ID: 1048886778

View in Genome Browser
Species Human (GRCh38)
Location 8:138915263-138915285
Sequence GTGCCCAGAGGCGCACGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048886778_1048886784 25 Left 1048886778 8:138915263-138915285 CCAGCGCGTGCGCCTCTGGGCAC No data
Right 1048886784 8:138915311-138915333 AGCAACTCCATCTTGAATAGGGG 0: 300
1: 439
2: 392
3: 341
4: 375
1048886778_1048886782 23 Left 1048886778 8:138915263-138915285 CCAGCGCGTGCGCCTCTGGGCAC No data
Right 1048886782 8:138915309-138915331 AGAGCAACTCCATCTTGAATAGG 0: 472
1: 704
2: 648
3: 448
4: 325
1048886778_1048886783 24 Left 1048886778 8:138915263-138915285 CCAGCGCGTGCGCCTCTGGGCAC No data
Right 1048886783 8:138915310-138915332 GAGCAACTCCATCTTGAATAGGG 0: 297
1: 452
2: 484
3: 409
4: 345
1048886778_1048886780 -9 Left 1048886778 8:138915263-138915285 CCAGCGCGTGCGCCTCTGGGCAC No data
Right 1048886780 8:138915277-138915299 TCTGGGCACACTAGTGTCAGAGG No data
1048886778_1048886785 29 Left 1048886778 8:138915263-138915285 CCAGCGCGTGCGCCTCTGGGCAC No data
Right 1048886785 8:138915315-138915337 ACTCCATCTTGAATAGGGGCTGG 0: 380
1: 729
2: 670
3: 480
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048886778 Original CRISPR GTGCCCAGAGGCGCACGCGC TGG (reversed) Intergenic
No off target data available for this crispr