ID: 1048897161

View in Genome Browser
Species Human (GRCh38)
Location 8:139002236-139002258
Sequence GACAAGTAAATGCACAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048897161_1048897169 25 Left 1048897161 8:139002236-139002258 CCTGCCCTGTGCATTTACTTGTC No data
Right 1048897169 8:139002284-139002306 TCCCTTTACTTGTCACAGACTGG No data
1048897161_1048897171 26 Left 1048897161 8:139002236-139002258 CCTGCCCTGTGCATTTACTTGTC No data
Right 1048897171 8:139002285-139002307 CCCTTTACTTGTCACAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048897161 Original CRISPR GACAAGTAAATGCACAGGGC AGG (reversed) Intergenic
No off target data available for this crispr