ID: 1048897162

View in Genome Browser
Species Human (GRCh38)
Location 8:139002240-139002262
Sequence CTGTGACAAGTAAATGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048897162_1048897169 21 Left 1048897162 8:139002240-139002262 CCCTGTGCATTTACTTGTCACAG No data
Right 1048897169 8:139002284-139002306 TCCCTTTACTTGTCACAGACTGG No data
1048897162_1048897171 22 Left 1048897162 8:139002240-139002262 CCCTGTGCATTTACTTGTCACAG No data
Right 1048897171 8:139002285-139002307 CCCTTTACTTGTCACAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048897162 Original CRISPR CTGTGACAAGTAAATGCACA GGG (reversed) Intergenic
No off target data available for this crispr