTCTGTACCTTCACATGGAGG - Intergenic
1185872259 X:3673901-3673923 TTCACTGTGTCCTCACATGGTGG - Intronic
1186027018 X:5324281-5324303 CTCACTGTGTTCTCACATGGTGG - Intergenic
1186364414 X:8876018-8876040 CTCCCTGTGTCCTCACATGGTGG - Intergenic
1186422665 X:9438802-9438824 CTCCCTGTGTCCTCACATGGTGG + Intergenic
1186442745 X:9600297-9600319 TTTGCTGTGTTCTCACATGGTGG + Intronic
1188303779 X:28537483-28537505 TTCCCTGTATTCTTACAGGTAGG - Intergenic
1189208775 X:39265180-39265202 CTCCTTGTATTCTCACTTGGTGG - Intergenic
1189671349 X:43413512-43413534 CTTCCTGTACCCCCACATGGTGG - Intergenic
1189816072 X:44825159-44825181 TACCCTGTAAACTCATATGGAGG + Intergenic
1190647914 X:52540358-52540380 GTCCCTGTGCACTCACAGGGAGG - Intergenic
1190748144 X:53338825-53338847 TTCCCTTTCCTCTTCCATGGAGG + Intergenic
1190798820 X:53770033-53770055 TTCCCTTTCCTCTTCCATGGAGG + Intergenic
1193136948 X:77983004-77983026 CTCCCTGTGTCCTCACATGGTGG + Intronic
1193497087 X:82228223-82228245 CTCCCTGTGTTCTCACATGGTGG + Intergenic
1194736714 X:97521131-97521153 CTCACTGTGCCCTCACATGGTGG - Intronic
1194947454 X:100085849-100085871 CTCCCTGTGTTCTCACATGGTGG - Intergenic
1195163964 X:102198916-102198938 TTCACTCTAACCTCACATGGAGG - Intergenic
1195194897 X:102488179-102488201 TTCACTCTAACCTCACATGGAGG + Intergenic
1195745945 X:108118467-108118489 TTCCCTCAACTCTAAAATGGAGG + Intronic
1196005139 X:110828872-110828894 TTCACTGTGTCCTCACATGGTGG + Intergenic
1197004791 X:121482396-121482418 TTCTGTGTGTTCTCACATGGTGG + Intergenic
1198463263 X:136882927-136882949 CTCACTGTGTTCTCACATGGTGG - Intergenic
1200791645 Y:7304780-7304802 TTCACTGTGTCCTCACATGGTGG + Intergenic