ID: 1048879313

View in Genome Browser
Species Human (GRCh38)
Location 8:138859713-138859735
Sequence TGACCTCAGTCTACAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048879313_1048879324 18 Left 1048879313 8:138859713-138859735 CCTCCCATTGTAGACTGAGGTCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1048879324 8:138859754-138859776 CAAAGGGGCATGCTAAGGGATGG No data
1048879313_1048879325 19 Left 1048879313 8:138859713-138859735 CCTCCCATTGTAGACTGAGGTCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1048879325 8:138859755-138859777 AAAGGGGCATGCTAAGGGATGGG No data
1048879313_1048879320 2 Left 1048879313 8:138859713-138859735 CCTCCCATTGTAGACTGAGGTCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1048879320 8:138859738-138859760 TCTGAGGATCTGCAGGCAAAGGG No data
1048879313_1048879326 25 Left 1048879313 8:138859713-138859735 CCTCCCATTGTAGACTGAGGTCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1048879326 8:138859761-138859783 GCATGCTAAGGGATGGGCATCGG No data
1048879313_1048879321 3 Left 1048879313 8:138859713-138859735 CCTCCCATTGTAGACTGAGGTCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1048879321 8:138859739-138859761 CTGAGGATCTGCAGGCAAAGGGG No data
1048879313_1048879322 13 Left 1048879313 8:138859713-138859735 CCTCCCATTGTAGACTGAGGTCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1048879322 8:138859749-138859771 GCAGGCAAAGGGGCATGCTAAGG No data
1048879313_1048879323 14 Left 1048879313 8:138859713-138859735 CCTCCCATTGTAGACTGAGGTCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1048879323 8:138859750-138859772 CAGGCAAAGGGGCATGCTAAGGG No data
1048879313_1048879327 30 Left 1048879313 8:138859713-138859735 CCTCCCATTGTAGACTGAGGTCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1048879327 8:138859766-138859788 CTAAGGGATGGGCATCGGTGTGG No data
1048879313_1048879319 1 Left 1048879313 8:138859713-138859735 CCTCCCATTGTAGACTGAGGTCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1048879319 8:138859737-138859759 CTCTGAGGATCTGCAGGCAAAGG No data
1048879313_1048879317 -5 Left 1048879313 8:138859713-138859735 CCTCCCATTGTAGACTGAGGTCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1048879317 8:138859731-138859753 GGTCACCTCTGAGGATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048879313 Original CRISPR TGACCTCAGTCTACAATGGG AGG (reversed) Intronic
903878451 1:26492310-26492332 TGACCTCAGTCTGCAGTTGTTGG - Intergenic
909224255 1:72996591-72996613 TGACCTCACTATATCATGGGAGG - Intergenic
913597461 1:120392696-120392718 TGCCCTCAGTGTGCAATGGTGGG + Intergenic
914089869 1:144486618-144486640 TGCCCTCAGTGTGCAATGGTGGG - Intergenic
914308741 1:146447598-146447620 TGCCCTCAGTGTGCAATGGTGGG + Intergenic
914593368 1:149125533-149125555 TGCCCTCAGTGTGCAATGGTGGG - Intergenic
924872735 1:248066552-248066574 TGACCTCAGTCCAACATGTGTGG - Intronic
1064463659 10:15558546-15558568 TGGCCCCACTCTACAATGAGAGG - Intronic
1065501255 10:26384921-26384943 TGAGCTCATTCTGCAAAGGGAGG + Intergenic
1083989063 11:66235583-66235605 TGAACTCAGGCTCCTATGGGTGG - Intronic
1089668020 11:120032631-120032653 GGAACTCAGTCTAAAGTGGGTGG - Intergenic
1092442203 12:8515585-8515607 TGATCCCAGTCCAAAATGGGGGG - Intronic
1096556612 12:52407868-52407890 AGACCACAGGCCACAATGGGAGG + Intergenic
1098231263 12:68373961-68373983 TGCCCACAGTCTACACTGAGAGG + Intergenic
1099691393 12:85957296-85957318 TGACCTCATTATAGAATGAGGGG - Exonic
1101110697 12:101482723-101482745 TGACTTCAGCCTATAATAGGGGG + Intronic
1101670473 12:106867042-106867064 TAACTTCAATCTACAATGTGTGG - Intronic
1105830349 13:24158762-24158784 GGACCTCACTCTGCATTGGGTGG - Intronic
1108721057 13:53132701-53132723 TGACCTCAGGATGCAATGAGTGG + Intergenic
1117379176 14:55143366-55143388 GGACCACAGTCTACATTTGGTGG + Intronic
1119557185 14:75562320-75562342 TTACCTCAGTCTAAAACGTGTGG + Intergenic
1121517806 14:94564663-94564685 TGACTTCATGCTACAATGGCAGG + Intronic
1123965616 15:25453940-25453962 TGCCTTCACTCTACAATGGCAGG - Intergenic
1124089867 15:26588833-26588855 TGACCCTATTCCACAATGGGTGG - Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1139231228 16:65284399-65284421 TGATCTCAGTGTACAATGTATGG + Intergenic
1139523591 16:67499475-67499497 TAACCTCAGTCTTCAGTTGGGGG - Intergenic
1140134158 16:72190430-72190452 TGACCTCAGTGAACACAGGGTGG + Intergenic
1142491904 17:284911-284933 AGACCTCACTCTACTGTGGGAGG - Intronic
1144654727 17:17028358-17028380 TGGCCTCAGTCCACACAGGGTGG - Intergenic
1146485605 17:33240175-33240197 TGACCTGAGTCTACAGAGTGAGG + Intronic
1148390263 17:47267201-47267223 TGACCCCAGTCTTCACAGGGTGG - Intronic
1148468205 17:47877491-47877513 TCTCCTCAGTCTACAAAGGGTGG + Intergenic
1151462733 17:74264335-74264357 TGACCTCTGCCCACCATGGGTGG - Intergenic
1164310891 19:24045353-24045375 ATACCTCAGTCTACAAGGGGAGG - Intronic
1166814374 19:45533711-45533733 TCACTTCAGTCTCCTATGGGAGG + Intronic
925757218 2:7145060-7145082 GCACCTCTGTCTGCAATGGGCGG - Intergenic
929755513 2:44760990-44761012 TGACCTAACTCTACACTGGAGGG + Intronic
929992073 2:46798592-46798614 TGGTCTCAGTTTGCAATGGGAGG + Intergenic
937840529 2:126519901-126519923 TGCCCTCACTCCACAAAGGGAGG + Intergenic
945305416 2:208254915-208254937 TAACCTCAGGCTCCAAGGGGCGG - Intronic
1172206671 20:33167410-33167432 TGACCTCAGCCTGATATGGGTGG + Intronic
1179294280 21:40046865-40046887 TGAGCTCACTCTCCAATGGTGGG + Intronic
1179369121 21:40787861-40787883 TTTCCTCAGTATACAATTGGGGG - Intronic
1184291163 22:43498807-43498829 TGACCTCAGTGTGGATTGGGTGG - Intronic
1184478022 22:44731875-44731897 TGGCCTCACTCTACAGAGGGGGG + Intronic
950542459 3:13620559-13620581 TGGCCTCATTTTACAGTGGGGGG - Intronic
951806543 3:26650471-26650493 TGACCTCAGTCTGCCACTGGTGG - Intronic
952509110 3:34036353-34036375 TGCCCTCAGCCTGGAATGGGAGG - Intergenic
954745200 3:52783860-52783882 TGAGCTCAGTCTAGAAAGAGGGG + Intronic
962158844 3:132977917-132977939 AGACCCCAGCCTTCAATGGGAGG + Intergenic
969691792 4:8707924-8707946 TGACCTCAGTGTATGATAGGGGG - Intergenic
974168984 4:58241663-58241685 TGACCTCATTCAACAATAGGAGG - Intergenic
976630709 4:87233256-87233278 TGATCTCAAACTCCAATGGGAGG + Intronic
979431556 4:120638900-120638922 TGGCATCAGTCTGAAATGGGAGG - Intergenic
995677385 5:114677756-114677778 TGACCTCAGTCTAGCTTGGTAGG + Intergenic
1000920115 5:167128288-167128310 CGACCTCAGTTTACTATGGAAGG + Intergenic
1001962097 5:175885670-175885692 GGAGCTCAGTGTGCAATGGGAGG + Intergenic
1002985846 6:2190517-2190539 TGACCTCAGGAAACACTGGGTGG - Intronic
1006980690 6:38145502-38145524 TTACCTCTGTCTACACAGGGAGG - Intronic
1007542588 6:42661850-42661872 GGAGCTCAGGGTACAATGGGAGG + Intronic
1016044426 6:139466674-139466696 TGACTACAGTCTAAAATGGTGGG - Intergenic
1016057146 6:139590247-139590269 AGATCTCAGTCTACAAAGGTAGG - Intergenic
1016323503 6:142873957-142873979 TGACTTCGGTCTGAAATGGGAGG + Intronic
1017902199 6:158727880-158727902 TGACATCAGTAGACAAGGGGAGG + Intronic
1032682900 7:134203689-134203711 TGTGCTCAGTCTACAAAGTGGGG + Intronic
1041552153 8:59115197-59115219 TGACCTCGGCCTGCAGTGGGAGG - Intronic
1042441196 8:68828690-68828712 TGCCCCCAGGCTACAATGGAGGG - Intergenic
1044455480 8:92388004-92388026 AGACCTCAGTCTACAACAAGTGG - Intergenic
1044484720 8:92738400-92738422 TAAGATCAGTGTACAATGGGAGG - Intergenic
1045390460 8:101709812-101709834 TGACCTCAGCCACCAATGGGAGG + Intronic
1048879313 8:138859713-138859735 TGACCTCAGTCTACAATGGGAGG - Intronic
1051702821 9:19842617-19842639 AGACCTTAGTCTCCAAGGGGGGG + Intergenic
1052091250 9:24330267-24330289 TCACTTCAAACTACAATGGGTGG - Intergenic
1058560560 9:106224800-106224822 TGTCCTCAGTTTACAAAGGAAGG + Intergenic
1058600615 9:106665908-106665930 TGATGTCAGTGTACCATGGGTGG - Intergenic
1059568280 9:115406396-115406418 TGTCCTCAGTCTAGAATGTAAGG + Intergenic
1061927336 9:133812339-133812361 GGGCCTCAGTCTACAAAGTGGGG + Intronic
1062198872 9:135290136-135290158 TGAGCTCAGTCCACATTAGGTGG + Intergenic
1062446018 9:136595287-136595309 TGACTTCAGCCTCCACTGGGAGG + Intergenic
1187827162 X:23343347-23343369 TGACCTCAGTCCCCAATCAGTGG + Intronic
1189117483 X:38358145-38358167 AGACCTCATTCTTCAATAGGAGG - Intronic
1190433998 X:50405506-50405528 TGACATCAGTTGACAGTGGGGGG + Intronic
1195617927 X:106927699-106927721 TGGCCTCAGTCTGCAATTGAGGG + Intronic
1196056959 X:111366310-111366332 TGAAATCAGTCTACAATGTCAGG - Intronic
1196759757 X:119190533-119190555 TGCCCTCAGTCTAGAATGAAGGG + Intergenic