ID: 1048897169

View in Genome Browser
Species Human (GRCh38)
Location 8:139002284-139002306
Sequence TCCCTTTACTTGTCACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048897163_1048897169 20 Left 1048897163 8:139002241-139002263 CCTGTGCATTTACTTGTCACAGG No data
Right 1048897169 8:139002284-139002306 TCCCTTTACTTGTCACAGACTGG No data
1048897161_1048897169 25 Left 1048897161 8:139002236-139002258 CCTGCCCTGTGCATTTACTTGTC No data
Right 1048897169 8:139002284-139002306 TCCCTTTACTTGTCACAGACTGG No data
1048897162_1048897169 21 Left 1048897162 8:139002240-139002262 CCCTGTGCATTTACTTGTCACAG No data
Right 1048897169 8:139002284-139002306 TCCCTTTACTTGTCACAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048897169 Original CRISPR TCCCTTTACTTGTCACAGAC TGG Intergenic
No off target data available for this crispr