ID: 1048881186

View in Genome Browser
Species Human (GRCh38)
Location 8:138874049-138874071
Sequence GCAGCTAGTGAGATTGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048881186 Original CRISPR GCAGCTAGTGAGATTGAATC AGG (reversed) Intronic
905081892 1:35330101-35330123 GCTGCTTGGGAGATTGAGTCAGG + Intronic
906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG + Exonic
909238692 1:73183861-73183883 GCAGGTAATGAGAATGAGTCAGG - Intergenic
909447286 1:75761194-75761216 GCAGCTTGGGAGGTTGATTCTGG + Exonic
909732245 1:78907780-78907802 GCAGCCAGTGTGACTGAATATGG + Intronic
910850682 1:91647195-91647217 TCAGCTAGTCTGATTGAAGCAGG - Intergenic
911547301 1:99233777-99233799 TAAGCTACTGACATTGAATCAGG + Intergenic
912958495 1:114173846-114173868 GCAGAGAGTTAGATTTAATCAGG + Intergenic
915662191 1:157413725-157413747 GCAGCTTGTGTGACTGAGTCTGG - Intergenic
916228971 1:162520138-162520160 GCACTTAGGGAGACTGAATCGGG - Intronic
916593996 1:166224987-166225009 GCAGCTAGAGAGATAGAGGCAGG - Intergenic
916948666 1:169757433-169757455 CCAGCTAGTAAGTTAGAATCTGG - Intronic
916950633 1:169776826-169776848 GCAGATAGTGGGATTTAAACAGG - Intronic
1072682750 10:97518328-97518350 GCAGCTAGGGAGAAAGAACCAGG - Intronic
1075290443 10:121225481-121225503 GCAGCTAGTGAGTTTTATTTTGG + Intergenic
1076469375 10:130708040-130708062 GCAGCTCCTGAGATTGGAACAGG + Intergenic
1081245084 11:40755984-40756006 GAAGCCAGTCAGATTGAAACAGG - Intronic
1081988904 11:47327162-47327184 GCTGCTAGAGAGATTGCAGCAGG - Intronic
1083240674 11:61385829-61385851 ACAGGTACTGAGAGTGAATCTGG + Intergenic
1084805366 11:71575216-71575238 GCTGCTGGTGAAATTGAATATGG - Intergenic
1087640533 11:100750478-100750500 GCAGATAGTCAGAATGAGTCAGG + Intronic
1087646441 11:100813589-100813611 GCAGAGAGTGAGAGTGAATTAGG + Intronic
1093809767 12:23477203-23477225 CCAGGTAATGAGATTGAAACAGG + Intergenic
1094583788 12:31758491-31758513 GCAGGTAATGGGAATGAATCAGG - Intergenic
1095864809 12:46959748-46959770 GCAGCTTGTGAAATTCAAGCAGG + Intergenic
1098175064 12:67781650-67781672 GCAGATAGTCAGATTTAACCAGG + Intergenic
1101377895 12:104186784-104186806 GTAGCTAGAAAGAATGAATCTGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1112156395 13:96822166-96822188 GCTGCCAGTGAGACTGAATTGGG + Intronic
1118318396 14:64739110-64739132 GCAGCTAGTGGAAATGAACCAGG + Intronic
1122928393 14:104921485-104921507 GTAGCTGCCGAGATTGAATCAGG - Intergenic
1130213313 15:81945923-81945945 GCCACTAGTTATATTGAATCAGG + Intergenic
1131907082 15:97154548-97154570 GTAGCAAGTGAAATTGAACCCGG - Intergenic
1134805937 16:17125445-17125467 GCAGCAAGTGAGAAGGAAACTGG - Intronic
1135197063 16:20403399-20403421 GCTGCTAGGGAGGTTGAAGCAGG - Intronic
1137459335 16:48645404-48645426 GCAAGTATTGATATTGAATCAGG - Intergenic
1139030492 16:62875274-62875296 GAAGCTAGTCAGATTGGATTAGG + Intergenic
1141351777 16:83304796-83304818 GCTGCTAGTAAGAGTGAATTAGG + Intronic
1149520800 17:57316959-57316981 GCACCTAGGGAGATAGAATCAGG + Intronic
1150253629 17:63725461-63725483 GCTGCTAGGGAGACTGAAGCAGG - Intronic
1151344170 17:73491670-73491692 AGAGCTGGTGGGATTGAATCTGG - Intronic
1152261813 17:79271467-79271489 GCGGCTAATGAGCTTGAGTCCGG - Intronic
1155886837 18:31218210-31218232 GCAGCTAGTGAGATCTTTTCGGG - Intergenic
1158086492 18:53657477-53657499 GAAGCTATTGAGATGGGATCTGG + Intergenic
1162666270 19:12215418-12215440 CAACCTACTGAGATTGAATCAGG - Intergenic
1165282821 19:34812928-34812950 GCAGCTTGTGTTCTTGAATCTGG + Intergenic
1167886687 19:52505812-52505834 GGAGCTTGTGAGGTTGAATGAGG + Intronic
1167892064 19:52548337-52548359 GGAGCTTGTGAGGTTGAATGAGG + Intronic
925634950 2:5934038-5934060 GAGGCAAGTGAGATTTAATCAGG - Intergenic
926277799 2:11418074-11418096 CCTGCTAGTGAAAATGAATCTGG + Intergenic
937458209 2:122062370-122062392 GCAGCTAGGGAGAGTGAGGCAGG - Intergenic
937823449 2:126338117-126338139 AAATCTAGTAAGATTGAATCAGG + Intergenic
937856517 2:126675549-126675571 GAAGCTACTGAGAAAGAATCAGG - Intronic
938051614 2:128177877-128177899 GGAACGAGTGAGAATGAATCTGG + Exonic
938084066 2:128386682-128386704 GATACTAGTGAGATTGGATCAGG + Intergenic
939355205 2:141092680-141092702 ACAGCTAATGAGATAGAAACAGG + Intronic
940339328 2:152563186-152563208 GCAGATAGGGAAATTGTATCTGG + Intronic
942632832 2:177970549-177970571 GAAGTTAGTGAGTTTGATTCAGG + Intronic
942812339 2:180013925-180013947 GCAGATACTGAGATAGAAACAGG + Intergenic
943264818 2:185715379-185715401 CAATCTACTGAGATTGAATCAGG - Intergenic
945187463 2:207154194-207154216 GCAGCTTATGAGAGTGAATCAGG - Intronic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
948358526 2:237399952-237399974 GCTGATAATGAGATTGAGTCTGG - Intronic
1178251544 21:31008172-31008194 GTAGCTATTATGATTGAATCAGG - Intergenic
1182164122 22:28155067-28155089 CCAGCCAGGGAGACTGAATCAGG - Intronic
949204769 3:1424768-1424790 GCAGCTAGTGTGAAGGAGTCAGG + Intergenic
952725479 3:36579774-36579796 GAAGGGAGTGAGATTGAATTGGG + Intergenic
954969668 3:54640504-54640526 GCAGCTAGAGTGACTGAATATGG - Intronic
955446910 3:59021630-59021652 GCAGCTACACAGATTGAACCTGG + Intronic
956862535 3:73339012-73339034 GCAGCTGGTGAGATTGAGGTGGG + Intergenic
957922196 3:86760152-86760174 GTAGCCAGTGAGATATAATCAGG + Intergenic
958217162 3:90600920-90600942 GCAGTTTCTGAGAATGAATCTGG + Intergenic
960668163 3:120131223-120131245 GCAGCTAGGGACCTTGAATTTGG - Intergenic
962065008 3:131970416-131970438 GCAGCTAATGAGACTTAATGGGG - Intronic
963948356 3:151170810-151170832 GCAGGTAGTGGGAATGAGTCGGG + Intronic
965148403 3:164937599-164937621 GCAGCTTGTGAGAGCGAATAGGG - Intergenic
965509680 3:169554770-169554792 GCAGCTAGTCAGGCTGAATCTGG + Intronic
966421307 3:179737137-179737159 GCAGCTAGTAGGATGGACTCAGG + Intronic
968111913 3:196055434-196055456 GCAGATAATGAGATAGAATTGGG - Intronic
969354495 4:6617468-6617490 TCAGCCAGTGACAGTGAATCTGG + Exonic
970331223 4:14986392-14986414 GCAGATAAGGAGATTGAAACTGG - Intergenic
973564527 4:52170843-52170865 GCAGCCAGGAAGATTGAATTGGG - Intergenic
976012745 4:80510967-80510989 CCATCTAGTGAGAATGAATTTGG + Intronic
980698305 4:136389607-136389629 CCAGGTACTGAGCTTGAATCTGG + Intergenic
984428261 4:179615358-179615380 GGAGATACTGAGATAGAATCTGG + Intergenic
986647096 5:9928115-9928137 GCAGCTCTAGAGAGTGAATCAGG + Intergenic
987286514 5:16463317-16463339 ACAAATAGTGAGATTTAATCTGG - Intronic
989388642 5:40877887-40877909 GCAGGTAATCAGAATGAATCAGG + Intergenic
990877298 5:60500060-60500082 GCACTTAGGGAGATTGAAACAGG + Intronic
991289552 5:65019482-65019504 GTAGCTGGTGAGATTTTATCAGG - Intergenic
997316781 5:132943141-132943163 GCAGCTGGTGAATTTGAAGCTGG + Intronic
998255401 5:140583109-140583131 CCAGGTAAAGAGATTGAATCGGG + Intronic
998595228 5:143522356-143522378 GCAGCTAAGGAAATTGAAGCAGG + Intergenic
998849391 5:146339069-146339091 GCAGCGGGTGACATGGAATCAGG - Exonic
1002290569 5:178197866-178197888 GCTGCTAGGGAGGTTGAAGCGGG + Intergenic
1002308127 5:178296357-178296379 GCACCTAGTGAGGTTGCAGCAGG - Intronic
1004495305 6:16157243-16157265 GCAAGTAGTGAGATTTAAGCTGG - Intergenic
1008198520 6:48556473-48556495 GCATCTAGTCAAATTGAATTTGG + Intergenic
1009768723 6:68117786-68117808 GCAGATAGTGAGATAAAATCTGG + Intergenic
1015405803 6:132835733-132835755 GCAGACAGTCAGATTGAATTAGG - Intergenic
1024500922 7:50104832-50104854 GAAGCTAGTGAGAATGCAGCTGG - Intronic
1024555434 7:50599510-50599532 GCAGATAATGGGATTGATTCAGG - Intronic
1031696250 7:124858143-124858165 ACAGCTAGTTGGATTGAAGCAGG - Intronic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1036941523 8:13057012-13057034 CCAGCTAGTGAGATTGAAGTGGG + Intergenic
1039850519 8:41360937-41360959 GCAGCAAGTGAGAAGGAAGCTGG + Intergenic
1040579521 8:48685909-48685931 GCAGCTGGTGATAGTGAACCAGG - Intergenic
1043387666 8:79764529-79764551 GCAGCTGGTCAGATGGATTCAGG + Exonic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1055831677 9:80386464-80386486 GCAGCTTGTGGCATTGAATAGGG + Intergenic
1057919576 9:99085994-99086016 CCAGCAACTGAGATTGAATGAGG - Intergenic
1057934120 9:99222274-99222296 GCAGCTGGCGAGACTGACTCAGG - Intronic
1058069863 9:100591038-100591060 GCAGCTAGAGAGATTGTATGAGG + Intergenic
1060571577 9:124645343-124645365 GCAGATTGTTAGAGTGAATCAGG + Intronic
1185951993 X:4447785-4447807 GCTGCTAGTGAGATTGGAAGGGG + Intergenic
1194777689 X:97985188-97985210 GGAGCTAGTAAGATTGAAAATGG + Intergenic
1197767082 X:130066371-130066393 GCAGCCAGTGAGATAGAGCCAGG + Exonic
1199927933 X:152488829-152488851 GCAGCAAATGAGATTGTAGCTGG - Intergenic