ID: 1048882192

View in Genome Browser
Species Human (GRCh38)
Location 8:138880335-138880357
Sequence GCGCGTGCACACACACGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 1, 2: 15, 3: 68, 4: 357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048882192_1048882194 16 Left 1048882192 8:138880335-138880357 CCTGTGCGTGTGTGTGCACGCGC 0: 1
1: 1
2: 15
3: 68
4: 357
Right 1048882194 8:138880374-138880396 ATGCATGACAGAAACTGAGTGGG No data
1048882192_1048882193 15 Left 1048882192 8:138880335-138880357 CCTGTGCGTGTGTGTGCACGCGC 0: 1
1: 1
2: 15
3: 68
4: 357
Right 1048882193 8:138880373-138880395 TATGCATGACAGAAACTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048882192 Original CRISPR GCGCGTGCACACACACGCAC AGG (reversed) Intronic
900214808 1:1475704-1475726 GCGCGTGAATTCACACCCACAGG - Intronic
900222021 1:1514058-1514080 GCGCGTGAATTCACACCCACAGG - Intronic
900293800 1:1938552-1938574 ACACGTTCACACACACACACAGG + Intronic
900295274 1:1946131-1946153 GAGTGTGCACACACGCACACTGG - Intronic
900416395 1:2536982-2537004 GCACACACACACACACGCACAGG - Intergenic
900522870 1:3114686-3114708 CCGGGTGCACACACACACAGAGG + Intronic
900555394 1:3277823-3277845 GCACATGCACACACGTGCACAGG + Intronic
900567655 1:3341565-3341587 ACGCGTGCGCACACACACAGAGG + Intronic
900580928 1:3408509-3408531 GCTCTCACACACACACGCACCGG - Intronic
900580951 1:3408789-3408811 ACGCGCTCACACACACGCACCGG - Intronic
904356859 1:29945986-29946008 GCACGTGCACACACACACACAGG + Intergenic
904979614 1:34486636-34486658 ACACATGCACACACACACACAGG - Intergenic
905166516 1:36086318-36086340 GCTCATACACACACACTCACAGG - Intronic
905174369 1:36126641-36126663 ACGCATGCACACACACACCCAGG - Intergenic
905245176 1:36607833-36607855 ACGCATGAACACACACACACTGG - Intergenic
905291367 1:36923885-36923907 GCATGTACACACACATGCACTGG + Intronic
905449421 1:38047043-38047065 CCGCGTACACACTCACGCCCCGG + Intergenic
906342795 1:44995631-44995653 ACACATGCACACACACACACAGG + Intergenic
908835954 1:68230568-68230590 ACGCGCGCACACACACACACGGG - Intronic
912542357 1:110426650-110426672 CTGTGTGCACACACACACACAGG + Intergenic
913356716 1:117930003-117930025 GCCCGTGCACACGCACGGTCAGG - Intronic
915010738 1:152683889-152683911 ACACATGCACACACACACACAGG + Intergenic
916312036 1:163408431-163408453 GTGCATGCACACACACGCCCAGG + Intergenic
917614440 1:176725706-176725728 GCGCGCACACACACACTCACGGG + Intronic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
920431085 1:205919591-205919613 GCAAGTGCACACAGACACACAGG - Intronic
920818065 1:209354163-209354185 GCGAGCGCACACACACATACAGG + Intergenic
920928039 1:210361326-210361348 GTGCGTGCACGCACACACAATGG + Intronic
922743777 1:228031591-228031613 ACACATGCACACACATGCACAGG - Intronic
922811048 1:228415941-228415963 ACACGCGCGCACACACGCACAGG + Exonic
922831119 1:228555064-228555086 GCGTGCTCACACACACACACAGG - Intergenic
1062787019 10:273242-273264 GCGCTGGCACACACACACACCGG + Intergenic
1062999668 10:1904082-1904104 GTGCATACACACACACACACAGG + Intergenic
1063542806 10:6951267-6951289 GCCAGTGCATACACATGCACTGG + Intergenic
1063928464 10:11004402-11004424 ACGCGCGCGCACACACACACAGG - Intergenic
1065183327 10:23148449-23148471 CCACATGCACACACACGCACAGG - Intergenic
1067222812 10:44356312-44356334 ACACGTGTACACACACACACAGG - Intergenic
1068233473 10:54201747-54201769 GTACGTTCACACACACACACTGG - Intronic
1068708712 10:60107765-60107787 GCACGCGCACACACACACACAGG + Intronic
1069630775 10:69895808-69895830 GCGGATGTACAGACACGCACGGG - Intronic
1069713944 10:70508842-70508864 AGGCCTGCACACACACACACAGG - Intronic
1069860223 10:71466176-71466198 GCACATGCACACACACAGACGGG - Intronic
1070336807 10:75463239-75463261 GAGCGTGCACACACATCCCCGGG + Intronic
1071175642 10:82923797-82923819 ATGCGTGCACACACACACACAGG - Intronic
1071601494 10:86960647-86960669 ACACGTGCACACACACACAAAGG - Intronic
1074310928 10:112322777-112322799 GTGTGTACACACACACACACTGG + Intergenic
1074657771 10:115614699-115614721 GCACACACACACACACGCACTGG - Intronic
1075078501 10:119367734-119367756 GCGTGTGCACTCACAGGGACAGG - Intronic
1075450764 10:122550566-122550588 ACACGTGCACACACACACACAGG + Intergenic
1075450790 10:122550795-122550817 ACACATGCACACACACACACAGG + Intergenic
1075940717 10:126388339-126388361 GCGCACGCACGCACACACACGGG - Exonic
1076534316 10:131167166-131167188 CTGCCTGCACACACAGGCACAGG - Intronic
1076579534 10:131497448-131497470 GCGCGCGCGCACACACACACTGG + Intergenic
1076856936 10:133121575-133121597 GCACAGGCACACACATGCACAGG - Intronic
1077022133 11:421646-421668 GGGCGCACACACACACACACAGG + Intronic
1077052666 11:574806-574828 GGGCGTGCACACACAGGCGGGGG - Intergenic
1077353608 11:2104468-2104490 GAGTGCGCACACACACACACAGG + Intergenic
1077405426 11:2380385-2380407 GAGCCCACACACACACGCACAGG + Intronic
1077443919 11:2581436-2581458 GGGCCTGCACCCACATGCACAGG - Intronic
1077502390 11:2915278-2915300 GCGCACACACACACACACACGGG - Intronic
1080234654 11:30055089-30055111 TCGCGTGCAGACACACACATAGG - Intergenic
1081412599 11:42777355-42777377 ACACATGCATACACACGCACAGG + Intergenic
1082098000 11:48146734-48146756 ATGCATGCACACACACACACAGG - Intronic
1083820634 11:65169505-65169527 ATGCGTGCACACACACAAACAGG + Intergenic
1083856544 11:65395991-65396013 GCGAGGGCACACAGACACACAGG - Intronic
1084389631 11:68866591-68866613 ACACATGCGCACACACGCACAGG + Intergenic
1084725302 11:70937948-70937970 ACACATGCACACACACACACAGG - Intronic
1084949234 11:72655488-72655510 GTGCGTGCACACACACACACAGG - Intronic
1084949254 11:72655792-72655814 GCACGTGCACATGCACACACAGG - Intronic
1085297697 11:75440150-75440172 ACGTGTGCACACACACGCCCCGG - Intronic
1085741660 11:79082589-79082611 ATGTGTGCACACACACACACAGG + Intronic
1086411747 11:86550959-86550981 GCATGTGCACACACACCCAGAGG - Intronic
1087087652 11:94236400-94236422 TCACGTGCAGACACACACACAGG - Intergenic
1087089186 11:94250293-94250315 TCACGTGCAGACACACACACAGG + Intergenic
1088920913 11:114259319-114259341 ACACGTGTACACACACGCAGAGG + Intronic
1089797307 11:120991862-120991884 GTGCACGCACACACACACACTGG - Intergenic
1091215262 11:133897364-133897386 GCACACGCACACACACGCACAGG + Intergenic
1091225156 11:133952531-133952553 GCACGTGCACACAAACACACAGG + Intronic
1091664667 12:2410697-2410719 GCACGCACACACACACACACAGG - Intronic
1091850479 12:3693122-3693144 CTGCCTGCACACACATGCACCGG + Intronic
1093894624 12:24562481-24562503 GCGCGCACACACACACACACCGG - Intergenic
1094473421 12:30823561-30823583 GCACGCACACACACATGCACTGG - Intergenic
1094520927 12:31187860-31187882 ATGTGTGCACACACACACACAGG - Intergenic
1095957546 12:47815321-47815343 ACACATGCACACACACACACAGG + Intronic
1096106537 12:48999425-48999447 GCGCGCGCACACACAGAGACAGG - Intergenic
1098407991 12:70147158-70147180 ATGCGTACACACACACACACAGG + Intergenic
1098796121 12:74890008-74890030 GTGTGTGCACACACACACAGAGG + Intergenic
1101548348 12:105738274-105738296 ACGCGCGCGCACACACACACGGG + Intergenic
1101641252 12:106586964-106586986 GCGCGCACACACACACGCCCGGG - Intronic
1101755587 12:107618494-107618516 ACACGTGCACACACACACAAGGG + Intronic
1103936346 12:124479579-124479601 GCGCATGCACACACACACCCTGG + Intronic
1105438120 13:20394640-20394662 GCGCGGACACACACACCGACAGG + Intergenic
1105746481 13:23381430-23381452 GCGCGCGCACACACACACACAGG + Intronic
1105964645 13:25372875-25372897 GCGCGCGCACACACACACACAGG + Intronic
1106313386 13:28573245-28573267 GCACGTGCACGCACACACACAGG - Intergenic
1108166015 13:47693901-47693923 GTGCGTGCACACACATGCACAGG - Intergenic
1108473273 13:50788388-50788410 GTGTTTTCACACACACGCACAGG - Intronic
1109173811 13:59129944-59129966 GAGCGTGCACACACACACACAGG + Intergenic
1109386735 13:61638997-61639019 GCGCGCGCGCACACACACAGTGG + Intergenic
1109529222 13:63619237-63619259 ACGTGTGCACACACACACACAGG + Intergenic
1110706261 13:78603706-78603728 GCGCGCGCGCGCAGACGCACGGG - Intergenic
1113269002 13:108652138-108652160 GCGCGCACACACACACACATTGG - Intronic
1113503932 13:110799963-110799985 GCTCTTCCACACACACACACTGG + Intergenic
1113558967 13:111262397-111262419 ACACATGCACACACACACACAGG - Intronic
1117411917 14:55457639-55457661 ATGCGTGCACATACACACACCGG - Intergenic
1118473176 14:66093925-66093947 GAGCGTGCACACACCTGCCCAGG + Intergenic
1119035590 14:71228004-71228026 GTGCGCACACACACATGCACAGG + Intergenic
1119075783 14:71637117-71637139 ACGCGTGCACACACAGGATCTGG - Intronic
1119612263 14:76073574-76073596 GCACATGCGCACACACACACCGG - Intronic
1120704963 14:87736189-87736211 ACACATGCACACACACACACAGG + Intergenic
1122543177 14:102509065-102509087 CCGCGTCCACACACACTGACTGG + Intronic
1123587929 15:21775414-21775436 ACACATGCACACACACGCACAGG + Intergenic
1123624567 15:22217979-22218001 ACACATGCACACACACGCACAGG + Intergenic
1124441473 15:29689076-29689098 GCGCGTGCACACCCAAGCCTCGG - Intergenic
1124715791 15:32060337-32060359 GCGCGTGCACACACACACACAGG - Intronic
1125703872 15:41713792-41713814 GCGCATGTGCACACACACACAGG + Intronic
1126415513 15:48413980-48414002 ACGCATGCGCACACACCCACAGG - Intronic
1126743947 15:51806348-51806370 GCAGGTGCAGACACATGCACAGG - Intronic
1127041516 15:54982172-54982194 GCACACACACACACACGCACTGG + Intergenic
1129059619 15:72850294-72850316 GTACCTGCACACACACACACAGG + Intergenic
1129188985 15:73926837-73926859 GCCCGTGCACCAGCACGCACAGG - Exonic
1130070682 15:80644418-80644440 GCGCCTGCACGCTCAAGCACAGG - Intergenic
1130340989 15:82999031-82999053 GCGCCTGCAATCACAGGCACTGG + Intronic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1130588213 15:85196879-85196901 GCACGTGCACACACACAAGCTGG - Intergenic
1130766987 15:86880774-86880796 ACACGTGCACACACACACAGAGG - Intronic
1132076098 15:98821859-98821881 ATGTGTGCACACACACACACAGG + Intronic
1132227326 15:100152485-100152507 GCACATACACACACAAGCACAGG - Intronic
1132543448 16:522018-522040 GCGCGCGCACACACACGCAGCGG - Exonic
1132726321 16:1340111-1340133 GCAGGTGCACACAGATGCACAGG + Intronic
1133285896 16:4690673-4690695 CCGAGTGCACACACATGCATGGG - Exonic
1133456890 16:5950257-5950279 GCAGGTGCACAGACACCCACAGG - Intergenic
1133511080 16:6457971-6457993 GCGTGTGCACACACATACATAGG + Intronic
1133822836 16:9252216-9252238 ATGCATGCACACACACACACAGG - Intergenic
1133899302 16:9958424-9958446 ACACATGCACACACACACACAGG + Intronic
1136399825 16:30011184-30011206 GCGCGCGCACACTCACGCAGGGG + Intronic
1137437049 16:48464103-48464125 TCACGTGCACACACACTCATAGG - Intergenic
1137523163 16:49211074-49211096 GCGCCTGCAATCACAGGCACTGG + Intergenic
1138532895 16:57644682-57644704 GCACAAGCACACACATGCACGGG + Intronic
1138561373 16:57802581-57802603 GCGCCCGCACTCACGCGCACTGG + Exonic
1138953772 16:61946141-61946163 GTGCATGCACACACACACAGAGG + Intronic
1139390415 16:66604114-66604136 GCGCGCGCGCAAACACACACAGG - Exonic
1139615479 16:68085885-68085907 GCGCGCGCACACACACACACAGG - Intronic
1141520921 16:84578669-84578691 AAGTGTGCACACACACACACAGG + Intronic
1141990211 16:87604978-87605000 GCGCGCGCACACACACACACAGG - Intronic
1142106397 16:88305560-88305582 ACACGTGCACACACGCTCACAGG + Intergenic
1142116012 16:88356467-88356489 GCATGTGTACACACACACACAGG - Intergenic
1142116013 16:88356489-88356511 GCACATGTACACACACACACAGG - Intergenic
1142257730 16:89023344-89023366 ACGCATACACACACACTCACAGG + Intergenic
1142410597 16:89914180-89914202 ATACGTGCACACACACACACAGG - Intronic
1142731434 17:1861117-1861139 TCGTGTCCACACACACACACGGG + Intronic
1142975595 17:3642040-3642062 CCGGGTACACACACACACACAGG - Intronic
1142984914 17:3689968-3689990 ACGCGCGCACACACACCCCCAGG + Intronic
1144037255 17:11378345-11378367 GTGCGCGCACATGCACGCACTGG + Intronic
1144754087 17:17669024-17669046 GCGCGCACACACACACACACGGG + Intergenic
1145253675 17:21311053-21311075 ACACATGCACACACACGCAGTGG + Intronic
1145322911 17:21776908-21776930 ACACATGCACACACACGCAGTGG - Intergenic
1146102224 17:29994192-29994214 ACACGTGCACACACACGCGGTGG + Intronic
1146498782 17:33346511-33346533 GCATGTGCACACACATACACAGG - Intronic
1146845958 17:36182337-36182359 GCGTGCACACACACACACACAGG - Intronic
1147018391 17:37510847-37510869 GCGCCTGCCCACACACACCCAGG - Intronic
1147726219 17:42567477-42567499 GCGCTTGCACACACACAGCCCGG - Intronic
1147947271 17:44087093-44087115 GTGTGTGTACACACACGCACAGG + Intronic
1148160191 17:45445246-45445268 GCACATGCACACACACACAGGGG - Intronic
1148826446 17:50397571-50397593 GGGCGTGCCCGCACACGCTCGGG - Intergenic
1149514748 17:57272132-57272154 GTGCATGCACAAACACACACAGG - Intronic
1150446885 17:65233021-65233043 GCGTGTGCACACAAGCGCCCAGG + Intergenic
1150489111 17:65562109-65562131 GCACGTGCACAAGCGCGCACAGG - Intronic
1151411149 17:73930669-73930691 GCGCCTGCTCACACACCCCCAGG + Intergenic
1152231081 17:79114505-79114527 GCCCCTGCCCACACATGCACCGG + Intronic
1152290905 17:79439696-79439718 GCACATGCACACACACTCAGTGG + Intronic
1152309350 17:79540137-79540159 ACGCATGCACACACACTCACAGG + Intergenic
1152855052 17:82660416-82660438 ACACGTGTAAACACACGCACAGG + Intronic
1152855060 17:82660619-82660641 ACGTGCACACACACACGCACAGG + Intronic
1153567416 18:6432184-6432206 GCGCGCACACACACACACAGTGG - Intergenic
1153985409 18:10346547-10346569 GCGCGCACACGCACACACACAGG + Intergenic
1154423104 18:14251858-14251880 GCGCGCACACACACACACACAGG + Intergenic
1155807672 18:30192458-30192480 GCGCCTGCACACACCAGCAGGGG - Intergenic
1156099774 18:33578849-33578871 GCGCGCGCACGCACACACACAGG - Intronic
1156227219 18:35120977-35120999 GCGTGTGCACACACACATGCAGG - Intronic
1156501156 18:37559293-37559315 GTGTGTGCATACACACACACAGG - Intronic
1156504257 18:37578994-37579016 GCGCGTACACACACACACACAGG - Intergenic
1157097259 18:44697171-44697193 GCGCGTGTGAGCACACGCACAGG - Intronic
1157678163 18:49583005-49583027 GCACGTGCACACTTACACACAGG + Intronic
1157985671 18:52435284-52435306 ACACGTGCACACACACACACAGG - Intronic
1158238189 18:55343862-55343884 ACGCGTGCACACACACATCCGGG + Intronic
1159989608 18:74888913-74888935 GCACGTTCACACACACACATAGG + Intronic
1160621883 18:80177078-80177100 GCGCGCACACACACACACACGGG + Intronic
1160696094 19:485199-485221 ACACGTACACACACACACACAGG + Intergenic
1161003289 19:1921957-1921979 GCTTATGCACACACATGCACGGG - Intronic
1161227976 19:3156516-3156538 ACACATGCACGCACACGCACAGG + Intronic
1161280864 19:3444900-3444922 GTGCTTGCACGCACACGTACAGG - Intronic
1161353787 19:3808044-3808066 ACACATGCACGCACACGCACGGG - Intronic
1161353794 19:3808126-3808148 ACACGGGCACACATACGCACGGG - Intronic
1161353799 19:3808172-3808194 GCACGTGCATGCACACGCACAGG - Intronic
1161358117 19:3830889-3830911 ACGCATGCACACACACACACGGG + Intronic
1164592714 19:29515051-29515073 GCACGCACACACACACACACAGG + Intergenic
1167373656 19:49099915-49099937 GCACATACACACACACACACAGG - Intronic
1167621820 19:50564938-50564960 GTGCCTGCACACACACCCTCAGG - Intronic
1167649273 19:50720479-50720501 GCGCGCGCACACACGCACACAGG + Intergenic
925119697 2:1408595-1408617 GCACGTGCCCACCCACTCACAGG - Intronic
925241448 2:2333970-2333992 GCACCTGCACACACACACGCAGG + Intergenic
925927839 2:8682942-8682964 GCGCGCGCACACACACCGAGGGG - Intronic
927110295 2:19859650-19859672 TCACATGCACACACACACACAGG + Intergenic
927527321 2:23757235-23757257 GCACGTACACACACACACAGAGG - Intronic
928185555 2:29107291-29107313 TCACATGCACACACACACACAGG - Intronic
928763057 2:34607062-34607084 ACACGTTCACACACACACACGGG + Intergenic
929880705 2:45835031-45835053 ACGTGTGCAAACACACTCACAGG - Intronic
931960472 2:67476914-67476936 GCGTGTGCTCACACACACACAGG - Intergenic
932059836 2:68484963-68484985 GCGCACACACACACACACACAGG - Intronic
934501105 2:94861183-94861205 GTGTGTGTACACACACGCGCAGG - Intergenic
934837026 2:97599917-97599939 GCACGTGCACAGACACACATAGG - Intergenic
935407725 2:102726620-102726642 GCACGCACACACACACACACAGG + Intronic
936531994 2:113282966-113282988 ACGCCTGCACCCACAGGCACGGG - Intergenic
937018832 2:118632382-118632404 GCGTGTGCACACACATGGACTGG + Intergenic
937205983 2:120237491-120237513 GCGTGTGCACACGCACACATGGG + Intergenic
937392363 2:121500915-121500937 GCACGTGCACACACACATAAAGG + Intronic
937395138 2:121528620-121528642 GCACGTGCATGCACGCGCACTGG + Intronic
938557289 2:132437170-132437192 ACAAGTGCACACACCCGCACAGG + Intronic
939704187 2:145431584-145431606 GCGTGCTCACACACACACACTGG - Intergenic
940305684 2:152223590-152223612 GCGCGCACACACACATACACAGG + Intergenic
940712813 2:157182879-157182901 GCACATACACACACACACACAGG + Intergenic
941746951 2:169096972-169096994 GCACGTGCACACACACACAGAGG + Intergenic
946879977 2:224167599-224167621 ATACGTGCACACACACACACAGG + Intergenic
948118862 2:235514139-235514161 GCGCGCGCACGCGCATGCACTGG - Intronic
948640455 2:239372490-239372512 ACGCGCGCACACACACAGACAGG + Intronic
948769861 2:240246137-240246159 ACACGTGCACACACACACAGAGG + Intergenic
1171051460 20:21862969-21862991 GCGCATGCACACACACGAGTGGG - Intergenic
1171249045 20:23634881-23634903 CCACATGCACACACACACACAGG + Intronic
1171317513 20:24208377-24208399 TTGCGCGCACACACACACACAGG - Intergenic
1172823105 20:37756425-37756447 ACGGGTGCACACACACACAACGG - Intronic
1172841291 20:37903945-37903967 GCGCGCGCGCACACACACACAGG + Intronic
1173087145 20:39933892-39933914 GTGTGTGTACACACACACACTGG + Intergenic
1173368206 20:42408379-42408401 ACACATACACACACACGCACGGG - Intronic
1174162539 20:48561939-48561961 GGGCGTGCACGCACACCCAGGGG - Intergenic
1175499936 20:59442547-59442569 GCACGGGCACACACAGGCACAGG - Intergenic
1175728113 20:61333223-61333245 ACGCATGCACACATATGCACAGG + Intronic
1176058938 20:63163612-63163634 GAGTGCGCACACACACACACAGG + Intergenic
1176200602 20:63858599-63858621 GAGCGTGCACCCACCCCCACAGG - Intergenic
1178433050 21:32533558-32533580 GCACGAGCACACAGACACACAGG - Intergenic
1179116200 21:38494817-38494839 GTGCATGCACACACAGGCAGAGG + Intronic
1179975294 21:44862077-44862099 GCTCTTACACACACACACACGGG - Intronic
1180055024 21:45353175-45353197 GTATGTGCACACACATGCACAGG + Intergenic
1180172813 21:46068723-46068745 ACACGTGCACACACACACCCAGG - Intergenic
1180954517 22:19735688-19735710 GCACATCCACACACACACACAGG - Intergenic
1181405591 22:22682600-22682622 ACGCATGCATACACACACACAGG - Intergenic
1181786185 22:25228903-25228925 ACATGTACACACACACGCACAGG - Intronic
1181861851 22:25825077-25825099 ACACGTGCACACATATGCACAGG + Intronic
1182882476 22:33745460-33745482 GTCAGGGCACACACACGCACTGG - Intronic
1183148176 22:36014758-36014780 GCGCATGCACACACAGATACAGG + Intronic
1183278137 22:36914197-36914219 GCACATGCACATACACACACAGG - Intronic
1183369890 22:37426605-37426627 ACGCACGCACACACACACACTGG + Intronic
1183664993 22:39242069-39242091 GCACGTACACAGGCACGCACGGG - Intronic
1183730962 22:39618250-39618272 ACACTTGCACACACACACACAGG - Intronic
1184127035 22:42494780-42494802 GCGTGCGCACACACATGCATAGG + Intergenic
1184241815 22:43214994-43215016 ACACGTGCACACACAGGCATGGG - Intronic
1184779456 22:46639591-46639613 GGGCATGCACACGCACACACAGG - Intronic
1184990631 22:48167065-48167087 ACTCATGCACACACATGCACGGG + Intergenic
1185018424 22:48359064-48359086 GGGCGTGCGCACACAAGCCCCGG + Intergenic
1185132868 22:49050022-49050044 GCGTGTGCACAGAGACGCACAGG + Intergenic
1185285919 22:49999814-49999836 GCGCGGGCGCTCACTCGCACAGG + Exonic
949321255 3:2813092-2813114 GTGCATCCACACACACACACAGG + Intronic
950747453 3:15101851-15101873 GCACGTGCACACAGATGCTCTGG + Intergenic
951803363 3:26622073-26622095 GCGCTCGCACACACACACACTGG + Intergenic
952998359 3:38906931-38906953 GCACGCGCATACACACACACTGG + Intronic
955703194 3:61702521-61702543 ACACGTGTACACACACACACAGG + Intronic
955925701 3:64002510-64002532 GAGTATACACACACACGCACAGG - Exonic
957664849 3:83214539-83214561 GCACGCACACACACACACACAGG - Intergenic
959910619 3:111759550-111759572 GTGCATGCATACACACACACGGG - Intronic
961574540 3:127823498-127823520 ACGCGCGCACACAGACCCACAGG + Intergenic
961653167 3:128427510-128427532 GCCCATGCACACACACCTACAGG + Intergenic
962304899 3:134277495-134277517 GTGTGTGCATGCACACGCACAGG + Intergenic
962851556 3:139312110-139312132 ACACATGCACACACACACACAGG - Intronic
963281944 3:143392709-143392731 TCACGTGCAGAGACACGCACAGG + Intronic
963956971 3:151264760-151264782 ACACATACACACACACGCACTGG - Intronic
965845698 3:172958768-172958790 GTGCGTGCACACACACAAAGAGG - Intronic
968151260 3:196338429-196338451 GCGCGCACACACACACGCCTGGG - Intronic
968522741 4:1041459-1041481 GCGCCAGCACACACATGCAGGGG - Intergenic
968653398 4:1768723-1768745 ACGCAGGCACACACAGGCACAGG + Intergenic
968789152 4:2647531-2647553 GGGAGTGCAGACACATGCACAGG + Intronic
968866916 4:3218932-3218954 ACACGTGCACACACACACACAGG - Intronic
968977453 4:3829414-3829436 ACTCGTTCACACACATGCACGGG + Intergenic
969238473 4:5884476-5884498 ATGCATGCACACACACACACGGG + Intronic
969504878 4:7579354-7579376 GTGCGTGCACACACACACACGGG - Intronic
969613448 4:8239365-8239387 GCACACGCACACACAGGCACAGG + Intronic
969662813 4:8540241-8540263 GCTCGTGCACACACAGGACCAGG + Intergenic
969706035 4:8792180-8792202 ACGCGTGCACGCACACACAGAGG + Intergenic
969706057 4:8792400-8792422 ACGCGTACACACACACACAGAGG + Intergenic
969706083 4:8792692-8792714 ACACGTGCACACACACACAGAGG + Intergenic
970826544 4:20283097-20283119 GCGCGCGCACACAGGCACACAGG - Intronic
971031799 4:22645753-22645775 GTGTGTACACACACACACACAGG + Intergenic
971159894 4:24123031-24123053 GTGTGTGCAAACACACGCACTGG + Intergenic
971779899 4:31019790-31019812 GCACATGCACACACACCCACAGG + Intronic
973274246 4:48291892-48291914 GCGCCTGCAATCACAGGCACTGG - Intergenic
976689764 4:87856102-87856124 ACACATGCACACACACACACAGG + Intergenic
977323891 4:95550448-95550470 ACGCATGCACACACACACGCAGG + Intergenic
977583077 4:98746129-98746151 ACGCATGCACACACACGATCAGG + Intergenic
979446406 4:120818252-120818274 GCGTGCACACACACACACACAGG + Intronic
982074172 4:151721871-151721893 CCGTGTGCACACAAGCGCACGGG + Intronic
982564995 4:156974767-156974789 GTGCATGCACACACACACAGAGG + Intergenic
983895283 4:173074890-173074912 GCGTGCACACACACACACACGGG + Intergenic
984816191 4:183839019-183839041 GCGCGCACACACACACACACAGG + Intergenic
985053071 4:186012238-186012260 GTGTGTGCACACACACGCATAGG + Intergenic
985780853 5:1870517-1870539 ACGCATGCACTCACACTCACAGG - Intergenic
985780858 5:1870625-1870647 ACGCATGCACTCACACTCACAGG - Intergenic
985780860 5:1870665-1870687 ACGCATGCACTCACACTCACAGG - Intergenic
985780876 5:1871009-1871031 ACGCATGCACTCACACTCACAGG - Intergenic
985780884 5:1871191-1871213 ACGCATGCACTCACACTCACAGG - Intergenic
985795741 5:1960992-1961014 ACAAGTGCACACACACACACCGG + Intergenic
985848147 5:2369521-2369543 ACGCATGCACACACAGACACAGG + Intergenic
985927825 5:3031519-3031541 ACACAGGCACACACACGCACAGG - Intergenic
985958625 5:3282872-3282894 ACACGGGCACAGACACGCACAGG + Intergenic
985958628 5:3282900-3282922 ACACGGGCACAGACACGCACAGG + Intergenic
985958645 5:3283084-3283106 ACACGGGCACAGACACGCACAGG + Intergenic
985958651 5:3283140-3283162 ACACGGGCACAGACACGCACAGG + Intergenic
985958661 5:3283260-3283282 ACACGGGCACAGACACGCACGGG + Intergenic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
987072220 5:14349267-14349289 GTGCGTACACACATACACACAGG - Intronic
987274841 5:16351639-16351661 GCGCGCGCACACACACACACAGG + Intergenic
988007033 5:25428134-25428156 GTCCAGGCACACACACGCACAGG + Intergenic
989198656 5:38741516-38741538 GCGCGCACACACACACACACAGG + Intergenic
989633345 5:43510565-43510587 GCGCCTGCAATCACAGGCACTGG - Intronic
989747349 5:44845822-44845844 GCGTGCACACACACACACACGGG + Intergenic
989861969 5:46389101-46389123 TCACGTGCACAGACACACACAGG - Intergenic
990008453 5:50968570-50968592 ACGCACGCACACACACACACCGG + Intergenic
990068798 5:51752815-51752837 GCGCGCACACACACACACACAGG + Intergenic
990321059 5:54630322-54630344 GCACACGCACACACACACACAGG - Intergenic
991611131 5:68450682-68450704 GTGTGTGCACACACACATACAGG + Intergenic
993506900 5:88720209-88720231 ACTCATACACACACACGCACAGG - Exonic
993811436 5:92482874-92482896 GCGTGTGCACACACACACGCAGG + Intergenic
993822435 5:92635278-92635300 GCGCGTGCACATACACACACAGG + Intergenic
993899054 5:93572201-93572223 GCACGTACACACACTCACACGGG + Intergenic
994250214 5:97527557-97527579 GCGCACGCACACACACACACTGG - Intergenic
994488623 5:100411460-100411482 GCACGCACACACACACACACTGG - Intergenic
994495878 5:100512766-100512788 GCGCACACACACACACACACAGG + Intergenic
996487255 5:124051200-124051222 GTGCGTGCATACACACACAGTGG - Intergenic
997833092 5:137169517-137169539 GCCCAGGCACACACACCCACTGG + Intronic
998963272 5:147510197-147510219 GCGCGCGCACACGCACACACAGG + Intergenic
999438174 5:151580593-151580615 GTGCTCGCACACACACACACGGG + Intergenic
1000003788 5:157164689-157164711 GCACGTGCATACACACACACAGG + Intronic
1000294830 5:159903957-159903979 GCACGTGCACACACACATACAGG - Intergenic
1001207398 5:169777165-169777187 GTGCATGCACACACACACAGAGG + Intronic
1002803390 6:548662-548684 ACGCGTGCACACACAGCCGCTGG - Intronic
1002861999 6:1087640-1087662 GCCCATGCGCACACACGCACAGG + Intergenic
1003877711 6:10452945-10452967 GCACGTGCACACACACACACAGG - Intergenic
1004637052 6:17479206-17479228 GTGTGTGTACACACACGTACAGG - Intronic
1006913035 6:37576384-37576406 GCACATGTACACACACGCACAGG - Intergenic
1007709351 6:43811939-43811961 CCGAGTGCACACACTCCCACTGG - Intergenic
1007775596 6:44222917-44222939 CCGCGCGCACACGCAAGCACAGG + Intronic
1007829476 6:44627402-44627424 ACACGTGCACACACACACACGGG - Intergenic
1010235577 6:73572515-73572537 GTGCGGGCGCACGCACGCACTGG - Intergenic
1012399029 6:98829328-98829350 GTGCGCGCACACGCACACACAGG - Intergenic
1012448407 6:99329847-99329869 ACGCGTGCACACATACACACAGG - Intronic
1012448408 6:99329864-99329886 ACGCGTGCACACATACACACAGG + Intronic
1014408699 6:121086852-121086874 GCGCATACACACACACAAACAGG - Intronic
1016636810 6:146302286-146302308 GTGCGTGCACACACACAAGCAGG + Intronic
1017175082 6:151494767-151494789 GCTCGTGCACACACGCGAACAGG + Intronic
1018798134 6:167202965-167202987 GGATGTGCACACACACACACGGG + Intergenic
1018814581 6:167321211-167321233 GGATGTGCACACACACACACGGG - Intergenic
1019205476 6:170358087-170358109 GCACGTACAGGCACACGCACAGG - Intronic
1019295736 7:273058-273080 TCGTGTGCACACACACACCCAGG + Intergenic
1019323406 7:425812-425834 GCACACGCACACACACACACAGG - Intergenic
1019601803 7:1887842-1887864 ACGTGCACACACACACGCACAGG - Intronic
1019601805 7:1887894-1887916 ATGCATGCACACACATGCACAGG - Intronic
1019601812 7:1888006-1888028 ACGCATGCACACACACGTACAGG - Intronic
1019601824 7:1888143-1888165 ACACATGCACACACATGCACAGG - Intronic
1019601827 7:1888205-1888227 ATGCATGCACACACATGCACAGG - Intronic
1019601832 7:1888273-1888295 ATGCATGCACACACATGCACAGG - Intronic
1019601833 7:1888311-1888333 ACGCATGCACACACACACATAGG - Intronic
1019601835 7:1888341-1888363 ATGCATGCACACACATGCACAGG - Intronic
1019601837 7:1888379-1888401 ACGCATGCACACACACGCATAGG - Intronic
1019601841 7:1888437-1888459 ATGCGTGCACACACATGTACAGG - Intronic
1019601845 7:1888503-1888525 ACGCATGCACACACACGAACAGG - Intronic
1019601847 7:1888535-1888557 GCATGCTCACACACACGCACAGG - Intronic
1019740280 7:2669586-2669608 ACACGTGCCCACACACGAACAGG + Intergenic
1020649184 7:10854745-10854767 GAGCGTGCACACACCCGGCCAGG - Intergenic
1021533735 7:21679024-21679046 GCCCATGCACACACACACAGAGG + Intronic
1021585621 7:22204403-22204425 GCTCATTGACACACACGCACAGG - Intronic
1023095288 7:36654112-36654134 GTGTGTACGCACACACGCACAGG - Intronic
1023315750 7:38934601-38934623 ACGCGTGCACACACACACGGTGG + Intergenic
1023743701 7:43302949-43302971 ATGCGCGCACACACACACACAGG + Intronic
1024890886 7:54201666-54201688 GCACAGGCACACACACACACAGG + Intergenic
1024970779 7:55068107-55068129 ACACATGCACACACACACACAGG - Intronic
1026183589 7:68063439-68063461 ACGCCTGCACTCACACACACAGG - Intergenic
1028190544 7:87845542-87845564 GCTCATGCACACACACACACAGG + Intronic
1029438358 7:100574628-100574650 GCGCGCACACACACACACACAGG + Intronic
1030291897 7:107880989-107881011 ACGCGCACACACACACACACCGG - Intergenic
1031547465 7:123068183-123068205 GCGTGTGCACACACTTGTACTGG + Intergenic
1032379807 7:131466929-131466951 GCGCGCGCACACACGCACGCAGG + Intronic
1033991670 7:147295250-147295272 ACGCATGCACACACACACATGGG - Intronic
1034895509 7:154873852-154873874 CCACATGCACACACACCCACAGG + Intronic
1035069300 7:156129657-156129679 GCCCGAGCACACGCACGCCCTGG + Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035636243 8:1146594-1146616 GTGCATGCACACACATGCGCAGG - Intergenic
1035891522 8:3348984-3349006 ACGGGTGCACACACACACAGAGG + Intronic
1035958012 8:4104432-4104454 ACGCATGCACACACACACACAGG + Intronic
1036218790 8:6903397-6903419 ACGGGTGCACATACACACACAGG + Intergenic
1036772221 8:11587161-11587183 GTGTGTGCGCACACACGCATGGG - Intergenic
1039664145 8:39504110-39504132 ACACATGCACACACACTCACAGG + Intergenic
1040710185 8:50178407-50178429 GCGCACACACACACACACACAGG + Intronic
1040759346 8:50819970-50819992 ACGCATGCACACACACACCCAGG - Intergenic
1042663787 8:71184074-71184096 ACATGTGCACACACAAGCACAGG - Intergenic
1043669051 8:82858486-82858508 ACGCTTGCACACACTCACACAGG - Intergenic
1044388697 8:91622774-91622796 GTGTCTGCACACACACACACAGG + Intergenic
1048632660 8:136260852-136260874 GCACACGCACACACACGCACAGG - Intergenic
1048882192 8:138880335-138880357 GCGCGTGCACACACACGCACAGG - Intronic
1049187607 8:141266246-141266268 GCGCATGTACACGCACGCATGGG + Intronic
1049667571 8:143853254-143853276 GACCTTGCACACACACGCTCTGG - Intergenic
1049760753 8:144331056-144331078 CCGCATGCACACGCACACACAGG - Exonic
1049816038 8:144601307-144601329 ACGCCTCCACACACACACACAGG - Intronic
1049816071 8:144601800-144601822 ACGCCTCCACACACACACACAGG - Intronic
1050243373 9:3660885-3660907 ACACATGCACACACACACACAGG - Intergenic
1054987160 9:71275487-71275509 ACATGTGCACACACACACACGGG - Intronic
1056814347 9:89790794-89790816 TCACATGCACACACACACACAGG - Intergenic
1057840996 9:98485500-98485522 ACGCAGGCACACACACACACAGG + Intronic
1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG + Intergenic
1058251468 9:102702005-102702027 GCAAGGACACACACACGCACAGG + Intergenic
1058264326 9:102878781-102878803 GCGCACACACACACACACACAGG - Intergenic
1059484911 9:114619270-114619292 ACGCGTGCACGCACGCGCAGAGG - Intronic
1059625407 9:116059329-116059351 GTGCATGCACACGCACACACAGG - Intergenic
1060204835 9:121676338-121676360 GGACGTGCGCACACACACACAGG - Intronic
1060369803 9:123057924-123057946 GCGCCTGCAATCACAGGCACTGG + Intronic
1061058832 9:128240169-128240191 GCTCGTGCACACAGATGGACGGG - Intronic
1061083918 9:128388376-128388398 GCACATGCACACACACTCACTGG + Intronic
1061303728 9:129720931-129720953 GCTCGTGAACACCCACTCACAGG - Intronic
1061330573 9:129889895-129889917 GCAGGTACACACACACCCACAGG - Exonic
1062025756 9:134339466-134339488 GGGCATGCACACCCACACACAGG - Intronic
1062025774 9:134339748-134339770 GGGTGTGCACAGACACACACGGG - Intronic
1185642373 X:1595619-1595641 GCATGCACACACACACGCACAGG - Intronic
1185642385 X:1595804-1595826 ACACGTGCACATACACACACAGG - Intronic
1186453034 X:9689069-9689091 ACTTGTGCACACACACGCACAGG - Intronic
1187039208 X:15575571-15575593 GCGTGTACACACACACACAGAGG - Intronic
1187977568 X:24718705-24718727 GCGTGTGCACACACACGTGGAGG + Intronic
1189222851 X:39387621-39387643 GCATGTGCACACACACACAGAGG + Intergenic
1189263776 X:39698046-39698068 GCGTGTGCACACACACACACAGG - Intergenic
1190096117 X:47482592-47482614 GCGCACGCGCACGCACGCACCGG - Exonic
1193593530 X:83419311-83419333 GTGCATGCACACACGTGCACTGG - Intergenic
1194469771 X:94278961-94278983 GCGCGCACACACACACACACAGG + Intergenic
1196261093 X:113582567-113582589 GCACGCACACACACACACACAGG - Intergenic
1199506161 X:148563490-148563512 CAGCATGCACACACACACACAGG - Intronic
1199662377 X:150064909-150064931 GCACATGCACGCACACACACAGG - Intergenic
1201985073 Y:19957119-19957141 GTGCGTGCACATACACACACTGG - Intergenic