ID: 1048876825

View in Genome Browser
Species Human (GRCh38)
Location 8:138843191-138843213
Sequence CAGCATCTGCATCTTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048876825_1048876830 22 Left 1048876825 8:138843191-138843213 CCAGGCACAAGATGCAGATGCTG 0: 1
1: 0
2: 3
3: 16
4: 213
Right 1048876830 8:138843236-138843258 CGGTGACATGGCAAGGTCCCTGG No data
1048876825_1048876831 23 Left 1048876825 8:138843191-138843213 CCAGGCACAAGATGCAGATGCTG 0: 1
1: 0
2: 3
3: 16
4: 213
Right 1048876831 8:138843237-138843259 GGTGACATGGCAAGGTCCCTGGG No data
1048876825_1048876828 10 Left 1048876825 8:138843191-138843213 CCAGGCACAAGATGCAGATGCTG 0: 1
1: 0
2: 3
3: 16
4: 213
Right 1048876828 8:138843224-138843246 GACAGCAGAGCACGGTGACATGG No data
1048876825_1048876829 15 Left 1048876825 8:138843191-138843213 CCAGGCACAAGATGCAGATGCTG 0: 1
1: 0
2: 3
3: 16
4: 213
Right 1048876829 8:138843229-138843251 CAGAGCACGGTGACATGGCAAGG No data
1048876825_1048876827 2 Left 1048876825 8:138843191-138843213 CCAGGCACAAGATGCAGATGCTG 0: 1
1: 0
2: 3
3: 16
4: 213
Right 1048876827 8:138843216-138843238 ATCTTTAAGACAGCAGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048876825 Original CRISPR CAGCATCTGCATCTTGTGCC TGG (reversed) Intronic
900371364 1:2333597-2333619 CAGCAGCAGCACCTTGAGCCAGG - Intronic
900505251 1:3027166-3027188 CAGCTCCTGCCTCTTGTCCCGGG + Intergenic
900570340 1:3355197-3355219 CTGCAGCTGCATCTGGGGCCAGG + Intronic
901050058 1:6421468-6421490 CAGCATCTGCATCTTGGGGAGGG + Intronic
901115352 1:6839481-6839503 CAGCAACTCCAACTAGTGCCTGG - Intronic
901326280 1:8367358-8367380 CCACAGCTGCATCTTATGCCTGG + Intronic
901883319 1:12206657-12206679 CTGAATCTGCATCTTGGGCAGGG + Intronic
902394897 1:16127274-16127296 CAGCATTTGCATCCTGTGTGGGG - Intronic
904275724 1:29383021-29383043 CAGGGGCTGCATCTTGTCCCTGG + Intergenic
904423221 1:30407429-30407451 CAGAGGCTGCATCTTGTCCCTGG - Intergenic
904542389 1:31241760-31241782 CTGCATCTTCATTTTGTGCTGGG - Intergenic
904876394 1:33657853-33657875 CAGCAGCTGCATCTTGGGCCTGG - Intronic
905141696 1:35850981-35851003 CAGCCCCTGCATATTATGCCCGG + Exonic
905965762 1:42093837-42093859 CAGCATCTGCTTCTGGTGAGGGG + Intergenic
906544812 1:46613473-46613495 CAACCTCTGCATCCTCTGCCTGG + Intronic
907574930 1:55517848-55517870 AAGCATCATCATCTTGAGCCTGG - Intergenic
908497865 1:64713069-64713091 CATTAGCTGCATCTTCTGCCTGG - Intergenic
909986113 1:82162564-82162586 CAACAGGTGCTTCTTGTGCCTGG - Intergenic
912597191 1:110891049-110891071 CAGCATTAGCAACTAGTGCCTGG - Intronic
916103259 1:161410982-161411004 AAGAAACTGCATTTTGTGCCAGG - Intergenic
917618113 1:176767316-176767338 CAAAATCTGCATCTATTGCCTGG - Intronic
919112477 1:193237843-193237865 CAGGATCTGCAGGTTGGGCCCGG + Intronic
919125027 1:193382987-193383009 CAGTATGTGCTTCTGGTGCCAGG + Intergenic
920994974 1:210981308-210981330 CAGCAACTACATCTAGTCCCAGG + Intronic
924595536 1:245441875-245441897 TAGCATCTGCTTCCTGTCCCTGG + Intronic
1062946125 10:1463405-1463427 CTGCATCTGCATCATGGACCAGG - Intronic
1063261181 10:4391411-4391433 CAGCATCTTTGTCTGGTGCCAGG - Intergenic
1066059141 10:31706960-31706982 CTGCATCTGCAGCTGGTGCCAGG + Intergenic
1068224241 10:54086155-54086177 CAGCATCTGCTTCTGGTGAGGGG + Intronic
1070282077 10:75057333-75057355 CAGCATCTGCATCTGCTCCTTGG + Intronic
1070363959 10:75717674-75717696 CAGCAACTGCAGCTTGTGCAGGG - Intronic
1071872597 10:89811606-89811628 CAGCATCTACCTCTCATGCCTGG - Intergenic
1072036536 10:91567899-91567921 CTGCATCTGTACCTTGTGACTGG - Intergenic
1073154438 10:101335236-101335258 CATCATCTGCATTTTCTACCAGG - Intergenic
1075968628 10:126633813-126633835 AAGCATCTGTATCTTTTGGCAGG + Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077229489 11:1452251-1452273 CAGCATCTGCAGCCTGTGCCAGG + Intronic
1080273658 11:30478632-30478654 CAGTATCCCCATCTTGTTCCTGG + Intronic
1080399852 11:31923608-31923630 CAGCTTCTCCATTTTGTCCCAGG + Intronic
1081498387 11:43639408-43639430 CAGTATCTGCTTGTTGTGCTGGG + Intronic
1081552730 11:44129136-44129158 CCTCATCTGCATCTCTTGCCTGG + Intronic
1081711259 11:45217448-45217470 CAGAATTTGCATCTTGTCCTAGG - Intronic
1081757433 11:45554536-45554558 CAGCCGCTGCACCTTGGGCCAGG - Intergenic
1083717064 11:64583561-64583583 CAGCAGCTGCCTCTGGTCCCAGG - Intergenic
1084634995 11:70385959-70385981 CCACAACTGCATCTTTTGCCAGG - Intergenic
1084876264 11:72135963-72135985 CAGCAGCTGCATCATCTGCCAGG - Exonic
1084881136 11:72172459-72172481 GAGCAGCTGCATCATCTGCCAGG - Intergenic
1085170736 11:74447645-74447667 CAGCATTTTCATTTTGTGCTGGG + Intergenic
1088736975 11:112735864-112735886 CAGCAGCGGCAGCTTTTGCCAGG - Intergenic
1088833200 11:113555542-113555564 CAGCAGCTGCATCTCGGGCTGGG + Intergenic
1088976271 11:114818952-114818974 TAACATTTGCTTCTTGTGCCTGG + Intergenic
1090481509 11:127072884-127072906 AAACCTCAGCATCTTGTGCCTGG - Intergenic
1090540747 11:127700507-127700529 GAGCATCTGCTTCTGGAGCCTGG + Intergenic
1090548572 11:127792885-127792907 AAGCTTCTGCAACTTGGGCCGGG - Intergenic
1091997032 12:5001789-5001811 CAGCATTTGCATTCTGTGCATGG + Intergenic
1092455196 12:8636825-8636847 CAGCAGCTGCATCTTGTCCATGG - Intergenic
1093092213 12:14934855-14934877 CACCATCTGCCTCTTTCGCCTGG - Exonic
1098167641 12:67714579-67714601 CAGCCTCTGCATATTATACCTGG + Intergenic
1101195283 12:102375823-102375845 CAGCTTCTGCATCATGTGGATGG - Intergenic
1101368619 12:104102022-104102044 CTGAATCTGTATCCTGTGCCTGG - Exonic
1106005835 13:25769536-25769558 CAGCTTCTGCATCTGCTGCATGG + Intronic
1112675422 13:101695778-101695800 CACCATCTTCATCTGTTGCCAGG - Intronic
1113885738 13:113657526-113657548 CAGCACCTGCGCCTTGTGCGAGG - Intronic
1113925719 13:113940386-113940408 CAGCACCTGCGTCTTCTGTCTGG - Intergenic
1117057782 14:51930755-51930777 CAGTATCTGCTTCTTGTGAGGGG + Intronic
1117064790 14:52001824-52001846 TAGCAACTGCATCCTGTGTCAGG - Exonic
1117950790 14:61081035-61081057 CAGCATATAAATCTAGTGCCTGG - Intronic
1118950934 14:70435993-70436015 CAGCATCTGCCTCTGAGGCCAGG + Intergenic
1120362693 14:83525703-83525725 CAGCATCTTCAGCTTGTGGATGG - Intergenic
1121970414 14:98350811-98350833 CAGCATCTTCCTGCTGTGCCAGG + Intergenic
1122105068 14:99446806-99446828 CAGCATCTGCATCCTGCCCTCGG - Intronic
1122137450 14:99642992-99643014 CAGCATCTGTGTCATGTCCCAGG + Intergenic
1122156164 14:99751691-99751713 CACCAGCTGCCTCTTCTGCCAGG - Intronic
1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG + Intronic
1127628618 15:60804489-60804511 CAGCATCTGAATCTGAAGCCAGG + Intronic
1129596252 15:76966758-76966780 CTGCATATGCCTCTTGTTCCTGG - Intergenic
1130881782 15:88061649-88061671 CTGCTTCTTCATCTGGTGCCTGG + Intronic
1131435652 15:92419495-92419517 CAGGACCCGCATCCTGTGCCTGG + Intronic
1132817577 16:1839856-1839878 CAGGAACTGTGTCTTGTGCCTGG + Exonic
1133743349 16:8668351-8668373 CAGCAGCTGCCTGTTGGGCCTGG + Intergenic
1133802074 16:9092199-9092221 CAGCTTCTGCTGCTTGTGCTCGG - Exonic
1134658133 16:15963327-15963349 CTGCAGCTACATCGTGTGCCTGG - Intronic
1139553816 16:67693201-67693223 CTGCATCTGCATATTTAGCCAGG + Intronic
1140988432 16:80183478-80183500 CAGCATTTGTCTTTTGTGCCTGG - Intergenic
1141311062 16:82913623-82913645 CAGCGATCGCATCTTGTGCCTGG - Intronic
1143658825 17:8312528-8312550 GGGCATCTGCATCCTGAGCCCGG - Exonic
1144814604 17:18025253-18025275 CAGCAGCTGCATCTGTAGCCAGG - Intronic
1146523746 17:33547976-33547998 CTGAACCTGTATCTTGTGCCTGG - Intronic
1147693979 17:42337799-42337821 CAGCTGCTGCATCTTCTGCCTGG + Exonic
1148529582 17:48376955-48376977 CTCCCTCTGCATCTTGGGCCTGG - Intronic
1150132881 17:62678774-62678796 CTGCATCTGCTGCTGGTGCCAGG + Intronic
1151230995 17:72685004-72685026 CACCATTTGTATCTTGTGTCTGG - Intronic
1151795988 17:76346074-76346096 CAGCATCTCCAGCAGGTGCCTGG - Intronic
1152705798 17:81843025-81843047 CTGCATCTGCACCTCGTCCCAGG + Intergenic
1154030833 18:10752773-10752795 CAGGATCAGCATCTTTTGCATGG - Exonic
1157201428 18:45663211-45663233 TAGCATCAGCATCATCTGCCTGG - Intronic
1159753923 18:72339688-72339710 CATGATGTGCATCTGGTGCCTGG - Intergenic
1161569867 19:5024541-5024563 CAGCAGCTGCATCTTATGGGCGG - Intronic
1164521170 19:28981504-28981526 CAGGATTTGCCTCCTGTGCCTGG + Intergenic
1164558171 19:29269357-29269379 CAACAGCTGCTCCTTGTGCCAGG + Intergenic
1165242053 19:34476789-34476811 CAGAACGTGCATCTTGAGCCTGG + Intergenic
1165407883 19:35642015-35642037 CTGCCTCTGCAACTTGAGCCTGG + Exonic
1165434985 19:35790599-35790621 CAGCTTCTGCATCCTGATCCAGG - Intergenic
1166334895 19:42099775-42099797 CAGCAGCTGGTGCTTGTGCCAGG - Exonic
1168471697 19:56645572-56645594 CAGGTTCTGAATCTTGTGCCTGG + Exonic
926220661 2:10933667-10933689 CATCACCTGCATCTGGTTCCAGG + Intergenic
926767129 2:16331207-16331229 TTGCATCTGCATCCTGTGGCAGG - Intergenic
927672287 2:25078884-25078906 CAACATCTCCAGCTTGTGGCCGG + Intronic
927813675 2:26195185-26195207 CAGCAGCTGCATCTTGTCCACGG + Exonic
935470707 2:103456359-103456381 CAGCATCTTCAGCTTGTGGATGG + Intergenic
936111177 2:109666083-109666105 CAGAATCTGTCTCTTTTGCCAGG - Intergenic
936375805 2:111940526-111940548 TAGCAACTGCATCCTGTGTCAGG + Intronic
938989410 2:136612497-136612519 CAGCAGCTGCTTCTTGGGCATGG - Intergenic
941193992 2:162423447-162423469 CAGCATCTGCATGTGGTACCTGG + Exonic
941403031 2:165055279-165055301 CAGCAACTGATTCTTGTGCTAGG + Intergenic
944349782 2:198713304-198713326 CAGCATTTGCATTTTGGGCCAGG - Intergenic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
944766179 2:202866360-202866382 CAGCATCTGCATCTGATGAGGGG - Intronic
945414636 2:209555873-209555895 CAGCATCTGCAGTTTGTAACAGG + Intronic
946473197 2:219981989-219982011 CAGCCTCTGGGTATTGTGCCTGG - Intergenic
948656817 2:239481367-239481389 CAGTGTTTGCATTTTGTGCCTGG + Intergenic
1170196274 20:13692750-13692772 CAGCATCTGCATCTGGTTAGGGG - Intergenic
1171437679 20:25135802-25135824 CCGCATCCTCATCTGGTGCCGGG + Intergenic
1173411708 20:42817013-42817035 CAGCCTCTGCTTCTTGTTCTAGG - Intronic
1173741024 20:45402048-45402070 CAGCATCTGCATCTTGCACCTGG + Intronic
1173815866 20:45987661-45987683 AAGCATCTGCATCTTTTGGAAGG - Intergenic
1174068935 20:47886542-47886564 GAGCTGCTGCCTCTTGTGCCCGG + Intergenic
1174681778 20:52415623-52415645 CAGAATCTGCATTTTTTTCCAGG + Intergenic
1174783751 20:53413342-53413364 CAGCACCTGCATCCTTTGTCTGG - Intronic
1178035435 21:28577299-28577321 CAGCATCTACTACTTGTGCTGGG + Intergenic
1178254951 21:31043981-31044003 CAGCATCTGCAGCAGGAGCCTGG - Intergenic
1178394432 21:32229304-32229326 CTGCATCTGCAGCAGGTGCCAGG + Intergenic
1179804623 21:43829352-43829374 CAGCATTTGGCTCTCGTGCCTGG + Intergenic
1184235489 22:43180869-43180891 CAGCAGCTGCAGCAGGTGCCCGG - Exonic
1184596710 22:45518367-45518389 CAGCATCTCCAGCATGTGGCTGG + Intronic
1184928109 22:47658509-47658531 CAGAATCTGCATCTTTCTCCTGG + Intergenic
1185339161 22:50283940-50283962 CAGCGACTGCAGCCTGTGCCGGG - Exonic
950530725 3:13550997-13551019 CAGGATCTGCATCTCCTGGCTGG + Intronic
951288821 3:20850100-20850122 CAGCATCTGCCTCTGGTGAGGGG + Intergenic
951580108 3:24153652-24153674 CTGAATCAGCATCTTGTGTCTGG - Intronic
954434774 3:50490178-50490200 CAAAATCTGCAGCTTGTCCCAGG - Intronic
955467169 3:59249320-59249342 CAGCAACTGAATCATGTGCAGGG + Intergenic
958671842 3:97216158-97216180 CAGCATCTGCTTCTGGTGAGGGG + Intronic
960157194 3:114307999-114308021 CAGCAGGTGCAGCTTCTGCCTGG - Exonic
960973261 3:123154189-123154211 CAGCATCTGTCTCTTGTTCTGGG - Intronic
961397128 3:126602366-126602388 CATGATGTGCATCTGGTGCCTGG + Intronic
961989795 3:131176230-131176252 CAGCTTCTCCATCTTGGGCTGGG - Intronic
967399115 3:189041017-189041039 GAGCACCTGCATCTTGAACCAGG + Intronic
968039801 3:195579450-195579472 CAGCATCACCATCTTGGGGCTGG + Exonic
968847875 4:3057006-3057028 CAGCATTTGCCCCTTGTGACTGG + Intergenic
969107182 4:4816386-4816408 CAGCATCTGCTTCTGGTGAGGGG + Intergenic
969356744 4:6632353-6632375 CAGCCTCTGCATCTGCTCCCAGG + Intergenic
969520998 4:7677774-7677796 CTGCATCTGCATCGTCTGCTGGG - Intronic
975256303 4:72239661-72239683 CAGCATTGGCATGTGGTGCCTGG - Intergenic
975912237 4:79280624-79280646 CAGTTTCTGTTTCTTGTGCCTGG + Intronic
977626987 4:99198227-99198249 CAGTATCTGCTTCTGATGCCTGG + Intergenic
978334068 4:107647066-107647088 CTGCATTTGCATCCTGTCCCTGG - Intronic
978939594 4:114420480-114420502 GTGCATCTGCATCTTGTTACTGG - Intergenic
982065249 4:151649438-151649460 CAGCCTCTGCCTCCTGTGCAGGG + Exonic
982207676 4:153009195-153009217 CAGCATTTTCCTCTTGGGCCTGG + Intergenic
982392006 4:154874815-154874837 CAGCATCTAAATCTTGTTGCAGG - Intergenic
983256360 4:165404830-165404852 CAGCAGCTGCATCTTGTCTGCGG + Intronic
986754109 5:10818566-10818588 AGGCAGCTGCACCTTGTGCCTGG + Intergenic
991302006 5:65137849-65137871 CATCCTCTGCTTCTTGGGCCCGG - Intergenic
991906956 5:71524164-71524186 CAGCATCATCATCTTCTTCCTGG - Exonic
992182050 5:74207121-74207143 CAGCATGTGCAGCTCCTGCCTGG + Intergenic
992218031 5:74544830-74544852 CAGGCTCTGCAGCATGTGCCTGG - Intergenic
992530926 5:77651013-77651035 AAGCAGCTGCCTCTTGGGCCTGG - Intergenic
993969992 5:94407583-94407605 CAGTATGTGCATTTTGTGTCCGG - Intronic
997114330 5:131109803-131109825 CAGCATCAGCATCAAGTTCCTGG + Intergenic
998803017 5:145890112-145890134 CAGCATCTTCTTCTGTTGCCAGG + Intergenic
999010704 5:148035846-148035868 TAGCAGGTGCTTCTTGTGCCTGG - Intronic
1000223676 5:159237512-159237534 CAGTATCTGCTTCTGGAGCCAGG + Intergenic
1000501604 5:162057797-162057819 GAGCATATGCAGTTTGTGCCAGG + Intergenic
1000889789 5:166788663-166788685 AAGCATCAGCATCTTGAGCATGG + Intergenic
1001777393 5:174338909-174338931 CAGCATCAGTATCCTGTTCCAGG + Intergenic
1002302167 5:178263297-178263319 CAGCAGCTCCATCTTGTCCTTGG + Exonic
1002468899 5:179422943-179422965 CAGCATCTGCATGGTGTCCTCGG - Intergenic
1003129379 6:3382210-3382232 CAGCATCTGAGGCTTGAGCCTGG - Intronic
1003697110 6:8419639-8419661 CGGCATCTGCACATAGTGCCAGG + Exonic
1004107363 6:12678173-12678195 CAGCATGAGCTTGTTGTGCCAGG - Intergenic
1005121326 6:22392536-22392558 CAGCATCTGCTTCTGGTGACGGG + Intergenic
1005256831 6:24012274-24012296 TAGCATTTGCCTTTTGTGCCTGG - Intergenic
1007331261 6:41111303-41111325 CAGCATCTTCAGCTTCTGCTGGG + Intergenic
1007926085 6:45650921-45650943 CTGCTTCTGCATCTTCAGCCAGG - Intronic
1007986802 6:46215433-46215455 CAGCATCTGCATCTGCATCCCGG - Intergenic
1009848713 6:69167740-69167762 CAGCTTCTGCACCTTGTGGGAGG - Intronic
1011930904 6:92711272-92711294 CAGCATCTGCAACTTGTACTGGG - Intergenic
1013765199 6:113566167-113566189 CAGAATCTCCACCTTGGGCCAGG - Intergenic
1014906428 6:127035003-127035025 CTGCATTTGCATCTTGAGCTTGG + Intergenic
1015396844 6:132744260-132744282 CAGCTTCTGCATCATATGCTTGG - Exonic
1016948985 6:149562160-149562182 CAGGGTCTGCATCTTGGCCCTGG + Intergenic
1022551331 7:31242268-31242290 CAGCATCTGCATCTTTTGGTTGG - Intergenic
1023028202 7:36070946-36070968 CAGCAGTTACATCATGTGCCAGG + Intergenic
1026198048 7:68189957-68189979 CAACATCTGAATCTTGGGGCAGG - Intergenic
1026869181 7:73840435-73840457 CAGCCTCTGCACCCTGGGCCAGG - Exonic
1026915915 7:74120457-74120479 CGGCATCTGCCTCCTGGGCCTGG + Intronic
1027014770 7:74772807-74772829 CAGCCCCTCCATCTAGTGCCTGG - Intergenic
1027073261 7:75173148-75173170 CAGCCCCTCCATCTAGTGCCTGG + Intergenic
1028729824 7:94133477-94133499 CAGCATCTGAACCTTGGTCCAGG + Intergenic
1029532073 7:101132101-101132123 CAGCAACTGCATCTCATTCCTGG + Intronic
1030986695 7:116250162-116250184 TAGCATCTGCATGTACTGCCTGG - Exonic
1032198094 7:129800815-129800837 CAGCATCTGCAGCATGAGGCAGG + Intergenic
1032272446 7:130422520-130422542 CAGCCTATGCATTATGTGCCAGG - Intronic
1033238750 7:139659485-139659507 CTGCAGCTGCAGCTTGTGCACGG + Intronic
1033448162 7:141439846-141439868 CAGGATCTGAACCTTGTGCCTGG - Intronic
1034627514 7:152504728-152504750 CAGGGTCTGCATCTGGTGCCAGG - Intergenic
1034841455 7:154401428-154401450 CTGCATCTGCATCTTTTCTCAGG - Intronic
1039575979 8:38624370-38624392 CAGCATCTGCGTCTTGAGTAGGG + Intergenic
1044319358 8:90785201-90785223 TTTCATCTGTATCTTGTGCCTGG - Intronic
1047151100 8:122264035-122264057 CAGGCACTGCATCTTCTGCCGGG + Intergenic
1047887680 8:129270574-129270596 CAGCCTCTGCATCTGGAGGCAGG + Intergenic
1048175321 8:132147127-132147149 CAGCAGTAGCATCTTTTGCCTGG - Intronic
1048876825 8:138843191-138843213 CAGCATCTGCATCTTGTGCCTGG - Intronic
1049473924 8:142788205-142788227 CCACATTTGCATCTGGTGCCTGG + Intergenic
1050825461 9:9939982-9940004 CTGAATATGGATCTTGTGCCAGG + Intronic
1051220895 9:14847186-14847208 CAGCAGTTGCATCTTCTCCCTGG + Intronic
1052357282 9:27518058-27518080 CAGCATGTGAATCCTCTGCCAGG + Intronic
1055141955 9:72886582-72886604 CAGCATGGGCACCTTGAGCCTGG - Intergenic
1056093897 9:83231642-83231664 CAGCCTCAGAATCTTGTCCCTGG - Intergenic
1056214981 9:84398159-84398181 CAGCATCTGCTTCCTGGCCCGGG - Intergenic
1057569262 9:96191527-96191549 CTGCATTTGCATTTTGTTCCTGG - Intergenic
1059250786 9:112886425-112886447 CAGCATCTGCTGCTTGGGCTGGG - Intronic
1185515290 X:694757-694779 CTGCACCTGCGTCTTATGCCAGG - Intergenic
1186397240 X:9222465-9222487 CAGCATCTGCAGCTCGCTCCAGG - Intergenic
1186471061 X:9822520-9822542 CAGTATCCGCATCTGGTGCAGGG + Intronic
1188407919 X:29835047-29835069 CAGCATCTGGATTTTGTTTCTGG - Intronic
1192001866 X:67159630-67159652 CAGCACCTGCATCTTGCTCAAGG - Intergenic
1193960519 X:87919659-87919681 TAGCATCTGCATCTGCTGACTGG + Intergenic
1194513786 X:94825160-94825182 CAGTATCTGCTTCTGATGCCAGG + Intergenic
1198933626 X:141884890-141884912 CAGTATCTGCTTCTGGAGCCAGG - Intronic
1199050351 X:143229725-143229747 CAGCATTTGCATTCTGTGCCTGG + Intergenic
1201058435 Y:10018831-10018853 CAGCATCTGCATATAGTGAGGGG + Intergenic